AJ421017

Overview
NCBI AccessionAJ421017
VersionAJ421017.1
Typeregion
SpeciesGossypium hirsutum
LibraryEZAP
StockDong A
Germplasm
Stock NameType
Dong ATBD
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Libraries
Library NameType
EZAPcDNA
Sequences
The following sequences are available for this feature:

region sequence

>AJ421017.1 ID=AJ421017.1|Name=AJ421017|organism=Gossypium hirsutum|type=region|length=828bp
ggcacgaggcctcgtgccgaattcggcacgagggtgagtgttaaacattg
tttgcctttcatttctttctctattccttgttgcttcctcggcagcctct
cggtttctgagtaatcgaagataaaaaaggatggggctgtcttttgctaa
gctgtttagtcgactgtttgccaagaaagagatgcgaattcttatggtgg
gtcttgatgctgctggtaagactaccattttgtacaagctcaagctcggt
gagattgtcactaccattcccaccattggctttaatgtggagaccgtaga
atataagaacattagcttcactgtttgggatgttggtggtcaggacaaga
ttcgacctttgtggaggcactatttccaaaacactcaggggctaatcttt
gttgttgatagcaatgaccgtgaccgtgtggttgaggccagggatgagct
tcatcgtatgctaaatgaggacgagctgagggatgctgtgcttcttgtgt
ttgcaaacaagcaagatctgccgaatgctatgaatgctgctgagattact
gataagcttggccttcactcccttcgtcagcgccactggtatatccagag
tacttgtgccacctctggcgaagggctgtatgagggactggactggcttt
ccaacaacattgctaacaagggttgagggttggttgaattccagtcatat
cttcaggcagctatcctattattttctgggtccttttttaagttttacag
gaaatgtatcagattgtgttatataattaatatatattcaccgtactact
gaaattaggcaaaaaaaaaaaaaaaaaa
back to top