rps16, rps16 (gene) Gossypium areysianum

Gene Overview
Name rps16
Gene Symbol rps16
Type gene
Organism Gossypium areysianum
Synonym ribosomal protein S16
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
JN019795.1-rps16 N/A JN019795.1
NC_018112.1-rps16.m4 N/A NC_018112.1
JN019795.1-rps16.m4 N/A JN019795.1
NC_018112.1-rps16 N/A NC_018112.1

Sequence(s):
>JN019795.1-rps161140
atggtaaaacttcgtttgaaacgatgtggtagaaagcaacgtgcgacttgaaggacatgatcggctgtggatgtcaaaac
ccaccactttccgttatgtagaaatgaaggtgctttttgctcgacatcctttgttctattataatccgtctttttgttgg
gttgtaatgtaaatagtacaggatggagctcgaagagaaacatccatttttcaggggcaaggatctagggttagttaatg
gaaatcaataagttggaacaacttcgtaaatctatttgtgatatagaaatcgaaaggatccgattcaaactattttcaaa
tcaaaaagaaaagttgttggaattggtaaaactctttcgatcaaaagtgtatcatgcgggaattaatcgttcatatgatt
ctttgatagaaaaaaagagagaaaaaagggcatgttgctgccatttttgaaatgattaaatatcgccgaagtaatgtcta
aacccaatgattcaaggcaaagataaaagatcctagaacaaggaaatacccttttccattttctcaacaactagattaaa
atgaagaatcgaaatagattctaagcgagacaaacaaaaaaggggttagagaccactcaataaaagaatgcctaaggatt
ttttttttgagcattttgagagttatttgacttgagttatgagagtacgaatgcttttttcttctttttttttttcgaaa
aaaaaaaaaagacggggttaaatgtctaattgatttgctggtttatggatctttttgacattctaattccatacattata
attccatacatagacataacttttaattaatcattttttttctcgagccgtacgaggagaaaacttcttatacgtttcta
gggggggtattatttaactacatctatcccaatgagccgtttatcgaatcgttgcaattgatgttcgatcccgaagagag
ggaagagatcttcgaaaagtgggtttttatgatccgataaataatcaaacctatttaaatgttcccgccattctctattt
ccttgaaaaaggagctcaacccacagcaactgttcatgatattttaaagaaggcgggggtttttacagaacttagtctta
atcaaacaaaattcaattaa
back to top
>NC_018112.1-rps16.m4267
atggtaaaacttcgtttgaaacgatgtggtagaaagcaacgagccgtttatcgaatcgttgcaattgatgttcgatcccg
aagagagggaagagatcttcgaaaagtgggtttttatgatccgataaataatcaaacctatttaaatgttcccgccattc
tctatttccttgaaaaaggagctcaacccacagcaactgttcatgatattttaaagaaggcgggggtttttacagaactt
agtcttaatcaaacaaaattcaattaa
back to top
>JN019795.1-rps16.m4267
atggtaaaacttcgtttgaaacgatgtggtagaaagcaacgagccgtttatcgaatcgttgcaattgatgttcgatcccg
aagagagggaagagatcttcgaaaagtgggtttttatgatccgataaataatcaaacctatttaaatgttcccgccattc
tctatttccttgaaaaaggagctcaacccacagcaactgttcatgatattttaaagaaggcgggggtttttacagaactt
agtcttaatcaaacaaaattcaattaa
back to top
>NC_018112.1-rps161140
atggtaaaacttcgtttgaaacgatgtggtagaaagcaacgtgcgacttgaaggacatgatcggctgtggatgtcaaaac
ccaccactttccgttatgtagaaatgaaggtgctttttgctcgacatcctttgttctattataatccgtctttttgttgg
gttgtaatgtaaatagtacaggatggagctcgaagagaaacatccatttttcaggggcaaggatctagggttagttaatg
gaaatcaataagttggaacaacttcgtaaatctatttgtgatatagaaatcgaaaggatccgattcaaactattttcaaa
tcaaaaagaaaagttgttggaattggtaaaactctttcgatcaaaagtgtatcatgcgggaattaatcgttcatatgatt
ctttgatagaaaaaaagagagaaaaaagggcatgttgctgccatttttgaaatgattaaatatcgccgaagtaatgtcta
aacccaatgattcaaggcaaagataaaagatcctagaacaaggaaatacccttttccattttctcaacaactagattaaa
atgaagaatcgaaatagattctaagcgagacaaacaaaaaaggggttagagaccactcaataaaagaatgcctaaggatt
ttttttttgagcattttgagagttatttgacttgagttatgagagtacgaatgcttttttcttctttttttttttcgaaa
aaaaaaaaaagacggggttaaatgtctaattgatttgctggtttatggatctttttgacattctaattccatacattata
attccatacatagacataacttttaattaatcattttttttctcgagccgtacgaggagaaaacttcttatacgtttcta
gggggggtattatttaactacatctatcccaatgagccgtttatcgaatcgttgcaattgatgttcgatcccgaagagag
ggaagagatcttcgaaaagtgggtttttatgatccgataaataatcaaacctatttaaatgttcccgccattctctattt
ccttgaaaaaggagctcaacccacagcaactgttcatgatattttaaagaaggcgggggtttttacagaacttagtctta
atcaaacaaaattcaattaa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rps16JN019795.1-rps16Gossypium areysianumgene
rps16NC_018112.1-rps16Gossypium areysianumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rps16NC_018112.1-rps16.m4Gossypium areysianummRNA
rps16JN019795.1-rps16.m4Gossypium areysianummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06