BV679958

Overview
NCBI AccessionBV679958
VersionBV679958.1
Typeregion
SpeciesGossypium hirsutum
LibraryUpland cotton TM-1
StockTM-1
Germplasm
Stock NameType
TM-1breeding_germplasm
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Libraries
Library NameType
Upland cotton TM-1genomic
Sequences
The following sequences are available for this feature:

region sequence

>BV679958.1 ID=BV679958.1|Name=BV679958|organism=Gossypium hirsutum|type=region|length=500bp
cgatcccttcagtttaacactaaacttttctatatcagctcataattttt
taaaaataaaaaatggtaaaatttatttcatacaaatagtgaacgattgt
agttttccaaaaaaaaattgaagtaaatgaatacttacaattttattttt
gaggtagtttaaggtttaaaaatattttatgaaatttgttaaacacaagg
tttttaatattaaactctttccacataggttatgtctactgtagataccc
ttaaggtttttttaggtagatagtcatattcattttgtacttctttcctt
tcaaaaggttaactagttatcacctgtgagtgtgtgtgtgtgtcttatat
aaactattttagttttttacatatatagtagaacaaagttattgtcctga
tagaatttactaaatggtttgaaattagtagtcgcagaaacaattggtta
tataatagaggcaacccttgtatctaagttgcctcctaaagctcaagatc
back to top