X54091

Overview
NCBI AccessionX54091
VersionX54091.1
Typeregion
SpeciesGossypium hirsutum
LibraryLambda cotton
StockCoker 201
Publication[view all]
Germplasm
Stock NameType
Coker 201obsolete_cultivar
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Libraries
Library NameType
Lambda cottongenomic
Sequences
The following sequences are available for this feature:

region sequence

>X54091.1 ID=X54091.1|Name=X54091|organism=Gossypium hirsutum|type=region|length=1594bp
cgctcatgttaacaattaattcctataatcgacatcaaaattatatgaaa
gaattaacacttggttaccgagttaccatatttgaagataaggcgaaagg
taaaaacacaaaaggcaagcatgaccaagcaaacaaggtatggacataga
ttttttttgaatcgggaatggccaaatgggaccgtgaagaggggacaaag
gagaaatcaggcattcacggtttccattggatgaaatgagataagatcac
tgtgcttcttccacgtggcaggttgccaaagataaggctttaccattcaa
gaaaagtttccaccctctttgtggtcataatggttgtaatgtcatctgat
ttaggatccaacgtcaccctttctcccaaaccaatctctaaatgttgtga
gcttaggccaaattttatgactatatataggggattgcaccaaggcagtg
acactattaagggatcagtgagactcttttgtataactgtagcatatagt
actagtaagcagtaatagcaatggcctcctccatgatctcatcggcaacc
attgccaccgtgaactgctcctccccggcacaggccaacatggtggcccc
cttcaccggcctcaagtctgcctctgctttcccagtcactaggaaggcca
acaacgacatcacttctcttgcaagcaatggtgggagagtgcaatgcatg
caggtacttggtgatgcataaatacaacttaaattaccccaattgtttga
acacaacaaattacataaattgaatcaaatatatatcttggcttttgagt
ataggtgtggcctcctcttgggaagaagaagttcgagacactctcatacc
tccccgatcttacacccgtacagttggctaaggaagtagattaccttctt
cgctctaaatggattccttgcttggaattcgaattagaggtgttttcgag
ctctaaattattccattccaacactttatttttttagtgggatatttgat
ttgattaaatgtgttttatatgtatgtgcaggagggattcgtgcaccgta
agtactcgagcttacccacgtactacgatggacgctactggaccatgtgg
aaactgcccatgtttgggtgcactgactcggctcaggtgttggaggagct
tgagaattgcaagaaggaataccccaatgcattcattagaatcattgggt
tcgacaacgttcgtcaagtgcagtgcattagtttcattgcctacaagcct
aaaggctactaagttgtttacttccctcctaggaattccatttgtttcaa
agttgtacttaaattaagcccctcaaaccccccccccctttttctttttc
ttttttaattgaggtatttggcttggggtctttctctttgttttgttttg
gatttccaatggaacggctgagaactaatgaataaaaaggtagtttcttg
ccatatttcttgaatccagttcttccttaatttccagtgctaagatattc
atgttaagataggataaaaattaaaaaagaaaaaggcgattggggggtct
ggctttaaaataagaggataaagatttagatggacaagcaacgc
back to top