AF403074

Overview
NCBI AccessionAF403074
VersionAF403074.1
Typeregion
SpeciesGossypium anomalum
StockB1-1
Publication[view all]
Germplasm
Stock NameType
B1-1wild_unimproved
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Sequences
The following sequences are available for this feature:

region sequence

>AF403074.1 ID=AF403074.1|Name=AF403074|organism=Gossypium anomalum|type=region|length=666bp
acttcaatacgacgaggaacccactcatccttctgctctctgtgcccaag
cctccataagtgatgaaggaattgcatcaaggaaacaaaagaaaaaacaa
ataagtagaataaaggatttaagccctgtaaaaacacatcaaatactgga
acaatgcagaagttagcagtggtgaacatgtcacaaaccttccataacca
ccaaagccccacctagacaatcacataataaaagtaaattatttatgaac
aaggaaaataaaaggaaaatctaaaaccttaacacaataatcaacaatga
cttacgtgtaaacatagccattcgtgtccacggcaactggatgcacaaat
tagaaaagtaaacaatgagatgaatgtttaagtaaaagaagaaccaggaa
tagggaaggggatgaccaaaagatgaaagagcaaatgaacatgaaagaga
gcaggcatatcatgaacctgtatggtttgttccacaggcaactttgacaa
tagtttctccagaaagagtagctatagctctagggcgaggttgagattca
taaacaagcctcaccgagctatccttggcattatactgcaagtgtatagg
tatgatgcaaacacccgtggagaaaagcaagtcaatagcaactaggttag
agaactgcttaacaac
back to top