BV679946

Overview
NCBI AccessionBV679946
VersionBV679946.1
Typeregion
SpeciesGossypium hirsutum
LibraryUpland cotton TM-1
StockTM-1
Germplasm
Stock NameType
TM-1breeding_germplasm
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Libraries
Library NameType
Upland cotton TM-1genomic
Sequences
The following sequences are available for this feature:

region sequence

>BV679946.1 ID=BV679946.1|Name=BV679946|organism=Gossypium hirsutum|type=region|length=561bp
ccggatcaatttatcacttctaaaaaaattatataaactaagcagagaaa
aaaaaaacccaaattcccaccactcacggaatctcaaaattgattcatga
ttcccccattataatcgatacccatacccatctttcaaaaacaaaaaccc
agatgtagaattgggagaattttgtaaaaaaattgaaaaaaaaatgaaaa
gaagaagaagaagaagaagaagaaaattgagcgatgagtttggagtggtg
atgaagtagtggggatcatcctgttcgcgctgttcgcctttaacccactg
ctcggttctggcaacccgattctggtttttgccttcctgctgctggggtt
aagtctgatgggtctgaccttcgggccaatgggtgcgctgttaccagagc
tgtttccgacagaagtgcgttacaccggagcatcgttctcttacaacgta
gcgtcgattctcggggcttccgttgcgccatatatcgcagcctggttgca
gactaactacgggctaggtgcggtggggttatatctggcggcgatggctg
gcttgacgtta
back to top