psbA, psbA (gene) Gossypium areysianum

Gene Overview
Name psbA
Gene Symbol psbA
Type gene
Organism Gossypium areysianum
Synonym photosystem II protein D1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
JN019795.1-psbA N/A JN019795.1
NC_018112.1-psbA.m2 N/A NC_018112.1
JN019795.1-psbA.m2 N/A JN019795.1
NC_018112.1-psbA N/A NC_018112.1

Sequence(s):
>JN019795.1-psbA1062
atgactgcaattttagagagacgcgaaagcgaaagcctatggggtcgcttctgtaactggataaccagcactgaaaaccg
tctttacatcggatggtttggtgttttgatgatccctaccttattgaccgcaacttctgtatttattatcgccttcattg
ctgctcctccagtagatattgatggtattcgtgaacctgtttctggatctctactttacggaaacaatattatttctggt
gccattattcctacttctgcagctataggtttgcacttttacccgatctgggaagcggcatctgttgatgaatggttata
caatggcggtccttatgagttaattgttttacacttcttacttggtgtagcttgttacatgggtcgtgagtgggaactta
gtttccgtctgggtatgcgtccttggatcgctgttgcatattcagctcctgttgcagctgctaccgctgttttcttgatc
tatccaattggtcaaggaagtttttctgatggtatgcccctaggaatctctggcactttcaacttcatgattgtattcca
ggctgaacacaacatccttatgcatccgtttcacatgttaggcgtagctggtgtattcggcggctccctattcagtgcta
tgcatggttccttggtaacctctagtttgatcagggaaaccacagaaaatgaatctgctaatgaaggttacagattcggt
caagaggaagaaacttataatatcgtagctgctcatggttattttggccgattgatcttccaatatgctagtttcaacaa
ttctcgttctttacatttcttcttagctgcttggcctgtagtaggtatctggttcaccgctttaggtattagcactatgg
ctttcaacctaaacggtttcaattttaaccaatccgtagttgatagtcaaggtcgtgtaattaatacctgggctgatatt
attaaccgtgctaaccttggtatggaagttatgcatgaacgtaatgctcataacttccctctagacctagctgctattga
agctccatctacaaatggataa
back to top
>NC_018112.1-psbA.m21062
atgactgcaattttagagagacgcgaaagcgaaagcctatggggtcgcttctgtaactggataaccagcactgaaaaccg
tctttacatcggatggtttggtgttttgatgatccctaccttattgaccgcaacttctgtatttattatcgccttcattg
ctgctcctccagtagatattgatggtattcgtgaacctgtttctggatctctactttacggaaacaatattatttctggt
gccattattcctacttctgcagctataggtttgcacttttacccgatctgggaagcggcatctgttgatgaatggttata
caatggcggtccttatgagttaattgttttacacttcttacttggtgtagcttgttacatgggtcgtgagtgggaactta
gtttccgtctgggtatgcgtccttggatcgctgttgcatattcagctcctgttgcagctgctaccgctgttttcttgatc
tatccaattggtcaaggaagtttttctgatggtatgcccctaggaatctctggcactttcaacttcatgattgtattcca
ggctgaacacaacatccttatgcatccgtttcacatgttaggcgtagctggtgtattcggcggctccctattcagtgcta
tgcatggttccttggtaacctctagtttgatcagggaaaccacagaaaatgaatctgctaatgaaggttacagattcggt
caagaggaagaaacttataatatcgtagctgctcatggttattttggccgattgatcttccaatatgctagtttcaacaa
ttctcgttctttacatttcttcttagctgcttggcctgtagtaggtatctggttcaccgctttaggtattagcactatgg
ctttcaacctaaacggtttcaattttaaccaatccgtagttgatagtcaaggtcgtgtaattaatacctgggctgatatt
attaaccgtgctaaccttggtatggaagttatgcatgaacgtaatgctcataacttccctctagacctagctgctattga
agctccatctacaaatggataa
back to top
>JN019795.1-psbA.m21062
atgactgcaattttagagagacgcgaaagcgaaagcctatggggtcgcttctgtaactggataaccagcactgaaaaccg
tctttacatcggatggtttggtgttttgatgatccctaccttattgaccgcaacttctgtatttattatcgccttcattg
ctgctcctccagtagatattgatggtattcgtgaacctgtttctggatctctactttacggaaacaatattatttctggt
gccattattcctacttctgcagctataggtttgcacttttacccgatctgggaagcggcatctgttgatgaatggttata
caatggcggtccttatgagttaattgttttacacttcttacttggtgtagcttgttacatgggtcgtgagtgggaactta
gtttccgtctgggtatgcgtccttggatcgctgttgcatattcagctcctgttgcagctgctaccgctgttttcttgatc
tatccaattggtcaaggaagtttttctgatggtatgcccctaggaatctctggcactttcaacttcatgattgtattcca
ggctgaacacaacatccttatgcatccgtttcacatgttaggcgtagctggtgtattcggcggctccctattcagtgcta
tgcatggttccttggtaacctctagtttgatcagggaaaccacagaaaatgaatctgctaatgaaggttacagattcggt
caagaggaagaaacttataatatcgtagctgctcatggttattttggccgattgatcttccaatatgctagtttcaacaa
ttctcgttctttacatttcttcttagctgcttggcctgtagtaggtatctggttcaccgctttaggtattagcactatgg
ctttcaacctaaacggtttcaattttaaccaatccgtagttgatagtcaaggtcgtgtaattaatacctgggctgatatt
attaaccgtgctaaccttggtatggaagttatgcatgaacgtaatgctcataacttccctctagacctagctgctattga
agctccatctacaaatggataa
back to top
>NC_018112.1-psbA1062
atgactgcaattttagagagacgcgaaagcgaaagcctatggggtcgcttctgtaactggataaccagcactgaaaaccg
tctttacatcggatggtttggtgttttgatgatccctaccttattgaccgcaacttctgtatttattatcgccttcattg
ctgctcctccagtagatattgatggtattcgtgaacctgtttctggatctctactttacggaaacaatattatttctggt
gccattattcctacttctgcagctataggtttgcacttttacccgatctgggaagcggcatctgttgatgaatggttata
caatggcggtccttatgagttaattgttttacacttcttacttggtgtagcttgttacatgggtcgtgagtgggaactta
gtttccgtctgggtatgcgtccttggatcgctgttgcatattcagctcctgttgcagctgctaccgctgttttcttgatc
tatccaattggtcaaggaagtttttctgatggtatgcccctaggaatctctggcactttcaacttcatgattgtattcca
ggctgaacacaacatccttatgcatccgtttcacatgttaggcgtagctggtgtattcggcggctccctattcagtgcta
tgcatggttccttggtaacctctagtttgatcagggaaaccacagaaaatgaatctgctaatgaaggttacagattcggt
caagaggaagaaacttataatatcgtagctgctcatggttattttggccgattgatcttccaatatgctagtttcaacaa
ttctcgttctttacatttcttcttagctgcttggcctgtagtaggtatctggttcaccgctttaggtattagcactatgg
ctttcaacctaaacggtttcaattttaaccaatccgtagttgatagtcaaggtcgtgtaattaatacctgggctgatatt
attaaccgtgctaaccttggtatggaagttatgcatgaacgtaatgctcataacttccctctagacctagctgctattga
agctccatctacaaatggataa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
psbAJN019795.1-psbAGossypium areysianumgene
psbANC_018112.1-psbAGossypium areysianumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
psbANC_018112.1-psbA.m2Gossypium areysianummRNA
psbAJN019795.1-psbA.m2Gossypium areysianummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06