psbK, psbK (gene) Gossypium areysianum

Gene Overview
Name psbK
Gene Symbol psbK
Type gene
Organism Gossypium areysianum
Synonym photosystem II protein K
Description NA
Comment PSII K protein
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
JN019795.1-psbK N/A JN019795.1
NC_018112.1-psbK.m5 N/A NC_018112.1
JN019795.1-psbK.m5 N/A JN019795.1
NC_018112.1-psbK N/A NC_018112.1

Sequence(s):
>JN019795.1-psbK186
atgcttaatatctttaatttgatctgtatctgttttaattctgcccttttttcgagtagttttttattggccaaattgcc
cgaggcctatgcttttttgaatccaatcgtagattttatgccagtaatacctgttctcttttttctcttagcctttgttt
ggcaagctgctgtaagttttcgatga
back to top
>NC_018112.1-psbK.m5186
atgcttaatatctttaatttgatctgtatctgttttaattctgcccttttttcgagtagttttttattggccaaattgcc
cgaggcctatgcttttttgaatccaatcgtagattttatgccagtaatacctgttctcttttttctcttagcctttgttt
ggcaagctgctgtaagttttcgatga
back to top
>JN019795.1-psbK.m5186
atgcttaatatctttaatttgatctgtatctgttttaattctgcccttttttcgagtagttttttattggccaaattgcc
cgaggcctatgcttttttgaatccaatcgtagattttatgccagtaatacctgttctcttttttctcttagcctttgttt
ggcaagctgctgtaagttttcgatga
back to top
>NC_018112.1-psbK186
atgcttaatatctttaatttgatctgtatctgttttaattctgcccttttttcgagtagttttttattggccaaattgcc
cgaggcctatgcttttttgaatccaatcgtagattttatgccagtaatacctgttctcttttttctcttagcctttgttt
ggcaagctgctgtaagttttcgatga
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
psbKJN019795.1-psbKGossypium areysianumgene
psbKNC_018112.1-psbKGossypium areysianumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
psbKNC_018112.1-psbK.m5Gossypium areysianummRNA
psbKJN019795.1-psbK.m5Gossypium areysianummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06