X13201

Overview
NCBI AccessionX13201
VersionX13201.1
Typeregion
SpeciesGossypium hirsutum
LibraryGenomic in lambda Charon 35
StockCoker 201
Germplasm
Stock NameType
Coker 201obsolete_cultivar
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Libraries
Library NameType
Genomic in lambda Charon 35genomic
Sequences
The following sequences are available for this feature:

region sequence

>X13201.1 ID=X13201.1|Name=X13201|organism=Gossypium hirsutum|type=region|length=1195bp
cctagaattatttataaatttagataatgtatgaaatttgattgtagata
ataaaatttaaaaacaatattattaaaaaaataaccacaaatcttaaata
tgaatattaaattaaacatgaaaagtacaaaaatatatatataatttata
tagaatattagacataaattaaagttctataattttcaaacaaatttgat
tcaaaatcttaacattttttaatataattaaatatctaattcttataaat
gtgaagctttctagaaccaatacgtggttgtcatatagctacatctgcca
cgcgtcgaagcaccataggctgggtaatcaaacaaaatcctgcaaaaaca
aaacacattttatttatccatactacaagtgtatagcactgcatggcaag
cacgtccaacacgtgtcataaacaagatacgtgtttcatccgtaatgtcc
caaagttccctataaatagaaaccacacatgcaatagtaaactccccaac
aaacagttacacaattcagagcgaaaagaaaagaaaatggcgtctcatga
acagagttacaaagctggtcgagctgaaggccgagctcatgtaataatat
tattaattaccactttcgtccttccattttctttttcattaccagatttt
ctttaacattatgttcttttatggtaggaaaagggtgagcaaatgaagga
gagcatgaaggagaaagcagaagcagcgaagcaaaagacaatggagacag
cagaagcagcgaagcaaaagacaatggagacagcagaagcagcgaagcag
aagaccagaggggccgccgagacaaccaacgacaagacaaaacagacagc
gggagctgctagagggaaggcggaggaaaccaaggagacaagcgggggga
tactgcagcaggcgggggagaaagtgaggaacgcggcacaaggtgcgact
gatgcggtgaaacatacctttggaatggctgatgccgatgaggatgaaca
taattatccggctactgttactaggaaggattagggtagcatgtagggtt
aagataataataatagttgcaatatgtacgtgagtggttttagataacgt
acggttgcaaacgcttcgttgttatgagtgtgtgttgtgttacttttgtt
gttttagctttttttttaataataaaaattttaccttttcacttt
back to top