rps12, rps12 (gene) Gossypium areysianum

Gene Overview
Name rps12
Gene Symbol rps12
Type gene
Organism Gossypium areysianum
Synonym ribosomal protein S12
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
JN019795.1-rps12 N/A JN019795.1
NC_018112.1-rps12.m1 N/A NC_018112.1
NC_018112.1-rps12.m46 N/A NC_018112.1
JN019795.1-rps12.m1 N/A JN019795.1
JN019795.1-rps12.m46 N/A JN019795.1
NC_018112.1-rps12 N/A NC_018112.1

Sequence(s):
>JN019795.1-rps12908
atgccaactattaaacaacttattagaaatgcaagacagccaattagaaatgtcacgaaatcccctgctcttgggggatg
tcctcagcgccgaggaacatgtactagggtgtatactatcacccccaaaaaaccaaactctgccttacgtaaagttgcca
gagtacgattaacctctgggtttgaaatcactgcttatatacctggtattggccataattcacaagaacattctgtagtc
ttagtaagagggggaagggttaaggatttacccggtgtgagatatcacattgttcgaggaaccctagatgctgtcggagt
aaaggatcgtcaacaagggcgttctagtgcgttgtagattcttatccaagacttgtatcatttgatgatgccatgtgaat
cgctagaaacatgtgaagtgtatggctaacccaataacgaaagtttcgtaaggggactggagcaggctaccatgagacaa
aagatcttctttctaaagagattcgattcggaactattatatgtccaaggtccaatattgaaataatttcagaggttttc
cctgactttgtccgtgtcaacaaacaattcgaaatgcctcgactcttttagaacaggtccgggtcaaatagcaatgattc
gaagcacttctttttacactatttcggaaacccaaggactcaatcgtatggatatgtaaaatacaggatttccaatccta
gcaggaaagggagggaaacggatactcaatttaaagtgagtaaacagaattccatactcgatctcatagatacatatgga
attctgtggaaaaccgtattcgatgaaagtcgtatgtacggcttggagggagatctttcatatctttcgagatccaccct
acaatatggggtcaaaaagccaaaataa
back to top
>NC_018112.1-rps12.m1381
atgccaactattaaacaacttattagaaatgcaagacagccaattagaaatgtcacgaaatcccctgctcttgggggatg
tcctcagcgccgaggaacatgtactagggtgtatactatcacccccaaaaaaccaaactctgccttacgtaaagttgcca
gagtacgattaacctctgggtttgaaatcactgcttatatacctggtattggccataattcacaagaacattctgtagtc
ttagtaagagggggaagggttaaggatttacccggtgtgagatatcacattgttcgaggaaccctagatgctgtcggagt
aaaggatcgtcaacaagggcgttctaccaccctacaatatggggtcaaaaagccaaaataa
back to top
>NC_018112.1-rps12.m46372
atgccaactattaaacaacttattagaaatgcaagacagccaattagaaatgtcacgaaatcccctgctcttgggggatg
tcctcagcgccgaggaacatgtactagggtgtatactatcacccccaaaaaaccaaactctgccttacgtaaagttgcca
gagtacgattaacctctgggtttgaaatcactgcttatatacctggtattggccataattcacaagaacattctgtagtc
ttagtaagagggggaagggttaaggatttacccggtgtgagatatcacattgttcgaggaaccctagatgctgtcggagt
aaaggatcgtcaacaagggcgttctaaatatggggtcaaaaagccaaaataa
back to top
>JN019795.1-rps12.m1381
atgccaactattaaacaacttattagaaatgcaagacagccaattagaaatgtcacgaaatcccctgctcttgggggatg
tcctcagcgccgaggaacatgtactagggtgtatactatcacccccaaaaaaccaaactctgccttacgtaaagttgcca
gagtacgattaacctctgggtttgaaatcactgcttatatacctggtattggccataattcacaagaacattctgtagtc
ttagtaagagggggaagggttaaggatttacccggtgtgagatatcacattgttcgaggaaccctagatgctgtcggagt
aaaggatcgtcaacaagggcgttctaccaccctacaatatggggtcaaaaagccaaaataa
back to top
>JN019795.1-rps12.m46372
atgccaactattaaacaacttattagaaatgcaagacagccaattagaaatgtcacgaaatcccctgctcttgggggatg
tcctcagcgccgaggaacatgtactagggtgtatactatcacccccaaaaaaccaaactctgccttacgtaaagttgcca
gagtacgattaacctctgggtttgaaatcactgcttatatacctggtattggccataattcacaagaacattctgtagtc
ttagtaagagggggaagggttaaggatttacccggtgtgagatatcacattgttcgaggaaccctagatgctgtcggagt
aaaggatcgtcaacaagggcgttctaaatatggggtcaaaaagccaaaataa
back to top
>NC_018112.1-rps12908
atgccaactattaaacaacttattagaaatgcaagacagccaattagaaatgtcacgaaatcccctgctcttgggggatg
tcctcagcgccgaggaacatgtactagggtgtatactatcacccccaaaaaaccaaactctgccttacgtaaagttgcca
gagtacgattaacctctgggtttgaaatcactgcttatatacctggtattggccataattcacaagaacattctgtagtc
ttagtaagagggggaagggttaaggatttacccggtgtgagatatcacattgttcgaggaaccctagatgctgtcggagt
aaaggatcgtcaacaagggcgttctagtgcgttgtagattcttatccaagacttgtatcatttgatgatgccatgtgaat
cgctagaaacatgtgaagtgtatggctaacccaataacgaaagtttcgtaaggggactggagcaggctaccatgagacaa
aagatcttctttctaaagagattcgattcggaactattatatgtccaaggtccaatattgaaataatttcagaggttttc
cctgactttgtccgtgtcaacaaacaattcgaaatgcctcgactcttttagaacaggtccgggtcaaatagcaatgattc
gaagcacttctttttacactatttcggaaacccaaggactcaatcgtatggatatgtaaaatacaggatttccaatccta
gcaggaaagggagggaaacggatactcaatttaaagtgagtaaacagaattccatactcgatctcatagatacatatgga
attctgtggaaaaccgtattcgatgaaagtcgtatgtacggcttggagggagatctttcatatctttcgagatccaccct
acaatatggggtcaaaaagccaaaataa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rps12JN019795.1-rps12Gossypium areysianumgene
rps12NC_018112.1-rps12Gossypium areysianumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rps12NC_018112.1-rps12.m1Gossypium areysianummRNA
rps12NC_018112.1-rps12.m46Gossypium areysianummRNA
rps12JN019795.1-rps12.m1Gossypium areysianummRNA
rps12JN019795.1-rps12.m46Gossypium areysianummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06