X52136

Overview
NCBI AccessionX52136
VersionX52136.1
Typeregion
SpeciesGossypium hirsutum
LibraryLambda gt11
StockDeltapine 62
Publication[view all]
Germplasm
Stock NameType
Deltapine 62cultivar
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Libraries
Library NameType
Lambda gt11cDNA
Sequences
The following sequences are available for this feature:

region sequence

>X52136.1 ID=X52136.1|Name=X52136|organism=Gossypium hirsutum|type=region|length=1872bp
ctcttagctgttttcacaaaggtttctttatttgtatttacaaaaaccca
agttctagccatggctgcatctttctcagtgccttcaatgataatggaag
aagaaggaagatttgaaactgaagttgctgaggtgcaagcatggtggaac
tcggagaggttcaagctaacccgacgaccatactcggctcgagacgttgt
ggctttacgaggcagcctcaagcagagctatggctccaacgagatggcaa
agaagttatggacgactctcaagacgcaccaagccaatggcactgcttct
aggacttttggtgcacttgaccccgtccaagtaaccatgatggctaagca
tttggactccatttatgtctctggttggcaatgctcctccactcacacca
ccaccaacgagccaggtcctgaccttgctgactacccttacgacaccgtt
ccaaacaaagtcgaacaccttttctttgcacaacagtaccatgaccgcaa
acaaagagaggcacgaatgagtatgagccgggaggagcgcgctcgaaccc
cttatgtcgattacctgaagccaatcatagctgatggtgatactggcttt
ggtggaaccacagcaaccgttaagctttgtaaacttttcgttgaacgtgg
tgctgcaggtgtccacatcgaggaccagtcatctgtaaccaaaaaatgtg
gtcacatggctggtaaagtgcttgttgctgttagtgaacacattaacagg
ctagtggcagcgaggttgcagtttgatgttatgggagtcgagacagtgtt
ggtggctcgaaccgatgctgttgcagctactttgatccaaaccaatgtcg
acaccagggatcatcagtttattcttggtgcgacaaatccgaatcttcgg
gggaaaagtctggcaaatatgttggctgaaggaatggctgctggtaaaaa
tgggccccaacttcaggccattgaagataattggctagcaattgcacaac
ttaagacattctccgaatgcgtaatggatgccattaagagcatgaacata
acagaggatgaaaagagaaggagaatgaatgaatggatgaatcattcaag
ttatgataagtgcctatcaaatgaacaagcaagagagattgctgagagat
tgggacttcagaatcttttctgggactgggatttgcctagaaccagagaa
gggttctataggtttagagggtctgtaatggctgccattgttcgcggttg
ggcctttgcacctcatgcagaccttatttggatggagacatcgagccccg
acatggtcgagtgcaccaggtttgctgaaggggtgaaatcaatgcacccc
gagatcatgttggcttacaatctctccccatctttcaattgggatgcatc
gggaatgaccgatgaacacatgagagacttcattccaagaatagccaagc
ttggtttctgttggcagttcataacgttagctggtttccatgctgatgca
ttggtgaccgacacatttgcgagagatttcgccaggagggggatgctagc
gtatgtggagaagatccaaagagaagaaaggaacaatggagtggacacat
tggctcaccaaaaatggtcaggtgccaacttttatgatagatatctcaag
acagttcaaggaggtatatcatccacagcagccatgggcaaaggggtgac
tgaggagcaattcaaggaaacatggactagaccaggtgcagggaacattg
gaagtgaaggcaatctggttgtggctaaggctagaatgtaagacaagcaa
aaatgagctgaaggatggtctattttggacttgggagaataacccaattc
ttgaattttggaattgggacgg
back to top