X54092

Overview
NCBI AccessionX54092
VersionX54092.1
Typeregion
SpeciesGossypium hirsutum
LibraryLambda cotton
StockCoker 201
Publication[view all]
Germplasm
Stock NameType
Coker 201obsolete_cultivar
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Libraries
Library NameType
Lambda cottongenomic
Sequences
The following sequences are available for this feature:

region sequence

>X54092.1 ID=X54092.1|Name=X54092|organism=Gossypium hirsutum|type=region|length=1399bp
ggatccttaagttcttatacaactctcgcaaacttttattaatggctgct
gacagagtttttgttattgcagacaatgaaatccttcttcgaggaaacac
ttgtggcgatacctgattcagtcttggatgcacctattgctggtggagta
ccatctggtcgtgaagatctttttgccaatgtacatgatttattgccacg
ccaatatcacgcgagagaagaggaagcattgtatgcttagatttataatg
tcctaaattcctcagttccaattcatataatctcaaattacaatttttgt
agaatacggcctaattggttccatgtatgttgaattctaaattatataaa
tggttaattcaaaaggttttgttgtcactctatatgatcattagaatctc
ttgaatatttttcatttttcggtcactggttagccctttttttgttttgt
tttttcctccacatccattcttcactggcctgcctttctctagctgcaaa
gggttatctagagggagaggcagttgtgttctctacattgttggccccaa
tccatttttgtaaaatgggtaccacccaatagattttaatggctaccaca
ggtttagaacaaagataatatgaatgatgtggcactcaaatattggtcca
aaattttcttctgataagatctcatatacggatgctccatcctccacctc
attttttttttcagcatctttctagacttagaaatttaagctaaaaaggc
ccctccatattggcacctaagaagcacctgcaggaaaaatggcatccatc
accatgacaacatcattccttagcaccactaacctcacaaagggttctcc
aagaattacccagcggagactagtggttgccaatgctgctaagggagctc
aagtggagagtgtccagatgagcggtgagaggaaaacagagggcaacaat
ggcaggagggagatgatgtttgcagctgcagctgctgctatttgctcggt
tgcgggggttgcaacggcggagcctaaacgtggtagcgcagaggccaaga
aggcgtatgctcctgtttgtgttactatgccaactgctaggatctgtcgc
aactgaggcagtgccactgcacattgctcgagtgccatgagactatgctt
gttatgggcaggggctgaaggatgtaatttaataatgcttgtaatttttc
atttttataattgagaaacctaatttaaatttgtgtttttcttaattgtg
atgatcacatatggatgttttgatttgttccattttcatctttcttatct
ggtttccagccatcaggcgtttactccattgtcctctgttcggaaactaa
aggcctaattatgattttagtcctttttactatactgaagttttaaatt
back to top