AC197182

Germplasm
Stock NameType
Acala Maxxacultivar
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Sequences
The following sequences are available for this feature:

region sequence

>AC197182.1 ID=AC197182.1|Name=AC197182|organism=Gossypium hirsutum|type=region|length=87487bp
gagcccttaccctagaagagtaaccccactaataaatcataaggaataat
acacgaaaataagtccaactcacccaccaagttgcaacattacttctata
ctcaatctatatcactctcccaactaagacattcctcttgaaagtttagt
tgcaaactaagtcacacaacaacttacaatgaatttgcgctagaataata
tcctaatttgaacataataagtgctttcataatcttatacaaaaactgaa
acaagtctacatttaaataagcataaaatggcccgtttaattataaaata
gcctttgatatgatcttcaatagggactacctgccgagattacctagatg
tagtcttctatggaaaaccaatctcttcaataaggaaagtagatcacatt
aaaagtcttcaatattttctcgcttaacttgtgttgttccatgctttcaa
ctcaataaggtgctactaaaacttcttaaagatattcaattaaaagctcc
aaccattttggtcaaaatatgtcaaccaattatggcaagtaacattggcc
tcctagacgcaatctaagttgcaattggagttgtatcttaccctatagct
agcaccaacacaacgtattctttataccatcaatgcatcaaatataaata
ttattttatgtcgaagaaagaataatgttactttaggtaacacttccacg
tgttataatatgattaatttgacgacatatacattgatattatatcaaat
tcaaatcctaaagccttttgataatcatatatattatattgcaaggtttt
agttaaatagtagtgttcacactatatttttatgacatttggcataacat
aagaatgccatgtgtatttttaaatatatataaattgtttttaatagctt
aaaaatatatttaaaaattaaataaaatttagataaatttaaagaacaaa
atttaaattggtttaaggacaaattagattcaagtttaacatatcaataa
attaaaaataaccactaattcaatatcaaaattattattcattctaattc
aatcccaaaattaagcaattagtgttactaattaatatataattaagaaa
ataaaaccatgtcgattgagttttaactagattgacattaacattattgc
tagtaaagaatgatgtaggttcgagcgcactcaaatgcattttattctcc
tatttaaagggtgaataaaaattataaataattctagacacattatatca
aaaatgaaaatcaaaactataatacaacaatatactttaataatccattt
aaagtgtaaatcatgtatcacattcaaccttaatattttcatggagaaaa
catgaaaataaattaaaaatatcaatgaaaaattccggcaacttaaaaaa
taaatattttagatacttttatcaaaacattatatagaaataaaataaaa
caaataaaacaaatcatatcataaatatattagatgttaatgcaattcaa
attcaccaattctatatttgcagagcctcactcagaaagtgattatgatt
ttattcaacaattctaccccctaatgaataattgttgctccaaagtcgaa
cccaaattgttacaaattactctctccaaatagcttgcattacatacaat
atctctccataaaaatatctaaatagggcgtgcctaaatgaggaagtcta
tcaattacttatttataggcgaatagaagagtccagttttaatagagttt
aaacgctcatttaaagcagaatatatcacttgagttatcttgaatattta
tctcaagtccttaaacaagctctccaacaactacagattctctgaaagga
taaggatattaatgcttgagatgagattgccaatccttttttcttctact
cttcccaatattgattagcagcattcagatgcaataaaacatgactaagg
atcattttgtttgatttgttgtaataccaccatgaaaataaatgacgaag
tcaaaagtgggctggcaggctccctcgtcctccccctaaaatgactttct
aaaaaaagttaaaggacccaaaataaattatcatgtttttttaaaaagaa
atttactatgcatggtttaaagagtaaatattttgaaccctgtgtgttgg
tagggtgttcaccgccccaagtgtggttttaagtttgagtcctgctagtc
gcatttgctgtttggatttagccctcatctcgtaattcaccaaaaaaaga
aaagagagtaaatgattacatgttttgttcttttatgcaatttattccat
aaattagttattggtctgattgtttactgaaaatcttgaattacatttta
aattctttccggtcctaaaaagggttaaattttaattacattatnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngtttag
cgggggcagacgatctgagattcgtcaccaactcatagaacactttataa
tctatatatataaggtgaaaaacagtttaagaggatacatatatgatcaa
ttgttgatgttatcaatttagcaatgtatgtttggaaattgaaattagcg
aaaatcacaacaaattaatagtttaagttgatgtattaactaacaagcag
agtaatttgtaaagtagaaagcaaaaagaaaaagcaatgagtgcatcacc
tttatatcgaataactaaggtgactaaacaatacctctaaaattgaaatt
aagcagtgtggtcacaaaaattgttacagcgtcaatattattgtagtttt
aaactcccacgtgaagcaaattggtgggggggccataccgaacggtctct
agaactagaatcatgcttctaaatctaatcaagcatcgtatatatttccc
cctcaaggaatcaaaagagtttataatgtcactttgcattttcatatatt
aatgacgctgatagagaatatgccactacccccaacgaatggtaaaaacc
cttggggctaccacatgttggccatgaatgcaatcttagggcggtttgcg
tatcatctattatcgcctcctatgatattccaacaaccttgcaagtggat
gcaaaatatttattttgtatacactccttttgctttgtccatccacaatg
aagtgccttacattttatcttccttcttacttgaatataataagtggaat
aaatgtgagaaatctttaaagagcttagaaggtataatttaaagagtagg
aaaagaacctcctttatcttgcccttttgacctcttaaaatttgtgggct
tgtggaataattttctcatattatgacagattaaattcttaggttttaag
tgaaaaataaataaataaatcttgggatttaagtaaagtggtattgagaa
ggaaaacttttcatctatggcctagatatatagctacttcaatcttaaac
catagcccatgattatggaattatatatctatcattatataaaagttgat
atgatatatatgtgccaaagtgctttagtaaaattattgacgtagtgaac
aacttatttgatgcattattttcatgcgcatcacaaattcgatgcgagag
aattgacacattagttgcatatcattttcctccaaattgttttgaatgtt
tttaatgaactaatatgatactaaaagaaaatacaactatttaaaaacaa
acacacacagaaatcgtctaagggaagaggaaaagaaacacatatgtgta
ttcagaacttgatagataaactatatatgattccttcaacgcaaattata
ggaatagtttatatgcatttaaactaggtattcaatcctatcaatttggt
gacaaattaattataatgtacatatactgtatgtgtagtgttctgccttt
tcttgaggctgaagttagctcggctaatcagtctgtagctgattttagtt
cggtcagaggttagttaataattttttgaaatttttcagttatcggttaa
ttcagttcgaaatcgggtaattaatcgaattaaccaattaaccaaattat
atatattatatataattgttaactttttatttggttgttaactttcaaga
tttatgtagtgtttctaatgccttatttattgttttcgcttccatttaaa
gttttttaaactattaaaaaaagaagaaaaggagcattagcaatgtattt
ttttatatttatacttattttaatccaaagacaaaaaatatataaatttt
ggttaaccgaccaaattaactgaattatttcggtttggttaatgtatttg
aaaaaaacttcggttcaattaacggtaaagatttttatatttcgagtaat
ttggttaatgataattcgattaatggtaatttgatttgagtattaatcga
actaaccgtttgaatacccctactagagaagaatgaaaaagatatattta
cgtgggtgtatatatcttgacatattgtcgagcaagttttagtgagtttt
tttttttaaaagaaagatggaggttgccaatatttgttctctttgtgatt
taaatagttatttctcatattcatttttcttttaaatttataattatttt
agtgtagaattttatatttattgcattattaatgtacaactctaactcta
taatgaatcaaataatggtacatgtaaaaaaataactattatattttttt
ttatttttttgctttattattattgactatttttcataatatgatttact
ataatgtaataagtgtattaaaatatatacccttttggtatatgtatatt
acatattaaagtatgaatttagaaattttaaattaaatcagtataccttt
ttattgtttattattgttatgaaacataaattaggatcgatattcctacg
gcaattcatactgtgaggtgtagagaactactaacatgtaggggcggttc
ccaccttagaaggtgcagaaggctgctatatgtgttgagtttttgtacta
tcagcttacctatatttcttcttagaggatgaggcctagggtttttatag
acaaagaaaaacttagagtaggccctcttttcatgatggtctctttatag
agtccaattttaggaccgatgtgataaatcacttttcaagaagctattta
gtgttccagtttgggtaagggaatttaaggataggaactgtaaatcacta
ctttactgatccttggatgatgtgcactacctttttcaacaacattagaa
gatggtgcactaagcttcctcttttcctcttgcacaactcatgcatccct
tgcccagatgaaggtgcactctttctacatactagttagcatgcgctacc
ttcacccactagtgacatacactaccttcacccaaatgaaagagttgatg
gtccaacttcacagaatgactgatcttaaggggaacctggttactttttc
cccttttgatatttgttctcctaaggagttgactatcacatgtttacttt
ctagtattaccccctttttttttttgcacccatactcaaagacttctagt
atttcatttgccaagatcctcttcttttccctctttatatagataataca
acacttttttttttacaaattcttccaattccctttttccttacaacttc
ttcagtggtgtcccttaagctaaggcactcatcaatactatattgttttg
atacaagcattttgtcatcgatctcctcttccaaaggtcaaattgcatgg
atggcagagctctcaatattccattgttcctactaaagaattctccttat
gaggcgatggaagttgtgacccccaccacgactttgtcttttctctattt
aacgaagtagtaattccagtgtttttttgaatcggtgttgtattctcgct
taagagattgccccatgtcccaaggcatatattcttattattcctcctca
agctactcattgttccttcgagtcttttattggcatattcttgaagctaa
gaccaaatgaacttttgtctttgagattcttgatactaatgtattattga
ccaagagtcatcttccacttcacaactgtgacaatattattcttcttagt
ggtttgtcgaaaggccaaggaaaaaagcacaagcaagtctatcattccac
cttcgaggttgcatggaagtgatatgtctcccccgtattgctctagcctc
atttctttgacctattttaatttgggtcattaggagtattctacctttct
cacttctaatgattataaccttcaaggggtaaagagacatagttttttgt
tagtttcgcacaaaaaatgccaaaggttacaacacaaaatatgaggttga
cttgttatggtagttcacattgttagggagtggaaagctgctaggatgag
ggcagttcacgccatggaagatgtaaaaagatgttatacactaaaatttt
gaagatatggattttggcaaagtaaggttgcttgtgttctcagtcctttt
accttgatgttaagaaggtatttatagagggagggaggtcgagcgtggtc
cccaaccattgagtgtatgtggtgtgataaggtagcaaatgtcgacctag
gacactgttggagtttacctgaaaggactaaacgagggtatgttggatgt
gatggattgatgggtgcatcaaagggccttcctaacatatcttttgcata
ttgtatgagggagagttcatttggtaaagtaatggaaatattgtgctata
aaaaatattaaaaaaaacattgtgtaaaatataaaatattcaaatatata
ttcaaaaaaatataaaagttgaagaatttataaaaattaaaaagttatta
aattcaaaattgtttatagtattaaatatgtatatgatagaaaatcggta
taaaaaattaaataatataaaaaggaaataataaaataataaaaattcta
ataatttaaaaaatatctatgtataaaaacaacaaagggtcaatagtaaa
tcaacgctagtcaacggtctatcaacatggtctataatcagcgatcatgt
catcatttaaagaacatatcatcgacgatataaaaaaacggaagacacgt
gcgttatcattgattgggtatataactcttttttttaataccaataacaa
tttaaacaaaaaatatatataacaaaaaacaagttagataccaaaatgac
caaaatgacactatgaaacagttatatttgatatgtaaataagtaagtag
gttaccctatgtaagtaggttaccctattaactgtcccaagcaaagttga
gtatagttagcataccataggattagtgtaagagattatacttcaattta
taccgatgaggtgtggagcacactctacttctgttatatcaatgaggcgt
gaagtgcaatatatacttcagacgttccaatgaggcaatagatgccagat
atataggtgtgatgattggatgatccgtgtagtcgtcttaagtctgtgtc
tatttaatagggatcataaaacatgaacttgctaaatgatagttaatatg
aaatgcagatgaaaaacggtatatcatgtacatatatgaaatgtgacaaa
tgataacatgtgaaagattatgcgaatcagtttaaatgacccctaagggc
cgatgtggatataaaacaaatcaataaattcaagaaagaaacaagaaaat
tatgtgaaaaagtaatatgctatggaatataaatgaatgtgatgtaatga
tagaaaatatagtatggtatattgatgtgagattgccaaatgagataggg
tatgaattttagtacatgagacatgaatggttaatagaaattgttgaaaa
ttagatcatgttttaattgtattcttaacatgttataatattatttattt
gaataatgaaagtaccactgagttttatcgctcaacgtatggttgtttat
ttccatgcacaggtaccaatcaatctcgaggttttgaggagcgaaacaac
atccaaatcatagctcttgactcaacaaatttctataatctcattatgtt
atcaataagtggcatgaacctaaggttgagttggtcttatattgagaatt
gataatttggtactttggatggaaaatgttaacttgaacatgaatatatg
aattgaaagtaattaggtgtgaagccatgaatagaagttgaaatgttatt
tatatgtcaagttaatgaaagagatgtttaaatcttgaatgaatgtatat
aagtacttgattttatatgctaagtttactataggtgttgaagttatagt
ttagcatgtgaattaatgctcaaaaagatgttgtaatgaacttttggcta
tgtaggccacttggtattgaattcgataggtttggattgaatggggttta
tattcaagggaaactgtctccgaagtctcaacactacccctttgatgtcg
cgacatcgggcttctatttcttatttccatgatcgcgacattgaatccat
tgccttcaacgtcgcgacgtcccctactgaagtcatgacgtcgagcttct
gccttcaatgtcacgacattattcattcatagtcacaacgtcaacccaat
acttggaattaatccctcaattaacggtgatttttcacaaaagctttcat
aagctcgtatatagcctagattttattaaatatcatataataattaagaa
tttaacatattggcttgtacaaatgatttatttgatatgcaaatgaagtt
gtagttgctccgacaacaaatgtgtcatctcacattttggatccaatgat
cgggtcgggtgtaggtgttacacaatcaatggctctaaccgagcctccaa
gaactaattctttgcaactcgaagtttgaagaactttccccaaaatcttg
aataagatcaagtaaaaaaatcttctaaataaaaataagatttgaatatt
gcaaaataaaatactccaaagaatgattttattaatcaaataataataaa
aaatgtcttacataattaataatgatagtaactttatataggctaaaaaa
aaacttctaatttggcaaaacaagaagtgattctagtttaactaaacctt
cttaccaactaagaaacacaaaatttcttaacaacttaacatacttaaaa
atatctcgaaattcaaaataaataaatataaaaattaataaatacaatat
tgactttatttataattaaaatcaatacttaaaattgaacccaatatgat
ttagacatgaatcgaagtccaaaacttacagttcttgtaataattttgtc
tagaacttcgactcacgcaaatttactaaaacgatcataacttgagctcc
caaattttaaagaaggtgattcaaagtgtggttcgaagtgaataaataat
ctttcatcggtcaaaagacatctcaaaccaaaaacacttggatcccatcc
aaaagtttatcgcaagtcgactagttttctaaactttaaaattggcaaat
tcgggaaacttaatttaataaatttcacctcatagcaacatgtatcattc
ctccattcctcaaaaagaattgtcataaaatcttagctttgattgaaaaa
gaaagaatctttgtcacaggaggactcatttaattaagctcctttcaatg
gaccaacaaaatcctgaaataaagaaacaaaggcactacaaaaattcaag
ttaaggttagttaatacataatcactcttctcttttaaagagatattttg
tttcttttcaatctctttttctatctttagaacaactctcaaattttacc
tcatataaatttcactccccaaaattggaccgtcaattagatttttatgg
ctcaatgtgtcttttttcttagtctttttacataaattttcctcacttcc
cttatctcctgcacagtgtttttgaacatttaattcatcaaaatacaact
atgtaagagaacatgaagtttcgaacatgtctaaattcataggctcttat
gaacttttgtcactatcaattgcatcatgtttactgagttcactttgaaa
aaaggacaaaagaatttggtttgaccaaaatagtttgtccaccacgaacg
ttagtagtcatatcatcaaaagtattagtattagtattacgaccattgag
aggagaaattccaatattttaattcgaatgagatgaattacgcaatttat
tagaaagagcatgaaattgttcattcatagtgaactacatagtacgcatc
tcaagcctaagattgccaagccaagaatcttcaaaccattgtgaataggc
ctaaaaacgcaaacgctcaaacaaagcaaacctcgccattaactctaaaa
aatgttagcaccctaaggattaaaggaaaataataagaatccaaaacttg
ttaatcctcaaagtttctattttactcaaaatatatctaaaactaagtga
ggtcgttcgctagcaaaaggtatcctaagctctaagaagctaaggaaagc
tcgacgccaattagattaagatgcacggagataggaaagtacaattcctt
cgttcctattaagacaaggaaaagaatatgttagttagtgtaaaagaatc
aataaaaagcaaaaaaaaaatcataaagctaagaatcaaagaaaagttca
tatttacccaaaaccttgaaaaactacgaaacaactcaaattttagttct
tgatgttccgatgtgctaaaattacgaaattttgtaggatgcctctagat
ttaatgaatttaaaatctcgaatttttttcactaaattctaaccacaatg
tttttttttgttttttttcctttctttagattttttttaaatttttctat
ttatttaatattttttatggaaatttttttcattgtaatctagtgaaaaa
agtaaaaggttaaaattttaagtcaaactaaagtcatttaccgcctttat
tgaattaaaggatgtgaattttctaggcaaaaaacaatttttaggcacct
gaaaatttttttagcaatgatattgataaagcacgagtttaggaaaatcg
agaggcccgagctctaatatcaaatgatatgagggtagtgtccacacaag
tcctaagatgattaaaagttgtttcgagctttagaagactcgttattaac
tcgagaggctctagactgatttctatgattttggcagcaaacaatgtgag
tttttaagcttgaaaataatgataaaaaagtgagaattaagaccaataat
cgaagcaaagaaagtctaagaaaagtgaagaaaaagaaataatagagtca
attttgaggcgagaagaatgatcaaatgcttaaaagccttgaaggaagaa
aactaactttggaagattctttcttgatacttaagaacatgaaaatagta
agtataacgattaaaatgaaagtaaatgtggaagatggaatagataaatc
gatggagatgaatagaatgataaatgtctgattaaactctccaaaaaaat
attttgacaaactcaatcaatagctcttaccgagcctccaaaaacgaatt
ctttgcaatccgaagtttgaagatcttcccccaaaatgttgaataagatt
aaataaaaaaaaaccttctgagtaaaagaaagaattgaatgttagaaaat
aaaatactccaaagagtgattttatgaatcaagtaactagaaacgtctta
gacaatgaataatgatagtgtctttgtataggctacaaattgaataaaaa
acaaagaactaatttttggcttcatgataaatttggtcactaacgttttc
atattttgtcaaaatggctctaattgtaatttttagccttttttggccat
caacctttgattttttttcaaactactttttctttaaattaagagtcatt
ttttttaatttcatgtagtatttattttattatttctcacatgtaattat
attatagggttatttaagtagtaaattacatgtaaaattccacatcatcc
tcgttagaaaaaatagtttgaaaaaaagaacaaaagttgatggccaaaaa
aggttcaaaaatacaattagagtcattttgacaaaacatgcaaacatttg
tggtcaaatttgtcattaagccgttaattgaactttcaatttggctaaac
aagaggtaattctagttgtactaaaccttcttgtcaactaagaaatctaa
aacttctttaacaacttaaaatagtttaaaatattgtaaaattcaaaata
aataaatacaaaaaatttaaaacttaataaatacaatattgccgaataag
ttttagttcgattggcataggtattgttgccaatgcagaaggacatgggt
ttgggtgcgttggtcaaaacttataatgatattattaaaaagaatacaat
attaactcatatataattaaaattaaaccttagaatttaaacacaaatta
aagttcaaaatggatcccatccaaaagttccatagcaagttgagtgattt
tccaggctttaaatttaataacttttgagaacttaattcaataaatttta
cctcgtttgtgtatttatcaacaaaccaaattaaaatcatgatataagct
taaaaacaaaaaagcctcagcttagggtggggtttggatgggcgattggg
tgcggtgcgatgcgtttagcttactatttgtctctcgctacagtattgct
acagtatttaatctcaccgccaccactatttttacactaatcgcagataa
atacaccacccatccaaacccacccttagaatagtcattaataaactgat
tttcgtatgtatatttacgccagccagtggccattgagagcatttctgaa
atctagtagaaagcgttgtaaaacttaacgtttggtttccaagaaaaaat
aaattaaaataaaaaataaaaaaacaatgatttggcttataaaaatactg
caaatagacccaaaatggaaagacaatctttgaaagggtggcattcaaaa
acaggtaaaggaaccaactgaaaaaactgccacaagtaagagatatcata
actttcggttactaaaaacatggggtccctccctcaacacaaataataag
aaaccagacgctgcatttcacaaacaaaagaatgaggggtccacagtttc
cctttccatgatttgacatgtcattttggcatggcaatgattcatcaggg
gatcacaaatcatgcccatagtgctatacccactaaatcctaccacgttt
ggctgactactcaccagcccccccgcccccccctccctttgtcttaaggc
ctttggtccctattttcaagcccccaccaccacaaaaagctggattatcc
tcctccatgttcctccttttcaactcctacactactccggtggtattcag
agatctaattaattaatgttgttattgtatgcttcggaacatctaccacc
accgtatatgtcgcagtaatatcaccaatttctttttttatgtaaattac
acttgaaatggattaagggttttatttttgagaccccaaattcaaaaata
atatttttctcttcttcttttttttacataatgattttattttgggtctt
ttaattttataaaaaaaatttattttaacttttcaattaattttttgtta
cgtttttttgttagattactccaaaatgaataggaaaattaaagttttct
aattttgtaggcgtggattgccatgtagattacatatcaacatttaatca
atttttttaaaatctaaaaattcaaaaaaaatataaaatttgtttttaaa
attaaaaatttattttttaaaactttaaatttttaattaaatattgacat
gtcaaccacgtgtatgtcatgtcaaaaaagttaacaaacattaattcttt
ttcattcattctgaggtgatttgacaaaaaaaacacaagttcaatagtta
aaagagacgaaaaattaaatgaaaggctaaaataactttcttttataaag
ttagagagcaaaatatgtcattataagtatttttatggtcccaagttaat
attccatggtatttttataagtagagggctaggttaattaaggtccctaa
gaacattttaaggtagaaaagaagatttttatttttattttcctcctagt
ttctaaagtgagaatcacaaaagatccgagttaaaggaaaaatataggaa
gtataaattgtgggggctctttatgccaacttaaggttaatgattagttt
agttaattcttcttcttttttatgatggtggtagatcacttttccatagt
ttataaaataaaaatcaagattaatgtacttggttgaatgggactactct
caaaacataattattgctatatattaatgttatctttaagaatgtatttg
gcaaaagcaacccactgattccacttcttttttatgttgtagatctttac
aagttcccaaatttttatgttttctcaagcagccttttattttagtgcta
attgcacccaagatttaatgatgttccaatgaagaatttattagcgaata
tccaagcacctttacaatatctgatcatcttttctcccctatgatcatag
gtctcatcattaagggaacaactaaaaacatgtaatcttgcctactcatt
ggtagcagatattgtgagggtatatataatacaaaaacctggttatctat
gaatataacttaattagtcttggactgacaaagatgataccatgaagaaa
acctgtttcaagttcaccattagaattatgtataactctcagccaggcgg
atatgtaggagtgtaaaatctaggaaaagatatttgtgtggctgagagga
ggtgttgggcatgcataagaccactcctttaacaagttggtttcctataa
ataaatgggaaataaataatataatgctccacttgccatggcaaggaatg
cttgctagctggttctcagccctcccccctctctattgcctaggccaggg
gtagaaaaacacccggccctttccatggttccccttcattagcctaccaa
ctctgtgaatcacacagtcgtatgttacactatcatgtataatatgaatg
atatttaattaattcattttttattttaaaattaatatatttacataaaa
tataatttttaaattaattagttttaattattgaagattaaatattcaaa
tacaaatataaatattcataaagatatttaattggttgtaaagtaaaaca
ttcttaaaagaaaattatttaaaacattattgtgtatatattaaatattt
taatattatttaaatattgtgaaagtcaaaactagtgaaagtaagattct
aacataactggcaagcaattattctaaataaatttacttactttaaaatt
gtaatagcgggtgctaataaaatctttcatgtaattcaaggattaaccac
acttttaaatttatctcacaagttataaatactttacttattnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaggattct
agagattcgtcaaagtattgtgttaaccttggagagcgaagtccactaca
cgattatacggatcaagacggatttgcttctaaagcagtggttcttttat
tatttacgctcaattgattcttgtttcctgtcagtgctaacggttttcat
tttgcagcagtttgatatccttgaatgaggtgtgaaatcaatatttgatt
acgttcacataaaaaaatgcattttcatgtgctaatttatatgattattt
atagctgtgaatatcgtgtcgaagatggcaatataatttaaagagattcc
gtcaacaagaaagcaaaagcatttggagaaattagagattgggaaaatga
tgtgaattatttagacgaccctaaacaaaaataaaaaataaaaagggttt
tggttaaaaccgctgctggtattcattgaaatgcctaacaagcttgtgct
gggagattcttgtttcaatacaaggggcggctgtgaaaatatgtcatgcc
atttctggctctacttactacatttcctcattatagactatagagtgctg
cccaataatgcatgcgtaattaaagaaattttactttgtcctttttacca
ctagataataatttaaacgaatagcctaaaaaaaggcttctttccttgcg
aataattagagaaattgatttagttgacaatgggtatgttttagttaatt
tgccacatttaatgcatgtattacatataatataatatgagatactcaat
taacaaacttttcttaatataataatgttaccaaacattttcaattctcc
tctccaaaactatttattattattattatttgtttttttcaacaacctct
tgttttattattaaaatttatggttgagagacaatgtaattagttctgac
tccgcattaatgcttagtatccaattttaaattgtgtaactcgtgtttga
ctggtgattatatttatataaggaccacaaatattttttttttttagaaa
tcgggacgtcaaattcaagttttcatacctaccttataatgctttttgtt
attaggtcatattttgaaattgtggcttcattgtttgtaagccatacgta
gggacggattgtatttcgacccttctactgaaaaatggataaattagcac
ttatacgtttcaaaacgtgcaaattagcccatttgttaaaacttttttat
taaataatgacatgaaaaatgctgattttttttttatggtaaactataaa
aatggttacccaactaagcttttcattctactttggtctcccaactattt
ttttctaatttaatcactaaacttttcaaattcaaatattttagtcatta
atgtttacgcattctatcaatttgatcctaaatataaaaaaaattcaaca
atttagcccttaatgtttacaaaatttgttatttcagttctatttctaaa
aaaaattaaaaatttggtcctcaacatttacaaaatctatcaatttagtc
caaaatttaatttttttaaaaaaaattcatttttagcattttataaccaa
ttggctaacccatgagagatattaaaataagaaaaagagtacattctttc
aagtcacttgcaacaagtttttttttcctataatttagacttcacactgg
accaaaccaattgatttgtaacttgtatggaataattggcaacaaataat
gttttaaatgcttttattttcttttagatctattttttttatcccaactt
tttagagttctttgacaagtgaattgaaatagggtacttttttttcttgt
tttaatttttcacatgggttagctgcagagatggcaaaaaaacccaaatc
caacgagtttcgagccaatctaacccggcaatgtaggtttttttattgaa
gttaggggttggggtgtggtgggctaaaattttaaaatagtcgagtcaag
tttagaatgaaactgcccaccttgcactgagatatttacgaaattaccct
ctatactagtctcaaggttatttatcactactaatctcattctaccgcct
ctatactagtccacgttcaccattgtaaggttatttccctcattttttat
tcttaatttaataatttattaaaggaatctttgttccttcttttgttttt
ctatgttgtaatcacaacatgtgtgtaaatatacattaacacacaactcc
ataaataaatcattaagaaaatctaatagaaaatggtgccaaagcctttc
atttaaaaaaattaaactcgagttagatcggattggagttgagtatgcta
ttaatttttgggtttcgggtttagagcagttaaaatattttaagtcggga
taagggttggggtgggcaaaaaccccccaccccaccccattgccatcact
agttagttggtgggttataaatggctaaaaataattttttaaatattttt
aaatttttagagttaggactaaattgacagattttgtaaatattgaggcc
aaatttattgtatttttagaattagaactaaaatgacaaattttgtaaac
attgagagctaaacttgttgaatttttatatttgggatcaaattgataga
atgtataaaaattagagggctaatttcgttactagaccaataaaaaaacc
cacatcagctcagagtgactaaaatatttaatttcaaaaattttagtgac
taaataaaataaattaatagttgggtgaccaaaatagaacagaaagcata
gttaagtgacaatttttaaatttacccattaaaataattttcaacatgtt
ccacatcattatttaatagaaaattttaactgaagagctaatttgcatgt
tccgaatatacaatctacctctaaatacactctttattgtttaaaaaaca
ttccataaaaaaattactagatttgatggtatcataaaataaatttaaaa
tgataatgatagtaagtatatgctacaagtgacaacacctacttcatcta
aaattttatggatgttcataggaataatgaaattaggggggggggggggg
aacctttgaataccatgcaaactgtgaatttaaaaccaaaattttctcca
taattaatctttgatttaataattataaggagaacaaggttaagaaaata
aattattttatttagatagttaaatttagtaagtaaaattaatttaacca
tatttttttttaaaagaaaaagaattgaatataataatttttgcaattac
aacaatgtaaaaataagaggggttttaggtatatatgtcatgattttaat
tctttattctataatttaaaacttaagattaggataatgtattccgtaaa
tactctccaactaaactttaattcccttgtatatgttaaaaaaattctta
tgtttaaaagaaaaatattttgtatttatttaaaaaaaaagttttaaata
atatatcaaatataaataagattttcttactattttctctcttctaatta
ctattttagcaaagatgtttgaaaatttttgtttgatgttaattttgatg
aattttagaatagggtcatttgggttgaaatcaatttatcaatttaaagt
taatgttttatgataagataagataaaataaaataaaatttgatttagta
gaattttcaaacttatattaaaattgacaagagtgagtacatacctaata
ccgaaatggtaaatgttctacaattattacactctcactcctcattcatt
ttcctgatatgtgaaagtgattgaatgatcaaaaagtaactgttggatgc
aatgttaaggcacttgttgagaatcaatccctattgtaacgaacaagtaa
ataaaataaaatcgaaaagatcgaacacacaaatttacgagaaaaaattc
ctcaaaataggataaaaaccacgagtgcaaagagatttcactacaataaa
atgagcgtataaaagataaagagaatcaaaagaaaacccgaagcctcaaa
atgaaaacccttcaaactcaaagaacaaaattctcttaatcttaatatct
ctgttatataaaacctagagtaactaaggcttatttagaagctgaaattc
atagcatatatgactagaatatccctaggttaatcagggtttaagtggaa
aactgaaacagtgttcaattgaaagaagtaaagccaataaaattgaggaa
cacgtcgtgacgtggctttcttctcgttgtgacgaagtatggttgtgtcg
tcgagacgaagcttattttctcgtcgtgacgtcagctgctcatcgagacg
aagagctccacctcgtcgtgacatcacacactatttatgctgaaatacga
ggtatactccacaaatctccaccttgactcatatttcacttaactccttt
gtcaagccctgttacgtgcctaattggatctttgtcggatactcatcaag
tccaagcaatgctcggactttgaaactggaagactttttgtcaacatgtc
ggctggattgtgttatgtgctaattttatgaatctaaacatccccttgaa
tgatcacctctcgaacaaagtgataacgaatatttatgtgctttgtcctc
tcgtggtgcatctaatctttggtgaaatgtatggcactttgactatcata
atatacaacagttgctcctttcttattaaccagttcgctaaacatgcctt
ttaaccaaaccgcttcttttatagcttcgataattgccatgtattttgct
tcagtagtagataaggctactgtcgcttgaagagtagctttccaactgat
ggcacaatctctaaaggcgaatagataacctatgagagacctcctttgat
ctgagtctcctgcataatctaaagcaacatatccgactaaacccttttca
cttctttcgaactctaagcacatgttggaggtaccgtgtaaatatctaaa
tatccacttaactgcatgtcaatgtaacttacctggtttggccatgcatt
tactaacaacactagtaacatgtgaaatatcgagtcgagtacatacacca
ttgcgtacatcaaactttcaactgtgcttgaataaggtattttcgatatg
tacctttcttcttcttcattttggggagaatatgaaattgataatttaaa
atatgcagctaagggagtacttatcagttttgagtcttgcatttcaaatc
actcaaagatcttcttgatgtacctttgttgcgataaaaaaccatgagta
aaaagagatttcactataataaaacgaaagtacaaaagaggaagggaatc
aaaagaaaacttgaagccccgaaataaaaacccttcaaactcaaagcaca
aaattctctcaatcttaatatttcaattatataaaacctagagtaactaa
ggcctatttataggttgaaattcatagtatatatgaatagaatatcccta
ggttaatcagagtttaagtaggaaactaaaacaatgtttaactaaaagaa
ataaagctgagaaaattgaggaacatgtcgccacatcgtgatgtggcttt
cttctcgtcatgacgaagtatggtcgtgttggggggacgaagcttgtttt
ctcgtcgtgacatcgactgctcgttaggacggagagctcctcctcattgc
gacgtcacaaactttttatgctgaaatgcaaggcatactctacaattagg
aaaagagcttgagtattgaattctgaagataccattgttggaaaaaaaat
cacaaatccctaaaaaattaaaccgtaatatgtagatgaaaaatacctta
atcataccaaaaagtaattgaatgaacctttacaacgtttacaaatgaat
ggaaaatagatagagtgctaccaataccaatacaatcttaccttcttttt
ttcgtaatgccaaagctcagaagcaaacagtataaatggaataagactgt
ttaatccttgaaccttacggatgaatgtattgatggctaatgaattttaa
gtacaaattttacgatttggcaacacaagttggtggtaaaaaaaccttat
ttttgggagtaaggggtgaaatattccaaggtatcagatgggtggtccct
gagttcaaaagaagagaggaaggggtgggggagagatattgttggggtcg
aaaagtacacatggccaggaaagtaatggttgtttcgtctcttagtgtta
aaccaaagtttattaattgactagactaaccccagtctttttgcgactta
ttgtgtgttagtgcgcttctgtgattttcgccttttctttcctgtatatt
ttcttcttcttcttcttcttttttttatcttttcttttttttttgtttta
tttttggtctccctctctctctctctctctctaagcctttgcttatttaa
aacctaccattgggcgtctttgtagtcctaagatctcacattgccatctt
ctctgctcttttgatactctgtttctttctatactctcttcaggtatcga
ggctaggcattgaaataagattttaaagcgtgtgtgttttgttttattgg
ctatatcccagtctaaaagtttttcctattttggtttctctgaaaatagg
cagaagataaagcaacaagaaactaagaaaaacaatgactaaccaacaaa
atgtggtggttcttgatgtgatatcgcggggtgttagcaatgtgttgcct
cgatcatctctgccagtgcccaagtccttttcaccgcaagaccttaagat
gttattgatgaagagattcgaagctgaaaatgggggcgctaaaatcagtg
cctgggtggattccatgagagcttcttcaccaacccgtatcaagtcctct
accactgcttccttacctgaaactgacgacactagttcctggatcgtagg
ttccatttctccatcaaccatcattacttcccacttcttcagcttctgag
cattaatgattaaccacccctttgtttctttgttttgttatctgttaggt
tcaccatccctcggctttgagcatgtttgagcaaatagtagccgcttcta
aaggaaaacaaattgtgatgtttctggattacgacggcacactctctccg
attgttgaagacccggatcaagctttcatgcccaaagaggttaatttctt
cttattccctattcatgtttatcatcagcctataaaactcctactaattc
ccttcttcgtctctaatcagatgagagcaactgtaagagatgttgcaaga
tattttccaacagcaatcgtgaccggaaggtgcagagacaaggtacatta
ctgtaccattatcttacagtcgatatactttttctatatttacatgttgg
attggattggtttttgatgatgggattttacaggtttacagctttgtgaa
actggctggactttattatgctggtagccatggtatggacatcaagggac
catctaaaagttgcaaatacaagaaagtaagagcatcagtgtacttgtgc
aatttcacctattgtactttttttcttctttttttcagcaccagtgaaac
accccttttttttttcttctttctttccttggatgcttctaattttcatt
tctactgtcaacttttttggttgtgtggtatccagggtaaccagggagtt
cttttccaggctgcaagtgaattcttgcccatgattgatgaggtttcctg
tctcccaccatcttcttcacttgagaaagttaaaaagaaaaaacccatat
tcaggaaagaaaaattatacctttctttttcttttttcccttttaaattt
tcaggtttacaaagacttggtggagaaaacaaaatccattccaggaacga
aagtggaaaacaacaagttttgtgtctccgtacattttcgttgtgttgat
gaaaaggtacaaaccaaacccaacttttgtcttcttttcctgtgtaaact
gtaaatctatactctttatatcttacttaaaaaagtgcctcagacggagt
atttatacatttgaaagttgatgtttatattcatattggaaggctaatat
catggttggtgtgattggcagagttgggctgcactagcggagcaagttag
atcggtgctcaaccactaccctaagcttaaactaactcaagggaggaagg
tattagagatccgacccaccatcaaatgggacaaaggaagagccctagaa
tttttgttggagtccctaggtgatttctgtactcatcattttcaacctag
gtcttttttactaggaatcatttcaaatttacttaaagaaatttagtttg
tgtttttaggatatgcgaattcaactaatgttttaccggtgtacattggc
gacgatcgatccgacgaagatgctttttaaggttggatttaattatataa
aatagatgttataatattgagtttgtaagtaaattaaagacattgtttat
ttatgaacaggttttacgtgagagagggcaagggtttgggattcttgtgt
ccaagctacctaaagaaacaaatgcttcatattctctccaagaaccatct
gaggtaattttactaatcttagctgcttgcatttttgctattttctaaca
ttaattttgggctaacttttaaaggtgtctttattcctttttactataat
tttacaggttaaggagtttttgaagcgtttggtggactggaaaaaaatgt
cacaaagagcagctaaatgtgcttagatatatcccaccctagaaaaggga
ggaaggaattaattattattatgtaattttctcgttttagagagagtaat
ttccaattgtaattaactaccatcatcttcaacaggctgtgattgaaaaa
catgagccccaagaagaattccataattttggaaaatctttgaattattt
ctctccttctccctctttttttttttttttttttttgcatatagccattt
gtttatgagatattctcagatatgttgaccataaaaatgagaaaaaaaag
ggtataagtttgatgatgctaacacgtgttgatgcagtcacctgcatctg
ccattgtaatttgtcttcccagatagaacctgatatataattgtaaacta
acagattaatgctagcagttcacgttcttataaaaataaaaattgaccct
aatgtcaggtttgatctgaagcaaacaaacattcagaatctacaaatcca
ttggttgtttttcctcctttgagcaacaaccaagtacagtcaaaagcttn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnng
tttcctcttatatttaagcttgattcgtgtattgtgtaaccaaaatttgg
tgtccatcgttattttataaaggggactaagtccatctagttgcaattga
ttgaaaatctaaaatgcaaattcaacaaatttacatttggtatcaaagct
agacacttgacacattaagccaaaatccagttcttaatttgctatcaatg
tgaaagaagcatcaattttcaaaccccctatgttgtatgacacaaactat
gcctaatgggtggtaaaattgagggcttttatcaagtctatagatgaaaa
atcttagtgctcaattctaaccgattgggaattaccaacaactaatgtag
tcggtgtgatgactcctaaacctaaagtaacccagaccaatgataaagaa
aaacctacaaagacaaaagacaatggagttgtgaccaatgacaatgcacc
caaagagaaaaagaaaggatgcagtgctatgagtgccaatgttttcgcca
tattcaagttgaatatatcaatacatcgaagaaaaagaaaaaggcaactt
gtgttacctagagtgatgaaggttattcaagtagttcaaaaaaggataag
gagcatatcatgaactatgttgcctttacttcccaagttattccttcagg
tgcaactaactcaggtggctaaagtgacactgacactgagcaaattggtg
atttcatagagatctacaaaaccatgttaggtaagtaggatcaagcatac
aaggccaatggaagactcaatgataaaaactccttgttaaagttggagaa
aaaattagtgaagtggattgaggaaaaaaattcacactaaaagaattgca
tgttgttcaatttgtgttgaagaagctaggatttagcagtgataagctag
atgaaatacttgcagttgatagaagagaccttagttaatggaggacttgg
ttatgtggacaaaggagacaaaatagtgaaaggagttgttgatcaatcaa
agtgttccaaaaagactgaagttattaaaattgaagatcgtaacaagcat
acttatagaattatgtgtcactactctggtttctcatgccatattaggcc
aatgtgttttaagcttctaaaggatctgagaagaaataaattagatgtga
cttcaattacaactcgaggaacatcaaacatgagagaatcaaaagctagt
ctgaagaagaaaataccatacttgttttattgttgcacatcaatcaatga
aagttacaaataataatgtgtgttactttgatagtgaatgctctgggcac
ataattggtaaaagtagttttctcaagcttttccaagaaaatcatgaagg
caatgtgacctttggtgatggtaaaaaaggcaatattcttggaaagggtt
ttcttaatgttgaaggcatatctcagttatagaatgtttttcttgtagaa
ggtttgaaggcaaatttaataagcattactcaactttgtgaccaggaaat
gttcatgaacttcacaaaagataaatgcctagtaactagcaagtctaatg
agcaagttacgaaaggttccagaatattcgatgattgctatagattgatt
ggacctttgaaagttagctcatttgatctggagctatggaatgataagtt
aggccatgttcacttcaaaggcctacaacattttgtgatgtggcgttata
ccttgcattttttggcttttcttctcccagtcaaactctattattagttt
ctcacttaggctcttattagtgtaggttattttaatattatttgacctat
gaatttagcctataaataggtctttttccaccctagaaaaataacccatt
acacatttagatattagcttttacaagctttcagagaattttgtattcat
gttttgagggttcttattttgggtttcgaggtttagctttatctctatct
tttgtacttttcgtttttgccgttatagtaaaattatctttgcccgtgat
tttttatcctgttcgaagggggttttcacgtaaatatttgggttcgatct
tttcaatttgtttgatattttacttgtttgttacttaacagagtttatcc
ccaacaaactagtattagagcttgatcggtttccacattcaacccatcca
gagatggaagcaacaaggtttgatattgataagttcgatggcatcataaa
ttccaaaaaaagcatgtattagtctgtgtggagatagagagcactcattc
tatttaagttagaaacttattctagtgcaaattcgttgtaagtaattagt
cttgttattcagtttacaactaagcttttaagagggaagtcttttttggg
gaaagttctctatattagtatgagcgttaggttgcaatttggtgagtgag
ttggagttatatcatgttttgtgcatgttgatttataatagattacactc
taggtaaagccacaaagatgtagaaagtttttgaactatgtaactaaaat
tttggtgttcatcttagttttataactattagtaagtttatccaattgta
tctgaacgaaaatttgaatggcaaattcaatgaatctataaattgtcgat
gaattagataataacacatcttttagaatttttaaaaaaaaagttttttt
taaaaacttaaaaagttttaagtatcatggttgatttgataataaattta
ctagtgtcattatttttgaaaggtgaggtttgttagaacataggtgtgat
tgttatttggtagaagtctaattcaaaaatggtgcccgtgatggaaaagt
tgtgattagagagagacgaatgtgagatgaaccgaactcgcattcatttg
tgtatggtgatttgaattcaacataagttacccctatgattttgatgcat
gattgagacacaactcaacccaatttggaccttcacgtgcttttcatcaa
ggatctaaattacatttatattgttgtctggaaaggtccttagattgcgt
ggagctaacatattaatacaaattattttattttttttcaatatatggag
ctgcaattacttttgcatataaaaagggatgctttattctgcaagaaaaa
atattaccaattgttcttcctcttcttatgtttattaaagttgaaacttt
attactgttagttgggcttagaataacatagggaggagtgtttcggccca
actttcttggaagccttactagtaaaattattatgaaaaatgttaatcaa
ctactcgtcatagtgttaagctattgaaattaactcttcatcaaataaaa
tcaaagatacacataccacaaattttagcaaagcttattttctatatata
ttttgacttaattaattccattgattcccttcttctattattcccaacta
tatgattgtttatttgcttttctcacgacataagatgcccatggttcaac
ttcatttaaaactaaaaggacttttaagtatcaacaatgttttcttttgc
ctaaatctagttatttattaatcaaacatagaaagtataatattttacaa
ctcaaatcactatcaaccttattgttaaattatatcaatttagtgaattt
taaattcatttttctcctcttatctttatgatggtgttaccaatgaaatt
tgttaggcttattaaaatattgtaagaaatgtctaagatttatatttcta
acttttgagttctatattggtagtcgtctaacgaaagaagtcaagcgtaa
ggaggagaaactgcctgatggagaaccgggactcacagacagtttgaacg
aaaaaggaaaagatctctttttcaggataaattcattacttctttcagca
ttaatacaaatactgagcagactgtccaagaggatgatcttaatttaaaa
agaggatcaaataaattaaatatataggagggcaattttataaatatttc
gaggattcacattaaatttgacccggccattttctaaaattaacctaacc
caacccaatttaaaaccgatttcaaaaaactaaccctatctattcgaatt
gactaggaacccattggttagttgttgcaagtgattgttagtttctattc
atgcatctagtaattaatgagactctagtgtcacggggctaaaactttag
cctagtaaatcgcactatcttaaacgatttattgggtttaaatctaccta
attctacataacactccaaaaaggagaattcttgcagaaattctgtaagg
cactgaagcaaagtggaagtaaactcgaaagagaaagaagctatgaaaga
acagaaaagtcaaataaaaatagcacacactaagtgtttgagtaaatgct
ctcaaaatgttctttaacttaagaatgaagtagaggggatcattaaaaat
gagaaggaatgcatctatctatagttgagctcccccagattcaacaatat
agatcaaattacatcaacactacgattagtgccaatctacaagatgaaaa
tcctaagtgatttaaactctatacatctttatctcttaagatttacaata
attaccatggtaactctaattctactagagtgtttcactaggccaccatg
gcttcaaatagatgggtttctacatgtgttctgtgaatcgggccagttca
agtgggtcaaatgagcatcatttaatcagttgacttccatgggacattct
gtatgtattcgtcacaagctttggtccgtggcctatgacaccagtatata
ctaattaaatgactactagactccttagattcatctattgtagtcacttt
gattaaatataacattgatgacattacattacttaatagttagctccctc
cccaataggctttaggaaagcccctttttttgtttttttttttttttttt
ttgttgttgttgagtaatggtttgagggatttgatttcagttacaggtgt
aatagggatggtgaggaaagagtgatcagtatagtgaaggcaattgagtc
aagagaggtggagataatgatcatgaatggtggtgatgttgaattgtggg
gtgtgaatattgtaaggctggggaaaaagagctattgaagagggtgagtt
gggagaaagtgtattgtgtgtgagcttggggttgtagttcgattggtgga
gctggaatagtgaatatatagtggtttgagatggtcaatggttgagagtt
gggtgatggtgtgcatgagttggagttaaatgctaggcaaggactaagaa
taaggagtacggagagataagcgaagaataaagtaaaaaagaaaagaaaa
ggataaaaattttaaaatactgtgtttaattatatggcaatgacgtgaat
gacatattaatatttaatagtataatttatatcacatgagacttttgtga
tgcttttaacattagataacagtacggtgattaaaaggttaaaaattata
atatcagtgaccagaacgtaatttaaattatacataaataattattttta
tagttaaaaaaaaaggaaggaaactctaaaaaattggttcatcattgaaa
aagctattgaaatattttactgtatttttcaataaaaagttagacatgtg
tttttgttatttaattttgattttaaagttttttttttcttgtcgaccat
gtcatattaacaacgatagttttgttgtataagcataattatgttgaagt
tgagagttatatttaaataaaaccctaatatttaaacagaaaatttttat
cattccgtgattaaataattcaacaatataaggtttaaaatatttaacat
gccatgcaataatattcaggtaacatgaggtattttctagataaataatt
ttctagaagaaaatttttttaaaaaaaaaattgaagaaaaattaaacttt
taatcgcttaaattttgtaaacgttttattcagcccaactaacacagcat
attttaacgatgtgatttaggtatatttatcccagcgaaatagatttaat
tttaatatatatatatatatttgaattttaggctaagaagaaaacgaatc
attttgtttttctatatgaaatagaaaaagaaatgtaaagaaaattatag
aattgatggaaggattaatgaataagctaaggcatttagatgcatatcca
aaggtaaatgaggatttctacagccgaacactctccggtggcttcatcac
tctcgtctcctccgtcgttatgctcttgctcttcttctccgagatccgta
acttcctttcctctgctctatgatttggatctgttatgttcttccctcaa
tttaaattgatttggtcttcttgatgatatacgacttagttgatctgttc
catccaaatgtctttcttttttttgtggtctcggttgtaggattatatct
gcaccctgtggttgaaacaaagcttgtggttgacagttcaagaggggaaa
ctctacgcattaatgtaatcttaacttccaaattttctgaagattccttc
tgtgtccatgttccatttcgacttataatttctttattatatgctaattc
ggatattctacattatcaaaattgagtgtaaatgttataattgtttcttc
tttctttttttaagtttcattcatcgtaatgcgatgtaggccctttggga
ttatcccccctaatttcttaatgttccttttggatctgaaagtgcagttt
gatgtcacattccctgctatcgcatgctcaattctcagccttgatgcaat
tgacataagtggagagcaacaccttgatgttgtatgtattgcaagatctc
atgctttttttttccaattttatattgatgggttttgtcttacgtcaagt
gtcgtaaaggaaatgcatgcgcatgtgcatgcgcatgcgcatgtacttgc
tgctaaagtcataatgtcatttatttttatctaacttgcagaaacatgac
atagtaaaggaaaggttaggtgtaaatggcaatgttatagaagtgagacc
ggatggggttggttctcgcaaggttagctatattgctcgaagttgatttc
acagtcactttctttttttcccttaaaggatcatagaaaccagacattca
gcttactttttgacctttgcatttctctctgctcataattattttgcttc
tcacagatggaaaagcctttacagaggcaaggtggcaggctcgagcacaa
tgagacgtattgtggttcatgttatggtgcagaatctgtatgcttcatct
atctggtttccatcagctagttcattgtgatacaagtcaatccactgggt
gtatgtttgtcctgaatatgaaggatctttgactttatttgtataggtcc
ctgtaccttatcctcttaatcctaataagtatcgttttgtgatgctttgc
ctagatattatataaaacttttgataagtagcatttattctttttctttt
ggctatttccttaatgtctttcgttttggatgtggtttattagagggtga
agaggcagttcatgtcgtcagtatttagatagggaaaaatcattgaaaca
agtccagttaagaagtactattttcttgctccaggtatttttatttaacc
tgccctaacattctcttcacttccatcttgaagattgatggtgagtgttg
caactcctgtgaggaagttcgtgatgcatacagaaagaaaggttgggcta
tgtcaaatctggatttgattgaacaggtctgtgtgcattagagctctatc
taatttttaggtaacttcaattggaatgagacatgcatagtcatatgtgc
agggataaataatattgattttgcctttattgtctttgatattgataatc
atgcttgtgttcatttttattttggtaagctatgtagtggccatagcata
cactaaaacctctttcccctccttataatgcctacagagtactccaaata
catagaaaattttaaataatgaacatacccatgtcatacacatatccatt
tccatcactcattctggagtctaaatatacaagtgaggtttgcgtgagcc
aatatcaacagtgtacgcttgtccaagtgtagttgtactttatttgcttt
ctggtttgctcatctaaagattttctgtttctcctttactgttggcctac
atgacttgaccctggtttatgtcttggtttatgtgtttgttctgttttct
ggcgttcagtgcaagagagagggcttttttcagaagattaaggatgaaga
aggtgaggggtgtaatatttatggctccttagaagttaaaaaggtggcag
ggaattttcattttgcacctgggaaaagctttgaccaatcaaatattcat
gtacatgacttgcaagcatttcgaaagaacaggtttaatgtaaggcctta
ccctattatttgcattctttatgcacattagcttgtcttatatggaaaaa
tggttatctaacccaatctaatcatgcttcatgtacatttaatgcagtta
agtcacacgatcaatcggttagcttttggagatcatttccctggtgtggt
gaatcctcttgatgggtactgccaaatttctacttaatcgtttaatgttg
gccatgtacaaaagctggatgttagcaaatgattcttttaatttatgctg
ttcatatttctctcttctaaatttcagtgtccaatggatgcaaaaacaac
caattgggatgtaccagtactttatcaaggttagctttctgggtgaatgc
accttttctccactatgatcatattctccaatttttatcaggtatctctt
ctatctagtaattgaaggcaggacattaccctggatgtacactaatttat
ttttagtacttcattttattccattagcctgttagtgtctgtaacatgtg
acatctccattccaacttctgcatatataaatgttacatgatctaacact
gttttaaaatttaatctttccaaatattcgataaagacactacatggaaa
ccttaatggtgcaatacataaaaagtctgcctgattaacttaatcattgt
aaacttagtttatgctgtcaaatttattgaaacatttcctttttgaaatg
ctagtgacactagcaaagagatccctaaacatttccattttgaaatgcta
gtgtgactaatccttgagagcatgaaagaataatgcaatcccttagactg
agcagcaagaattattactaatgttgtaacctcttgagtggattgatggc
tcacagtcattttaagggggcatgggttcttcaattttgtgtcagataca
tgtagcagttcttgtttctaaatgagctttgaataagaaaagggtctgtt
agtttgagggatttttaataaactctctcttgtaggttgttcctaccatg
tacaaagatgagaacggacacactatccagtcaaatcaggtgtaactaaa
atttgcaaaagattcgatttggcttattctttcatttagtcaaaatgatt
aatgcatgagagattggtattgcagttttctgtaacagagcattttaaag
gtgcagaaagaggccttctcgataacctcgcaggagttttcttcatttat
gacctttctcctatcaaggttggtttctcctctgtttttttgttttcata
caatctcaatgtctgcatcaccttcaatgttctcttctcgccactttcat
atgtacaagggaaagccttagagatctgttaaagggaggtgtaataaatg
ttagcttaagttaggactgtttttcaaattgtttcgattatgagtcctgc
taattcactgagcttgttttaaacttcatttcgcaggtgactttcgcaga
gggacatgtctcattcttgcacttcctaacgaacgtttgtgctatagttg
gaggtaattgtcctttgcccttcatggttgatgtgtaatgtgttgagtat
atatgtatgttacaatcggataggtgttgtgcattgtacggcaggcgttt
tcgcagtttcgggaataatagactcgtgtatataccatggtcaaaaagca
atggaaaagaagatggagataggtaaattcaattgatgatggatagagct
ggtggcttgaaactggggggcttctgcttcatcttaattccagttggggg
gaattgaagcaagcaaagatgatagaccattgccacgtacttaccccatg
gcctgttcgttcattaccgactgaaattttgttcacacaattctctccaa
ttatatcgattgatcggttcatataaaagatgtatcgacacaaatttggg
tcaatttcattccactgcttcaattttgaccaatcataaacggaccccca
aatgataataatgagttgggattgagcaattttcaaatgaatggattggt
cttgacaccaccaccatctactgtactactctatgctgcctgcctaacta
gtaacttccaagccaacttgctttcctatattatattaatttcaactttc
ttccattttgacagattgcgtttacactttgataaatatttgaagatgat
gacacaactattaaaattgaaattattttttaaaaaatcttaattaaact
acaaatagtaaataaaaaatagtgtcgtcctctatttatgatgccttact
ttgataagaaaaaaaaagtggaaaagaaggatgaattcaaatcaaattca
atcccaacttataagctattttggacccaaaatcatgattatgtcggaga
tattaatgcttcttttggttagcatgtaatgataacatgatgatttagaa
agaatatggataatctgaaagtggagagaggcctgcatgattatgagcga
aaaaaaaggagcacgcgtgcgtccataatcatgattgaaattcaattacg
cacacagacaaagagctgttgcaaacgcgttactttaaagtaaaggcact
gttttgtgtaagacaaaatcttaagaaattgtgactgttgaaaacaggac
taaattttactttacgccaaggtaaggtagagaggttccccaccatcggc
gtaaactacttaaaccttcttgtcttgggtctattgattgttaggtggtt
ttaagataccaagaaaactcttccctggtttgtgccaagctcctgaattc
tgactcattctcgggactccaaacacattcaacatttctgcatgtaacac
aatttaattcaaatatttactgcaattttttatttagcagatataaaagc
tcatctcttccaagaaatcagaaaatgaagaaaacaacgataccagagaa
tacaacataaataacatttaattcgtacaaaatacaaaagctatcaacct
tttttatagacactaacaaatttcaccgtttggttcagcaagaaaaaaaa
cgagctgaccagcatggagaaaatcacaaagtcttacgaacacaagcact
tacattcattaacagactcttaataacctaaaatacatgccactgcaact
gccaaaaaccccattgcagctagctttacaaaaaaaaaccaaatacatga
aaggaaactcctaaacaacaaaagactgttacacagaaaacgaaacatgg
gtttttcccttcaggcttttagatggaatcccaatcgatctcagaagggt
acttggacaacataaaagtttccgaagaagaaacgacttccggccatggc
tgttcgtcgaaatccgagaatgtaagatctgataaaggtgaagatacagc
cgaaccctcactctcggattgaaccgtagacaaagatgaggagttctcca
ctttcgctgtattctcctcgggctttggctctgccatgtcggatttgttg
ttgctcctgcttttggtgtctgccgtaaccttggatgatttcttcttgct
cccttgcttagggttttgttccaagctctcacaaatggcttgtagcttag
cgtcaacagaagaaggcaaaggcttgtagtcaccaacgtgggaaccgtgg
tggcgaaggttagggaagttgagtctcgcaaagtcacctcttagtttata
agctgctttgtcataagccaaggctgcttcctcggcagtgtcaaaagtgc
ctaaccaaagacgtgtccggtttctaggtaaccggatctcagcgacccat
tttccccagtggcgttgcctaactcctctgtaaagcttggtgggtttgga
tggcgcacccacgtgtttcattggaacaggtttagggctaagaaagctaa
ccatcgggttactgttggcgctgatggtgttgggttgggaactttggtaa
aggtagcttggttggttgttgtggaggtggaattgaagctggatctgatg
gatctgagcttgtgtcaagctatttagcccaattgttgaaccagtttgag
gctgttggggacatgataatgagtccatttgtgtagggtaagggtaacaa
cagctatctgggtaaaaattaggctgtgtttcggaagaagagaaagaaag
gtaagaagtagaaggaagagaagaaggggaaggggagggggagggggagg
gggaagaggaggaaacacttttcataaaaggttcaagaacttccatcaat
tctcccccatatagatctgattgatctactccactactaatgaaatccat
tgcagctgccattacactaaaactagaaataagatgaggaccaaattaaa
aataaaaattaacctgtttcttaccaaaacttgaagaacaggtcctaaat
ccagaacggattaaaagaggtttttctttttaaaaatagacaaccctttg
aaatccaaccaaaaaaaaatttaaaactttgagggatcaaaaattaccca
caaagcgaatttatctacagacgaaaaaaaatgagaaattttctaagatt
taccttgtaatagaaacaaatattgaaactttgtatcaacaaagctgaag
gaaaaaaaaaaaaaactggatctcgtttctgaaaacacctgacttttaaa
gaaatccttgtctaagtttgcttttgacccatttgctaagtactgatgaa
aaacaaacccaaaaatcagattttgattcaaaagacagatgattaacaga
aagggattcagagaagcggggattaatagagaaaagggggaaagattttc
aaacaacaaaaaccagaaccactcaaattgtctagatctcaccaaagaac
aaaaaaaggctctcttctttttctttctcacaaatttatggtgtgaaaaa
ctcagcctcacttggtttatcctcaccagctcccttcactttatatacta
cttcagctccttaattaactcgcttaatcacctttattaatcatcattaa
cccactgttcttaagttttagctacaattgtttctatttttttatttttt
tggccttctctccaccgagctctggtttcctaacgtcagactcattcaat
ccgttgtctgtacccacttatgtctacacgtggaaagatcttattcactg
ccgacacctgtgcttttacttaccgtcagatacgacgctttttgtcatgg
atttaatggcctgcggagtatgttgaccattcgtgcttgcgttcacactt
cacaccttgagtaggtaaaggataatatctgcgataaggccctgcaatat
ttgtaattttaaaatttagtcagaattttttcatatttcaaaattcagat
ctaattaataatgctattaaatttttccattaaatttattgaagcgattt
tttgaaacaaaaattacttatttgataacgtgtaactcaacaatgacttg
taataattctaaatttgaaaaataatttgacttgaattttaaattagaaa
agtaggtaactaaattcttgaaataaaaattgaagaaataaatttcaata
gaaaaagtattgaaacttagagcatattttaaccttttcgtaaataataa
tattataatttatgttatttaaataatatcaaattctatcattagtccat
gtgtagatttatttcatatactttcatttgatcaaatatagtcaatatac
tttccaattttgaattttagtcttaacaaccagcaacacgtgaatctttt
tggttattagtcttatacaatgcgtaaaattttagatttagttaatgttc
tacaattggatcactttaagttgctatacttctctagttttgaaatttca
atcataatgcaaatgacattcattaaattcattagctgatattttcacga
gtgatatgtgaaaatagctaattaacatgataccacatatgtgttaataa
gtttaccacatcaatttttgaaattggcataacttaacttgcagaattta
ataactaccacgtaatcaagagtaaaatttgaaatgtacaaaaattaaaa
ataattgaattaaagtaaaatgattaaattaacaactttcacctagtgca
aggattaataataaaatttattctttaaataaatagtaatatttaagaca
ccattgtaccaaaagtcaacacaccatacgcaattgggatgtgtgatatc
ctaatccaatcgtatgcatatatcatgtattattcttttagattttaaat
ttactatgcttaatattgatttaattttacattataattaatcttatatt
gtcaactttttttttttgtcatggtgatatttttgaaacaaagtcaaaag
tcatcaccccgtgtgtaaaggaattgtttttcaagaatattagattttgt
aaatatatatatatgtatataatttatgtgaaaaaaattatgttaattat
ttttctaaattgttatgttttaatttaaggtgggtttagattgtttgaaa
aatgcttttgaaaggttcaatttagtttttaaatgttaagtgttactata
aaaaaaaagtatttgttatactcctacgtcaatcgaatacgtgttagtat
tagagatactgttgacctcccagttgactctatctagaattatatcttgt
ctgaccacttactctcaacatcattttgtaacaccattcgcatcctttta
aaggagccaaccatatgctttttaagtatgaacataccttcaaggctata
aggggcctaattaagcatagtaacctcgtactaattgaatgaataacaaa
tgggtcccattgtgcatgtcttttatgtattggatgagaataatcttatt
catggcaatctgccatgtcacactaatggaaaataagaactctcctataa
atactttaaccacatatgaataaatgatcgatttttcagtaccctaaagt
tattacgagcaattgttctctcaattagcttgtcattgttagtatgaatc
ggcaacaatacttttgaagagttaaaatgtctattttaaatacgatgttg
tgatacatttaaatgatattcaaattcgttaatattattatatttcaata
aaaatataaaaaaattacaactcgttaataatacttaaatgtacaaaata
caaattttaagccattaatataaattaattattaaatttaaattgaagac
ataaataatgttttagatattaaaatataaatagatgtgagtataaaagt
aaaaaaaaatcttagcataaatattaaaaattacactgaaactgaatggg
ctaaatatgattataaaagtgtttattttgtttttgaaaatgatgtatac
ataatattgctcatggctcaaaaaaaataataaacaaaatctttcataca
ttgaatgaaaaaaaggcaattaataaaaaggtggagccgaaactaatgcc
tcaacaacttctttccacttggggtttaactcattatttacaaaatttat
attatcttttccactgtcaataatatgatatatgaatctaatgatggcca
aataatgcaaagcattagcgtaattagtaaatttatatgttcccacttat
aaaaaaaatattactttcaaaatcttatcttttaatttcttttctttcga
ttgactagtagtttaattagtatgagtattgttgttaatatagaaggatg
tgggttagaggagttggagagagactttggatggttttaggcattatgtt
aaaaagaacaactatgaccataaattagagttaagaaacatgagattcaa
attcaaaatttaagcaaatattatgcatcaattgttgaccattgtcaagt
ttagaagttattgagaagagtatggttagctttacaaaaatatctatata
tacaaaaggaaatgggtatttttatttgattaaatttggtaagagaataa
atgatcacacaccaaatcaaaacaattgttcagcttttaattaattcttt
ataattacatttaggtgtaattatgctagtgctgcttcaattttaacacc
ttttaaaatgtcatcccggtgtaatttatatactgagtacttttattatt
tggatttgaaatttttattccaatcatcaattaaggtttgtttagacaac
acggaataattgaatgaaagtgtaatttttatactctcttgtaattacag
ataattgtaatctcttaaatgtattgggacgaatcttctagatacgnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnattg
atgccattcatccaattaggttgttagacaacacggaataaatgaatgaa
aggtaaatattatactctctgtaatacagatatgtaatttctaaatgtat
ttggtggataacgtttagtacatcgtaattccctatgtcatgtttggtag
cacaatttgtaaattatacaattacataatttatattcatcatcatctaa
atttgaatatgcatcattaaaattatcaagatcttcctctttcatgtact
atttgcaatataaatcatctcaattccacctgtgactaaatatacgaagt
atgctacatgctagtacaatccaacatttgttttctttatactatattaa
ggtgatattgttaatatgagaaatatatatttttttaaaacaacaaatgt
cttcttaaccatatttcaaagccttgaatatctcaaattaaagagttcgc
gagctataacacctctaactcatatccgtcaccggagcagggttacgaag
cattatcggagtttaaagatttaaaaatagtttacacatgtcatttacta
ttcataaccaaaattaaacatattcaatcataatgtcccttgaatgggcc
ctcgagacctaatttatgctttagaaacaagtagggactaaatcgggaac
ttaaagaatttttcacaaaatctcaacatttttcttaagtacagggacac
acacccgtatggctaggccgtgtgagccaagtgacacgcccgtgtcccaa
gccatgtgggaattcgatgtgcggcatacggccgtgtcctagcccgtgtc
catgcctatgtaactctctgacttgggtcacacggctagccacacgcccg
tgtgtcaggctgtgtggacaatttcattttcaaaaattaggtgcaagggt
cacacggccaagtcacacgcccatgtgctaggccgtgtgacatacacagt
tgagacacatgcccgtgtctctgcccgtgtgagcaattcaaagcattctg
tttctcaaattttaagatgcaagggacatacggtcaaaccacaagccctt
gtgtatggtcgtgtgtcacacacgcccgtgtctctgcccatgtggacaaa
ataaggtcatttccaagccttatttctcactcaatttgccttccacctac
aaaaaaacacttaaacatgttcaccaaccaattcaaactgttcaaatcaa
gccaaactcatgtaataagtatgacataatatcgcctatatgcatattag
acttaatgtgctaactcaatttagccatcaatataacgatatgctttgca
tcacttaaccatttcatacacataccaagcataataaagctacacacaaa
tatatatacttttacttcaaaatataactattacaagccattccaatggc
tagttctaaccaaaatatttcttctttatgcttaacttagcttatacatg
cttaacttagcttatacatgccattataccaaaagttagtttgatttata
tatcgagaagtccaagggatagtgtgatgtgtctccgaccaagttccaac
ctttacgagcttctgagtactacaaaacataggagataaaacagagtaag
catattatgcttagtaagttcgtataatagaaaattaacttaccactcat
ttacatttaaaataagcatacaaatttcatccaaataaatttggcaattt
gcctaaacacatataatctcaaaaaacttattagtcatgtattacattta
cacatcaagaatcaaggatgagctcatcttgtaataccttccatatacat
atgcttttcataccatatttccatttaacatgtgtatttccatgacaaat
catctaaagctcagttcaaccatgtcagaactttgctcattaactttatt
tgaaatatcgatagatacacatgtagtacactcgaagtgtacaaatctgt
aatccgtcaactcatatttaggggtacccattagggcacataatcagaaa
gcactctctcgagccatataacaggaagctcatatgagccatgtaacaag
aagcttatccaggttgtataacaagaaactcataacagtttgaaacagaa
agctcatgtgagcttaacaggtaactccgaatagttattattaagaagct
ccggatagccatatatcaggaagttcaagtgagccatatcaggaaactca
taaaagagcctatatcgggatgctcataaagagttgtggtatgtccgcat
tatatgcaggatccatacctatcatataataggacgctcacaaagagctg
caatatcactgcaacacatgtagggtcaataccgatcgggatactcgcag
gaaccatgtaatgcgaagctcaatagggcttataataggatgcttataag
agctatggtgtgtccgcaacatatgcaggatcacaaccaatacggaaaat
cttgtatccatcgaatttcatttattcaaacgggacttaacgtttaatga
gtattatcagatatgtgactaattttcatacataagacatttatacaatt
cacacatatgcaacattcaattcaaacatattaatgtacataatttagtt
acacgaacttacctcgataattgttcgtgttcgtaggctactaatccgat
attttttgttttccttgatccaatttcgagctaggtctattcagatctaa
ttgagccaaaacaacttgcttgaactcattttctcttagctagggtttcc
atgtattttaatttggggaagatgataaaataatatgatattagcttatt
tccatctttaattaattcaatttccaatttagtcattttctttttctaat
tttctatggatgaatcatcataaatatctactatctccatttaatggtct
aattgccatatacggacctcaaattttgaattctatagatatttaatcct
tttagctactagaactcaatttttgcattttatgcaatttggtcctttct
ataattaaacatgtaatcggtaaaattttcacaacaaaatttttatacgt
tatttctatcataatgcaaaccatgcaataatattaaaataacttttttt
actcagatttgtggtcccaaaactactgttccgatttcattgaaaacggg
ctgttacacgagcaatttatgatgcttctcaaattgtatcatatttcatg
atatggtgtaagaaaaaaattttatctgcataattagtattgatattata
atatttcagttcaaagtccaaatagattgtagttttattataaaaactta
tataaatttaaattagagaaagacttatactaaattatatcatttttata
atatgcaaaataagtataaaataatataaattttataatatataaattta
ataaaaaatttaaattgtccaaaactttcataatgtttctcataaataat
ataatttttatcataacttttaattttttataaataagtcataataaaaa
aatttataacaattttttaaataagtatattatttttataatacgtaaca
tgagtacataaataagttaagttcatacttgaccaaaactttttttataa
atatatatattataacacttttatgacattaaaataaattttataataaa
attttggctagaaatttagaatttttttaagatttaaataatataatttt
gttataactttataaaatgcaaaaattatattatatttaggatttataat
ataagaaaatcttggccataataatatcaaacacttatacgtgttcatgc
ttataatataaattttataacttgtataaaataactttttaaaattgagt
ttaattttttaaaataggatttaagtgtaattactcaaattttcatttta
tctaagaattgaaaagtataatgaaagtactctaattaaattaaattcga
taaaacaaattaattacaatgattactcaaatagggcaatttacaaaaaa
aaactatttttttttaaaaattaccgaaatgggcccgatatttaattatc
taccgaaatgggacattttccggcaaatcgtgtccacatcagcgcgatgt
caggggacgcgccagcaagtcgcggccacgtcagcacactttgctgacgt
ggcaacaaatgatttgctgccacgtcagcaaagcacgttgacgtggccgc
aacttcatgccacgtagcgcgtttcgggggacgcgattttgccgtttttc
ccacgttaggtttttttggcttttagggtttagggttcaggctttttagg
gtttttaggtcctggaagaaataatttagagttgacgtttctgtgtaaat
agtataacatcgcttttaccaggatgctttatgagaagaatttgttaaat
cgcgcccacgtggacgcgcttttgctacagtaggtcctgaaaaaattatt
ttgagttgacgtttctgagcaaatagtataaaaaatgcttcaagctgtat
gctatctaagaagaatttctgaaatcgtgccctcgtggacgcgcttttgc
tacagttggtactggaagaaataatttcgagttgacgtttctgagcaaat
agtataaaatcgcttctaccaggatgctttatgagaagaatttgtgaaat
ctcgcccacgtggacgcacttttgctatagtaacatgtttgggctgaggt
tataaatgaggtaaaaaatgttctcagaatgcataagtcacagcagaaac
aatttagagaggctaagaaggttagagtttcaaatatgagtgaacgtatt
agtgctgttatttactacgatggtgaggtttgccacaccgagaatggtgt
tatttttttgtcggagaatacggtgcgactggtttttaaccagaacatag
atttgacaggacttcgtaagagaattaggcgtaaaattttcggaacgacg
ccaatgaaagttctgtctatcacgtattgattttgttcttctgttgatcc
ggtgacatatgaatccttcgacgtaaaaggtgcgcgtagcttggaggaat
tggtgcagactcatcttgctagtggaacaccttatattgagttatatgta
caatttacgtcgccaaatgatgtacttgcgaccggtgttcgagatgtata
cacgacccctggctgacactcggttagcgggttacaaaatatagaacagc
ccatgtttggtagcggtgtcgaatgtacatcccctgcaagacactctgtt
ggtggatgggacatgtacgtcggtggctcgatgtttgatgctggaaatac
gtactgggaacggtatcaagttctagtaagtggcaatctacatccaattg
gggacgttatcaaatgccaagaagaagggatgatgtactccgtacgacgt
caaccggtgagggaacctcgtacgctgcagatgattgtgggttagaaaat
gactccgatgtggatccacctcgagagcccgggccggatggtgcagaagt
tggcttattttctgaaccagagcctattccaacagaacctgaagatgttg
aaaggagttcagatgaagaagaaaatccacgattcagagcatactcacct
ccagcccacatgcataatgtcgatctgtctgcagatgatgcgttagagtt
tccagatctaccacaccggttgcgtgatcgtacaagtttgggggtaaatt
ttggtaaatttgaagttggtaatcagtttaccaacaagaatagttttatt
ggtgttttgaaacaatataacatcaaaaacggcgttaactaccacgtcgt
taaatccaaatctgataagtttgaggtgaagtgtgtggtccaagacggta
catgttcatggaaaatctatgcctcgttgaggaaaatgacaaggttgtgg
gagattaaaaagtacaaaggtccacatacatgtgctgcaggtacaatatt
gacggtttctgataatacttttattatgcaatgttgcattatttaatgta
ctcggtttataggtgtttcacaagatcatcccaagatggatttagctatg
ttagctagcttgatactgcccgcggttaaagcagatcctaggacttcagt
gccggtgttaattaccaatattcgtagccaaatggggtacacgccctctt
accgcaaggcttggatagctaagcaaaaggcgttggagaagatgcttagt
gggtgggacgcctcatataatgaaatatggcagtggtgtcaggtgctaga
gagatacgtcccagatgccatcacagaccttgaaacggaacattcgtact
acaacaaccgattgctacgtggatgccaagtgttcaaacgcctattttgg
acctttaagcaatgccgagacgtattttcatactgcaagccgttggtaca
aattgatagtacctttatgttcggtaggtatactcatcggctattgcttg
cagtggcacaggatggcggtgggagaattcttccaattgcatttgtaata
acaccgggggagtcgtctgatgactgagatttctttctttctaggttaag
gaggcatatgtgcccccaacctaatatctatgttatttcagatcggggcg
ccggtatactagctgcatttgatcgacagtgaagcttatggcagcgcaca
caccatagatattgcctaagacacgtagcttcgtactactacaaacaata
ttcatctaagagcgaatgacaacaagtgaccaacatgggtatttagtcta
tatatgtgttatttcgtttgtcaatttgaattagttttattggtagaagt
ggtataaattattcgctatgatcttatattggcagggtatgaaacaaata
aagatcgttttcacgagatgttggcaattttacgttcaattaacggagaa
ggggcggactacctttgtaacatacgtttcgaacagcggactacaatatg
gccatatgacgtcgaacctggctgaatgcataaattctgttcgtaaagga
acgcgtcatctaccgataatatcggttatgcgagagacatattttcgctt
ggcagcactatttccaaagggagcagcaagttatgcagaccagatgcagg
gaggccatgtatggtgcagtaaggtagttcaagaaattaacaaggccaag
gcgagggcaaacaccatgcacacagtgtgtcacgatcgagacaatttatg
gtttcgtgtgacagagtttgacagactgcaccaagatgttgttggcaggc
aatatcgtgtacacttgcgaaatagaacttgtgacaccctgcaccctgca
ccctccattttctccggaatagcgctcaaaagctcctagcacaccgcccc
caatcgctagattgggcagacccggtgaccgggtacccgtccaccggcaa
tcccaattgcagactgacatcttctaaagtgataatgcactctccacatg
aaagatggaatgtgtgcgtatcgggtcttcacctctcgatcaacgcactg
attagtttcgagtccaccttgcatccccggcctaccgtcgtcacgtgcta
aaaacccgcttctcgcatgtagttctctaccaacggtgatggaggaccat
gcatattccggatattgcattccaatacccgatctacagacttttataac
aaataataaattaataattatctaaaaaatgcataaataaaaaattctta
aataatatttagaaattaaattgaacacttaccattttcatttattccac
tgatatgtgatgcttatcaagacgagtcaattctccggccatttaaaaca
aaatttttaaaattatttaaaaaaattaagagaaatttagaaatttttac
agttcaaaaaaatttaaaacaaaaattttgaaaattattttaaaaaaggg
agttaagagaaatttaagaggaacttgagagcaaattgagattaaatatg
gatttgagagaaatttggaaggaatttgagagcaaattgagaggaaattt
agagggaattgagaagaaatttgagagaggattagtttatgaaaaaaaag
gggtgggggtatttctaattttttttaccgttggggggggggacaacggt
caaatttttgaccgttgcactgttcacgcgcgaggcaagtcgtggccaca
tcagcgcgctttgctgacgtggccgcgacttgctggcgcgtcccctgaca
ttgtgctaacgtggatgcgatttcccgaaaaatgaccaattccgattaat
aattaaataccgggcccatttcgataatttaaaaaaaaggagcttttttg
tgtaaattacccactcaaatatatcatttttgtataattataaataatta
catctaaatttagttattaataagtccctttcgaaacattaccgtataat
taatatttttctattttgtcaaacaagttgacaagtcagtgtggagtgag
acaaaattgatgagctgtaatcactttgcggtgcggcttttaaggatagg
atcctaactattatggtacgtgaataccaatgaaactgaaaagctgtaaa
aagaaaaaataaataaacgaagttaaaagttacaaaaatttaataaaatt
cctaaaaaaaaaaaaacaaaaaatatggagatatgaggtagagacattct
aatcttataaaattggatggttatttaggaaaagctaagctcacattttg
atatgggaatgatggcgtttgttaatttatttatatcattttttctcctt
cttcaatttttaaaaatagaaaatgaagggaaagagtggaccctacatca
ttaattttttatgtcaccaaattcaacgccaacttccctcccacgttctc
catcttataataatatatatgtgttttaattaaatttcacccacaaagtc
aaaaagagtaccccttttaaaacctagcaaatcgtggcacaacttgaccc
aggttcatcttggttgagtttacggttgaacaagtcacgtgcggaggcac
tgagcttcatcacaaactctacatttgcggcggcagtcactggaagagct
ccaatgcactgtcggagttatttgacccacgctcacaggcggagcgtatt
ttacaacgttcaaattcgtgaagtacttccaacaggatgtgacgttcacg
cttttgaaaacagcagcttcttctttttaatgataaaaacagcatcttat
tattagataaagtaaaagtgtaatttgggggctaataattattaattgaa
aaattagggagcgggaaggacaaatcttcttggattagaatttgaaatta
caagctaagggaggggattagggaaaccatgggcacgagtgttggttaag
ttagttgacccgagtatcgggtttaggataacccgggccttgtcggctgg
ggaaatcttcaacccaagtaccacctctaaatttggtttcatttggagtt
cttaacgttaaagtccagaaaagtcattccattattccggatttataaag
tgtaaaggtttattttgttaggtagaatgacgaatttagccttttatcaa
tttcacctctattttttaaaattgaatttcatcatcaatattttaaaaag
agttaaatcgttattttctttaatgaaaatattaactaagacattaaaat
tttaaatatattaatcataattataataagtcatgaaaagtgattgcaat
acgaaccataattataattataattatagttaacatattaataaataaat
tgttaaataaaatatgattattataattgtaatgtgtgatatctactagt
ccactattaaggaaacaattattttgtaattagttctaagctttatttaa
gaaaaaaaaaccctaaattaattagaataataaaaataaaatgtaaattg
gtccaaaatttaagattacgtccgtaatcttaaattacttaaggaatagg
ccgtcatcttgtattacgggatgaccataatgtgaaattatgatatgact
aaaatattaaaaattcaaatacggtgatttcattccataatgtaacatta
gaagctacaatattatattcgaccaaccaaacatcctaaaaattttattt
ataattatgccattttattactaataaaggttgaattcaaaccacactat
ttaatcataattaatatatttccagtctaagaaaataattataaatacta
caatatcatgtaattctattatttacctttaactagaggtgatcatgggt
tgagttatgttgagaatcatacttgaagtcttattactaaataattcgcc
ctttacaccatagaatcatactatttataatacaattgttaaccaaccct
aactactaactgtcaagacttctaactactaactaccatagctgctgaca
tactctaatatgccactatcctcttcgacccctgctaacaacacctgtta
aacatattcttttggacctagcttaagacatgacctaaacttagtaaata
aaagtactgacagtggcttggtgaacacatctgtaatttgctcatgtgct
ggaatgtgacccacagcaagctgtccagctgcaactttctcacggacaaa
gaaaagatccaattcgacgtgtttaaagttagaatgcaggactgggttta
caaatacaacaatcgctccggagctatcacaccacactgtaggttttcgc
agagaggaaacatgcagttctgacaaaagtgactcgagccagactacttc
aacaattgtctgagccaaccccttatactccgcctctgttgttgacctag
agacaatcggctgtttctttaacccccatgcaacagggttaccaccaagg
aatacacaaaaagcccatagtagacctgcgatcatctatatccgtaccca
attcgcatcggagtatccaaccacatccaacttagccgattttgtgaaat
gaataacataaccaatagtgcattgaagataaaggagaatgtgtttgact
gctttaaaatgttgatcaagggggcgatgcataaattgacacaccttgtt
cacagcaaatgtaatatctagcctggtgatgaccacatattgaagagcac
caacaatgctacgatactcagcttcattttcaatcacacaaccatcattt
tgagataatttggaagtggcaaccatatgagtaggagagctattcgcttg
atccatattggctttctttagtagatcaagaatatactttgactgattta
aaaacaaaccattagcagtgggggttacctcaataccaaggaaataacca
agaggccccaaatactttaaagcaaactgagtatctagtgaagaaacaaa
attgtcaatgctttgttgatgatttccagtaattattatatcgtctacgt
agactagaacatataagaccactcattcatcctttttaacaaagagtgat
gcatcagacttagcacaaacaaattgcgagccaagcaagaagtcacataa
cttggaaaaccatgcccgaggagcctatttgaggccgtataatgttttct
ttagcctgcacactagaaatccatcattactgtattgttcaaagccaggt
ggttgggtcatatagatttcttcagacaactcgccattaagaaatgcgtt
gttaatatccacctgtcgaagctgccatccaaacttaacagctaaggcca
agacaactcgaatagttgttggcttgacaacaaggctgaatgtgtcttaa
aaatcgatgcccgcctcttgaagatagccattgacaaccagacgaccttt
gtagtgagcaatagtaccgtcggagttccttttaagtttgaaaagccact
tgtaacccacagctttcctatcggcaggtaaaggaaccaagtcccatgtg
tgatttttcatcaaagcatcatctcctgttgtgctgcaagagtccactct
ttgcttgtgaaggcctgctcaattgtaacaggttcaactattgttagttc
tgcagacaaaacctttggcttgaaaatcccacttttggacctcgtttgca
tgggatgaaaattgactaaagaagctcgagtaggttgactcggtaaacaa
ctattaacattcatcgaagagctggaggatactgaattctgtcttgaaaa
aatagaagagggactattagaaaccatatgcacaggagagcaacttactt
gtggacacacatgtgaagtattagatcgtggcataagaggttcttgagtt
gacacggacatagttgaatctgaagagctgtctaaccctgagcgaggtac
cataataggaacaacaaaatgctgatgttgaaatttagtaaggtcacgag
caaactgggaagcacttgcgaacgtagaactaacctcaaaaggaaagcaa
cctcatcgaatatgacatgtctggacacaaaactttattattctcagcaa
gacacttgtaccctttgtgagccacattgtggccaagaaaaacacaaggc
tgagatcggaactgtaacttgtgagcccaaaatggtttaagatacggata
gcatcgacaaccaaagatttttagatgctggtaattaggaacagtcttat
ggagaacctcatggggtgatttaccattgaacactagtgttaaaagttta
ttaatgagatacactgcactagtaaaagcatgagtctagaagcatatagg
catactagcctgagctagtaaagtcaacccagtatcgacaacatgacgat
gctttctctctaccaacccattttgttctgaagtgtgaggacaagaaatg
cgatgctgtatcccaagcgacgctaatagcctttgaaatggacgatactc
tcctccccagtctgtttggagagctcgtatcttacaaccaaactgtactt
caacaagtttttaaaattgaagaaacttagtcacagcctcagatttactt
ttaatcaaatacgaccaagtgtatcgtgagtaagcatccacaaacaacat
gtaataaagacattcatcagatatcataggagcaggtccccaaagatccg
aaacaatcagcttaaaaggagctgaataaacagtatttgaaggtaaaaaa
agaagtttttggcattttccaagctgacaatctgagcaaatagagctcaa
tttataattctttgatacaacattacatttctgaagaattgtagcaacag
tcctatgataaggatgtccaagacgcatgtgccacagttcgaagaccgaa
tcaccagaagaatacactcctgactgtgctgtatgaactgcagttaaacc
agcagaagtgctgagattttccaaagtactgggatgttgagagagattaa
actgatacattccattatgcatgcaccccaccagtaatatggtcactgtc
ttgatgtccttcacaaaacaatgaagtggatgaaatccttggaaccacca
cctctaaaagatgatcaagacccatgaccaaattgtttagcttgcctagc
gtcggactcagtatgttgaacaacatttgccttcaaagatatacttgaaa
caagatcttgttgtcgagccttagaatcagtcagcattttcgtaaggtag
tcaagagaaacattcattgctgatgcgacaatgcgtattgactcatactc
cacaggtaaaccagcaagaatgatattgatctgttcttgcttagaagtgt
tagtaccaacaacaagtaaagtatcacactgaccttgaatcttggctaga
tattcttgaatagacaattgaccttttttctgtgaatataacgaatgtct
aaaagtcaacactgttaaagacgacttagcagcaaaccttctgagaatag
tactccacacatcaaaactcgatccagccctagtaagatgaacaagaata
ctgtcagaaatggtggacaacagccaagaagccaatagcttgtcttgttg
cttatgaaaaacaaaatcaggattagaaacagaagaaccattattgtcaa
gaatagactgtggaggaacctgaactgtttcgagaacaaattcatgcaaa
ccatatccttcaagaatcagcaagatttgttgtttccataaaagaaagtt
attagcagtaagtttcaccgtgtcatgtttaggaaactgatgaagtttat
gcgagaaagcatatccaagatcaggagaagaagcagctacaggtgtggct
gtgtgaacagactgatgatcaccatcagatactgcatctgttgccataac
cgaatagaaaagaaaaaaaattatggctgtgataccatgttgagaatcat
acttgaagtcttattactgaataattctccctttacaccatatagaatca
tactatttataatacaattgttaaccaaccctaactactaactgtcaaga
cttctaactactaactgctaattaccatagctgctgacatactctaatag
gttatccggcccggcccgacggcccgcctgaaaaatgagagggttcgggt
aaaaataaaggcccgaaatatgagtttgggtaaaaaacgaggcctgtttt
cgggcctcagctaaaacttttttagctcgggcctagcccggattatatat
taaatatatattttttatttttaataaaatatatattttatttttaatca
aatatatatttaaaatgggccggaccgggattggacaaatttttaggccc
atatttcgagccgggccaaggcctagaaaacgggcctaaaattttatctg
ggcccgacccgaacccgacccggcccatgatcacctctacctttaactaa
ccgatgaaattaaaaaaagaaaaaaaaagaaatattgattctgttttgca
ataatatatattggaaagttggaatcacaagaataagagaaatagattaa
ggttgactaaatgtatgattcaataatagttatatgatagtgtcacagta
ttagacttttcgtcgtgtaatttatgttgtcttagtcgattttttcgttt
caaatacacctaaattagcttaactttcgaaaagtaaaaatgcttagata
gaaaatagtattcactatttaagaatggaatacaatagataccaacgaga
aggaggctctctatttatagttgagttctctcaatctaacgatacaacta
actttatatcaacgaacgagatcgaaatctatctacaattgagggattta
tataattcccaatattacaaaatcaaatttatcatattacaaatcttcta
agtttacttttcctatttaccaatatagccctaattttccgtaaatgctt
cgctaggccaccaagcttcaagtagatgagtttcatcacttattcttcga
atcgaaccagttcaagtgggttaaatgaatcccatttagtagattaactt
taataaaacgtttttttgtgcaatagtcgtaaaatttaaatcgcggcccg
tgataatggttttcgtaaaccctattaacattaatttgtttaagatacat
ttcatataacaataataatagaagaagtggggcgaaattgacagtggact
ccccaagttaatgatttgagaagcacgacgcgtttctttcaaataatgga
agaatcatgtggtgtttaagtgcattatataatatcacatgccaactgaa
aatgatgttcaaaactttcatttggaaaaaaggaaagggctaaaacgttt
ttcatggttgctacgtgcttgtatgagtagcatatagttttttcccaaat
ggggctttaatgtaactacgtgcaatgcatgttttaattaaggaatgttt
tatattttgggttttttttcccttctaaaacatttcgattttggttgacc
aaaccttttccttttaggttttttctttcctttaataggacttcttttga
ggaacattaatggcgaatatgattcgtgttgaggtggactggtgacctta
ttctcctacctagttggtagggtgaaaagtattaccctgctttctggaaa
ttactttcctccaaacattgtttgataatattattctttttatacatcaa
cataatttgaatgtcaataaaaatctaattaatcattacctacatattta
aaaataaatagatttaattacgtttttttgttaataataaaccaacattt
attaagattaacaaaatttgggaaaaggccttccaaatttatttttttct
cttgtttctcttttgttttacttagcgacgataccaactttcgacttggt
tactacttgcccttttctccttcccaacaaccgctctttatttcatctac
tcattcattccatgtgtcttctctcttttttagtccgcaaacctattttg
tgtgtatctttgttgtctttacaagttgtgatggatagatgacagtattt
gttgtcgctgaaactctactgaccactaacagtttttttgaaaagtgggt
ggctctacgtcgacttcttaatatgtttatattttaaaagtattttagaa
taataaatgatttcacgagtcggtttagactcgtgttgtctttaaatttt
atattttttttgtttgatttccattatttaataagtctccacttttaaaa
gtttttgtttgctcttgtagcacgttttttaatcttacttatgcatatag
tattgcttttgtaagcgattttagggctggttgtgtcatcatcttctcaa
gtttggtggatgttcggttcttttactaatttttgcttgtcattttggac
tatccggggttgatttccttattgtattaagtgcttgcaaattgcaatta
ctgtagatatgacatgcttaagttgtgacatcaattatctgtgtgctata
atgttcctctattgttgaagaaacttgtccttaaccacctacaatgaata
ttgtatttggagaaaaataaaaaagatcatctccaatagatctaaaaatc
aactgacttaagttgttttgaacaattgcccactctatctcaaaaaaatt
atttagaaaaattgaggattttttcgtttgtttataaatgctgttcttct
gtaagtactgcctaaggctgtagattccaaatccccttctcttaatttaa
taaaaatctaaaatcacatgcaaaattgaacatttcttttcttaaattta
tgctacaaaattcaaatgcatgattgtcaactacaagaaatatcacatgg
ttcatgtatttctttgtggcataagaaacaaatcatgattcaatgcaaat
tccaacatttctgttctcaggatgtaaataatcaacagtcttaaactaga
gagtaaaggtatgctttgttctttcgttcttttgagtgtagaaatcaatt
tcatacgcatgcatatattacttttgttctaatttgatgatgttcaaaat
ttgaaaatttaaccttaatactaaatataattattaaattttatgccgta
aatatattatcacatttataatgccatattgaattttgattctttcacat
cattttagttaatgaatttaacaattattatttgggtgaaaaataaaatt
tcaaaaatataatagttaaattaaaaaatgatgattaaatacacaactca
agagtgagacgaggtaaaattttgacatcaactaaatttgaaagctaata
acgaattgttttgtattaaaagagtagagaagcattaggctccaaagtgt
cattgggtactgtttctttagcataccacaaatcaaagaagaaacacatt
gaagtcaatgcgcactcaaaaatacaaatggaagtggactgaaaaattac
aaaggaaatagcctggaattttaaatagattggcagccaaataaattacc
caaaatcacggcgttttctaatcaaccctatatgattcgtgtttaaagtt
taacccaatatttgttaaatactatacgatttaattgtattacaaaaaga
cgagtgcttgaggtgaaatgtgaattattatggtgagaagtttgatcatg
aaaatcgaggttgcgtcctctgagtttctggaagacagcgaaatgcttgt
cattgttaattttattagaaattgatgtcagcatataggctggatttttc
ctctcatttggtgaggagaattttccaatgctcaattcctacaaactttg
ctgcctcgcctaacatgattgattttccccttcgcaaacctgttgttgat
gttgatactcgactgttgttgctgccaaatcaactgtacctgaaactacc
tcaacatcaaatgtaataaacatctatgcatccactttttaaggttctct
ctcacatatttgatatgatcttcttcagacttttttcaatatataccacc
tggcccatactagttgcgggccttgaactgagcccatctaatcatatatg
ggcccatgcctggtatacccattggaaattttctactactactatatatt
aaaagttcaaacttgtttcattgaatatgaaagaaacatggaaacatatg
atggatcatgatgaaggtccaatttattaggcttaaggaagggataaaaa
aatagataaagaaagactttctctaacttgttcaaaatcacaattgcata
caaattctccagacctaccagcgtgcatttggattttgacttttccaaaa
ctcaggttgattctcttggctcattactcaaataattatataaaatgtat
tcaaaattcaatattgatttattgttaagactcatgccttaactatgatg
gagataattacaaatcgaaagataaaatatgtaaaattcgataatgaatt
taattgaaccatcaatattaaggtttgtgatcgcataactaaatttaatg
tgatatgagttcaaataattcaattcatgacttttcacctataaaattca
cccgagttcggaaaaaaagttggaacaaaataaaaaaaaccttatactta
gttataggatagttgtaaagggtgagttacattagacaatagcacgcaca
tagccgtgagtttattttaggataaataatttagtaggtgtcagtcacat
tagccgccgtgcattaattttattttcgtttctcatccatgtgatgtgct
tcattcaggcttttaggatggcatttgatttcagtacaactccaataagc
tatttgtcgttgatggttgatgtgtttgccataaagaaatgaggagaaaa
gattaatttaaatatacttcctactcataccgaatttgccatagtcagta
gtggtggagaatagcaacatacaccaaggttgcaataaagattggatttt
cattcactcctactaggaaccacactcttacattgaaaataatttcttca
tttacctaaattatatttggtaaactattaaaacaatcatttttgtttac
tttaggttacattttagtcatttatgttatcgtgttgtaatattttagcc
actaaaccattaattaacatgacacgtcagcttacgagtgaaagagaaga
gggggaaatgagcttgaagaaaaccattaagttggggtcaaaagaagaga
attccatttttagcacaactctttgacacatacgtaacttcacttctagc
ctgccttggtcctaacctattccaatacaaattcaggtggccttgatcat
tcaaccccatctcgttcgtttgctaacttctttttcctctttaatttgga
aaggggcaacccgattttcctgttacaatttctgggtttagtatataaaa
tttactaacttctttttcttctttaattcggaaacgggcaacccgatttt
cttgttacaatttctgggtttagtatataaaatttactaacccgcactag
atctgatcatggttgggtttaggtcaggtcgatgtaaaattttagccttg
ttttttaggcctaggttttggttcaaaaaatggacttaaaattttaccca
actccgatttagataagaaatactaaactcgagcccaactcggtccgttc
gtattgaaattttttatatttttatataaaaataatacatcaaatacact
aaaaatattaaaataaatatttttcaacacattaaaaatatattaaaaaa
gttctttatacataaataatattaagacaatgcaaaaaaaaaaaaaaaag
aggctaattcgggccaaaaatccttcccaaagccccacttgttatttacc
caaatcattccatttttcggatgagtctattatcaagtttaactactaaa
atccacatttaaatttatattttcgggtccaaatattaaatgaaattgtt
aatatatctttatgattagaagataatttctttaaaataaaattgaatat
tatctatccaacacccatccgtctaaaacaaaattataaaataacagcta
agtaactattaaaaaattataaattttaattttcttgcatttggttttat
aaaattgattaaataagttttgttaagacattgtttattttttctcaata
aaaataatatattaattgaaggattgctaacttgttacaaatttatcaag
aactcctttgtaattttatcaatgcttcaactttacttttttttttttaa
aataaccatatttatattttttttggttgatatttttaaattttttttat
atgagatgccttttctcaataccatggactaatgtatagaaaaaaagtta
aaacaaatcaataatccgtataaagtaaaatataactttcaaagttaaaa
gggataaatctcaaagttatacatgaactttgatttaatatataattgta
tacgtgaactttaatttggtacaattatacacgtaaaactctaattgtgg
ttcaaataattttgatctaattatacacattcaaataaataaatacatca
aattatttttgggtaaactacaccgacggtcacttttatttacttcaggt
tacattttagtcacttatgtttaaaatattaagttttagtcacttgcgtt
atcgtgttgtaacattttagtcactgagtcgttaattgccgttaacagtg
taacagtaagttgacgtggcacgttaaatcatcatttcaaacaaatttta
gtcacttatgtttgaaatgttatgttttagtcacttgcgttatcatgttg
taacattttagtcactgagtcgttaattgtcgttaacagtgtaacagtaa
gctgacgtggcacgttaacaaattttagattaaattatataatcggtccc
caaattttttcgttttgagaaatttaatttatttcttttatgttctttaa
actttcctctctttttttttctttccatgttcttctgtttctccctttgt
tttcctactttctccatttattttaacatatcaggaagtcgaattgactg
taaagaaagaagcaagaagtcgaaagccatcattgcctataaacaaaacc
cataaatcaatatcaagcttcttttttgactttttgttatgttaaaagaa
atggagaaagtaggaaaagagagagagaaaaaaagagaatggaaaataaa
gaaaaaaaaggaaagataaaagaacataaaagataaaaattaaattactc
aaaacgaaaaaatatggggactaattgtatagtttaacttaaatttttta
tttgaaatgatgatttaacgtgccacatcagcttaccgttgcactgttaa
cggcaattaacgacttagtggctaaaatgttacaacacaatacgtaagtg
actaaaacgtaacatttcaaacataagttactaaaatgtaacctgaggta
aacaaaaatgaccatgggtgtagcttaccctttatttttatattagataa
atagaattattcatgaatacactatataaacataatatgatgttatatca
ataattgtgttaataatatataagaatttgatcaaattaaaattttatgt
ataaaattgcacaaaatcaaagttcatgtataaagttacccattaaatca
tagttcacatttaattttaaaatttatcctgtaaaatatataatttaatt
aaaagtaaaaaatttcgatctttattcttgacaaatatatgacataaatt
ataagaccaaaaaatactaaaaacttcaacaaaactaaaaaattatgaaa
atagaattaaaacactaaatgcaaacaaaaagaaggttgtttaattggtt
taattataaaaaaaaaagtccatgaaatgtgacttttgctaaaatctcat
catcttccttctttaaacttagatttgttaggttttaatgttgtttaatg
atgagaaaatatgaaaacttacaaatcaagtacaaaatactaaatacttt
tttttttaagtatgaaaaatataaattatcatacataaatttaattcaaa
atttcaataaaacgagacatattcatgcacttctcttgagaggcccttcc
tatagaaaatttcatttccatatatatatatatatatatccaacaaataa
tgaaacatatattttataatatataaatttacaaaatgtataaaataaag
acatttacaaccctgagttcaagtcgcactaatcgcgttagttgtttaag
ttttaccccgttactataattaaaaaaataaataaagacatttacacaat
taatgtaccattttcgatatacataaaataatatcataaaaacgtattaa
atgtgctatatatacgattgccaacagctttacaaccaaaaatttccctt
aaaagttgaccttcacagaaacatctgtacttactaagggctaaactaaa
cctgctggctgctgctgctcctccccaggaagttatacactgaaacacaa
ttatccaaggcaattctgatacaaccccttaaaatattcacactagctta
ccttacctctcatataaattatcagaggcactgcattctacaacatggag
tccagatattggttatatcgtctgcggttatacgctaacaagctgccgta
agtgcgatcagcaaccccaacaaagagcgtttctgtatccgggctaaacg
atactccagctatttcaccgaaaatatcaatttcttggcaattaacatac
cccaacttcgtatcaaagatgtgaacgaaatctgcaggctcagctatggc
caggaaccgaccatccgatgtgaacttcactcctcttattgctcccattc
ttcccttcaatatagctagggacttcgacaggtttcttatgtcccacaac
ctacagctagtgtcctgattcccagttgccagaatgtgcccatcagggtg
ccaagctgaagcaaaagaatagtccaaatgcccttttaggctgttggtaa
cctgcaaaattacacaaataaattagacaaagagaattaaaatcaaaccg
caccaattatgtggcgaagactgacatactttgccagattgggcatcaac
aatcaagcactccacactatctccgagtaccgcaagcaacttcccatctg
gacttacagaggtattctagaaagagcaaacaaccatttaggggataagt
acattaaaaggatgaataataaaaagtctaaagcaggcttctgaaggctg
gcacttacatttacagaccagttgaacgagtagcggttaatactagcaaa
agtttcagcatcaaatattcggattttagcatcattatttgcagccataa
ctctcaatgcaccgctgaggatataataagctttcagttcattgccagtc
aaaatatcatcaaatcgtccaaaatgccaaagagaaacagtattcctcac
ctaggattattaaacacatccacagcattggtgattgcattatcatcagt
agtcaattttgtgcaaaatgctgcccctgattgatttaagtactgaccca
acagaagaattaaacgaaacacatgagccatattgcagaatagaatatca
atagatccatcaatctaaccacataccttgcaaataagctctccttgaaa
accacctgctaccattaaattttctttaactaccatagtgctaatctgca
ctctagagagttgctgagatagcagtccaggatgcttctacaaacatatc
aacaaaaaggattttaacttgcaggccctttgaacaaagttaacagctga
agtcaaattaatcatgttcatcctcactaaccaggttgggaacaattggt
ttagccacattcagtacttcttcgcctttgtgaagcagtgatgaccaatg
cattactgagtaattttccatgaggtagacatcgtgctttgatgtagccc
acaatagatttctcagctacacaaggggaaaaatatttatttgaaaatag
ttactagtaaaatatatgttaggtcatatttacagttcaatagataaacc
tataaatgcactcgataatttttttctgggagacaagttcaattgattta
tatccaaaatataaatgcctgtgttaaaactgttaacatgatccttggtt
gaccttacacatccaagtacacattcaggccaccctcttctctcaaaatg
tgcattatggaaataaacaacgaagatagaaaaaaaatcaagatgatggg
taatgcatgaaaaacatgccacacaaaacaaaaatgacaaaagaaataga
aattatgtgaatgtaaaaggacacggtgttatgattaatggttatgatta
tcacaagttaaccctggtgatacaaagcaccattaacattgtacttggat
aacatgacaaagcaacacaaatgcatatagaagggaaaatgcattcatat
taagggtctgtttgattgacggaattgattttccggaaaatcatttccaa
cttttccaatgtttgattggcggaaaacattttccatttggaaaatgaac
tctaaaacaagggaaaataggttacattttagggaaaatgtcttaccctt
tcaatttccgtaagacattttccgtgctctcctctctatcgcctcattca
ttccttccttcatttccggtagaaaactgcttctgtttatcgattttcca
gtaacttgtttttttaattattcaatacttatttttttaacacaattaca
aataatttatttgatattagcttttttcaatttataacgattaatattgt
agcttaataattgagtattattataaataaatcattgcaatatatgtaaa
aataatttaaaatataaaaatttattaatatatattaatatatgtaaaaa
caacttttccgaaaaatattttcaaaaaatctgccaagcagcagaaaata
ttttacacagattcaatcaaacaccggaaaatattttccagtaaatcatt
ttacagaaaagtaaaacattttccagaaatcattttacggaaaatatttt
actggcaatcaaacagaccctaagtggctaatgcatcaaaactttgccat
ggaaaaggtgaaagaaattgtgacaacttatgtactgactacttgccata
aaattacgaatggactagctagggcccatcctttctagcttatataacaa
agtactacctagcatctcctgaagaacctaaaagaggtcatttaaatgca
cccatcactccatacctctgctaaaaaggaaaagcataaaaccaacaatg
aaaaactacaccaccaatgcatatatatctacacagctccaataaacaca
tcccagcaactgaggctcaaaaggcaatgggcaaggataaatacacaact
cattcacagcaaagaaacagaattaagcacaaggaaaacattcctatact
tgattactggatgaatatgcaaagataaataggagaaaaaaactcatgac
atcaaagagatcatcgaaaagaacaatattggacaataaatcaagtaaca
caaactggatagtcatgcagatgatatattgtaagtgaatcaagtaatga
aattgaatcacaaatgcaaatggtccctcaaaagcagcaagaaagtgaca
cagttctgataaccattaacagatctaataatttaatgacaatccagcaa
gatgaaatgcaattaagtattaattgccattcagatgagggaaatatcgc
tctactcaaattgcaggaatcactacagaggcctcttaaatgcttcctat
cgtaccatataaacaacgcatctttatcgcgccagcttcttagaaattac
tcccaacctgctttaaaggctgaaataagagagaaatagcattcctaaat
gccacaggttaaattcatataattaacatgcaacataatgtatatctaat
tctcaaattacaaacaatgaaaaataaaccagatttaatgcgaagttaag
atcataatctcaagaaatgctagatactttaatttaaagaaaagcgaaag
gcaaaatcaaaacctagattcttagaaagtatgatgtatttgtcttatca
ccttgttcagatggtgtagccaaatgtaaacctagggcaactctataccc
atggctcatctagtgtcacaaaagactacttctcagtggtagtatcacga
gcttcacagttggtgtatactgaagcagtgatgtgtgcaagcatatgcag
gagtgagctgtggcaacatgaggttgaactattcgtagtgtatgaatcag
tgcatgtttgtgaacaactacaaatgcaaaagttacaactacaaattgta
aataaaattttcaaaaaccccacgtcataccacagccaggaagcatcaat
atccatgatcaggatggtacctccgcaaatatttctttttaacattttta
cagtttgtataacagttaaaaatgtgcaagtataaagtaaagcgtccttc
acaaatctgcacaaaaaggattaacgtgaataaccaccccatcttgatcg
ctcagatgggatatataaaatattcaaaactaaaactaataaaagaagaa
gaaaacgtttccaaattcttttttaggtcaaattggaattaaaatacatc
acttaccctaactaaaactcgagaactatgagtagtgatatgcggatagt
tgaagttcaaaccatttgcaaaggataactacatgaattaccgagaccaa
agatacgaagatgaagaaatatatggagcattcatggtggcaaacagctc
taaatcaacacgcaatttaaaagtcaaaaactttcaagacataacaactc
tactacttgcaacattttagaagaccaaaggtctgcttgaatactactca
aaagattaaagaatggaagcgacaacacaaggaaacgcaatgcgtgtgcc
tcaaaacgggaacggaattgcaaacaaatagttggctagttagtagtaaa
acccgaagataattgagcaaattctctacctgaaagtgaacaattgtcga
tttgacaagccttgtgttaaactgaaagtcataaaaggcctttcccttct
ctacttgcaagcattcctgtcaacaaaatatgtatatttaataattccgc
ccaaaatttttggaaacgagcccaatcccttgagacacggccggagataa
attaacagctttttcgatcatatttcatgtcgaacttagagatagttaca
aaaactgtttagatttggcaagaaatacagaaaccaaccttttccatctc
ttcacgagaaccatagaggttctcgtagttcttgtactctcttactctcg
tctggcggtacctttctctagtgaaattaagcctctcccaaggaattcct
tgtatatcttttccatttcttgcttcctcagctgatgtgtcagtttttgg
cttactctgtttccaaaataaccacagaaaatgtattttcagaaaagtta
tttacagattctagaatctaaatcgtgataatcaggcataatttgaaaga
ttctttttaaaaaccattactgattcaatatcgtcttcaaagtcggagtc
aaaggattcaagtccagcggcgtctctctgaggctcgggttcgactacgg
caccgtcgttattgaaatcattgacgtcgtagtagtcatcgacaacgtac
tgaagatcgtcgtcttcaaatcgttccattatactgcagctaagaaacag
gttaaacaaaattttgatcaagaaaaacatagccttaaaccccctatcac
cctccgtcatagaaaaaaatctcaaatgacgaatttgaggagaatttcac
agaactttgttctttgaacctttgaaaagaaagaagggagagagggagaa
ttaattaagttgaaattggagagaaaataatatgaaaacaacaggagaga
aaggaacacaaagaatcaatgcaaataaacactcctcgaagacggtgata
gtctattgttcaaaaatataagaaaatttgaaactaaaaaaaattagagt
gaagaacgaataattataccttgaaatagatatagacaggaagaagtcac
gaattcaaagagctgtaaaaggaaaatgaaggggaagaacaaagaaacac
aaataaatggagcagaaaaaaagggtttcccgggaaacaaacagtgaaac
tgaaacagaaagagaaaccgtaaacagtccaacgacagagagtagagtta
gagagtctaaaacaggttcgtcaaactgaagattaaacaaagaacaatag
agagagagggagaggaaaacggaagatgaaggatataagatattcagagg
caatggcgataagagcagtggagtttgtcccggaaggggtacttatagtg
gaagaaggcggaggatagggatgagtgcggactgggggggcccaaacggt
gaaataccagaaaggcaagcaattaaagaatggaatccaatgttactttg
tggggtccagtctcgaccgcccaattataaccggcgatatttgccaggct
tggcggttagagatcttggggataatttctattttagcggtaactatgag
tatgagacaattggattaagctgtaattaacttgaatttagggggttggt
tttcttagccgctttgtgtacatttttttaggctcgctcagcccaatgtt
cagttttggattagaatttggtttcttgacacgtggtggttgattttttt
tagtttattttcttcaaattttaaatatttaatttaaaattagtttaaat
tagactagaattcttatcagctgcctatcttcgtggaaattataaattta
gaatataaaatatatggttaaattataatttttaaatatttaatttaaaa
ttagtttaaactagttttgatatacttcttatggtaatctcgccaatttt
cgttggtcttcccttgtagatccagcttgtgcagtgcttccatatttcgt
aataacgatgaaattttttgcctccacccgaattgccgcatcactcgatc
agattcgtgtatctccaccattgcgtacactatcaataacacatttgtgt
cccacatacttcgaatgaccaaaaattccgacgggactcattttatgata
tctgaattgacgtatggcatccattcaaactacagtaacacccatgactg
tagtaggatcaggcaaccattgattgacatctcatctgattttgttgtct
gacacaactcttgatacaatgtggccaacaaggctggtccctaactcagt
catccaaattatttgaagtcaactaggtgtagtagtcactttatgtgtac
caaatttcgagatttgtcgggcattagaatgcccccgattaacctaagga
tgaatgttcgggtgtattattctttgacgacattgggcgtgtttagagga
agttctttgaaattaaatagtttccaaccatttcatatctattcggtcac
cttgaaacttgttcagcacatcccccaaaaatgccttgcaaaggtcctct
ttactggtacgacagttgaccccgtaacgactggcccatccaccggtaaa
tcgagttgtgaagctgtaatgacctaaattcaaggttatttgaacaatgg
tttcgtagccacaaatacgatttaaagataaatttattttaatatttttg
catgaatattgatatgataggaaaatcgtataaaaatatagatagaagaa
ttttaccgatttagtggttagttagaaaaagaaattattgaagaaattgg
gtaaaaataaggtatcgagacctcgatctcgtaaaaccgagtcggaaata
tttttataaatatttatgaagtgttagtaatatggtattaaaatttcgtt
agaaaattttaatgtttgggtagtcaattaagtgaaaaggaaattgaaaa
aggtgtaaaagttactagaaggagtaaatagctcaattgttaaatgagga
gggacataaattgaaaataagcccaaaaagagatattttgggctgcataa
gctgagaaaaatcaggagagttggtgaaataagggtaaaatggggaaaca
acaaattttactaacataaaaatgggaccaaattgaaatatctagaattc
tctttatttttctgcattctcatcaaccaaaaacgtcctaagggtttatt
caagctggtttttcatattttttgcaccaagtgagttaatccttgccttt
ttcttgtaatttttgtgtttctaagacttttacaactaggtcctgttact
aaattcattagtttttgattttatgaatgaagttgaaagttgctatgaat
atatgctggacttttatgatgaaatagcatgaaattgaagctttaatttg
tttatgagatgattttattaggtaatttcaatagaaattgatttgtagga
cctaattgtgaaaaggtttggaattaaagtctagtgctaaaattctgatt
tccaaaggttataaagtagtttaaagtgatgggataaagtgttaattgag
gaaaatcagctcaattgagaggttaattgagcagggatgaaattatcatt
tattgaaagcttaaggaaaaatggtaattaacatcatgcactaaagcagt
tttggacagtagcagtagtctaattttgaaaaatcaccaaaaattgtaga
gattgaattagaggatgaataaaatatgaaattaaagcttattgagtata
gtttcttataaaagaaacgatgtaagcaatggaattgtaaatcatgagat
ataatagattttgtgagacaaggtcagaatgaattcgagttcccctattc
taactttggaaaatcatcaaaaattggagaaaaataattaagagcttaaa
tttatatgtttaaaatccttaatgagcctattttcaaaagaaacaagcga
gaacatcatccgaattctgtacaataagataattaatttttagtgaaaag
gggtcggaactgtcgaacagtgaaataggggagctttaaagaataaactg
tacttattggctaaaccaaaaattctaaaaattttatggtaagaagatat
gtgagtctagtttcggaggaaaattagtggatcttaatttggagttccgt
agctcaagatataaataatttagtgactatgactcaatgagacaactttg
aatgcactataaataataatggaattgtagagaatgttacatatgaacct
gaaatgtattagattaatgattaaatttatttatttagatccaaaaaatt
caaatatgaagctagatcgaggaaaagaaaaagttcgggattagtagatt
tttatttacgaacaagtatcgaggtaagttcgtgtaacttgaattatatt
cttaaatgccagaaatgtttgttattgatgtgaatatgatttgaatgttc
atcgtatgaaaattgatgaaaaattgatatatttgataaaaaggggaaga
aatcccggttgaatggaaggaaaattcgatggatctctgaaaagaaattg
acggtaaaaaggatctagcccggacgggtgatcctatcttgatatagccc
tcccgaagaatatgtggaaaatagatttagcccggatgggtaatccgaat
tagggtctgaatttagcctggactaataattcagatccaagctcattaga
gtaattgtcattgcaggggatttagcctggactggtaatcccgacaatac
tctatgagtttatatttcaagggatttagcctggactggtaatcccgctg
taaggatgaggttcgcgagagtgtgctctctgaaatggaaatgtgcgcac
atgaatatgaattgacggacccagatctgtacactaaagtgtacccctaa
aaatccatcgaaattccaagtagttcaacgggataatatggaaaaataac
gagggaatggaaatcatggtattgatgagctcatcaatcatggtatatat
attattgatacatggaaattattgaactaacttgaatgttgagtttgtgc
atgttaagggaataatgcattgaatggatgtatgaatgtttattgcattg
tattgaaaatattaggtaagtataattcttgttacatgagcttactaagc
acaaagtgcttaccctgtttccttttcccctgctttgtagtgttaagagc
tcggaggtcgagtttagtcagagacgcatcacactatcaacctcaagatc
tcggtatataaagaaactttattttaaaaatcaatggcatgtataagcta
gtaaagtaaatgttaatgtgaaatgaatgtatggttagccattggtatgg
ctaacaaattttggttttggtatgtgatgagattatcttatgaatacgtt
aaatctatcttgaaaatatgttgaaatggattggttgtgtcggattggtc
tcggtttaaaattgtagggaagattagatacttataaaggggttatattg
agttcaaaaaaaaaaattcagattttgcgaaaaatttatttggtaaaatc
tggtaatgcctcataccccattttggcgacgaatacgggtagggggtatt
acagaagctacgccatcgagtgtgattgtacactattcgtatggaagatg
gaacgtgtgtgtctcgggtctccatctttccaccaacgtgctgatgagtg
taggattcaatttgcagcccctaagcatacgagacgtatatcagaatcct
gcgtcttgcaaataaccatgaatttcggtgtttgggctctttgacaaatt
atgtatgacccctccgaaacacaataatatgcctatttatatagacaaaa
taaattaatttaaaagttaaaaagctttaaattatacttaatttaaaata
acgaaatttaaaatttcgtcttaccattatcgcttgagcggcgaaattgt
gtttgtcgtcgaaacgaatcagagagcttgtctgcgtgaaaatttaatcg
aaatgaatatgcaaaataattaaataaaactatagtgtttttaaatagag
tgtatttcgaacaaaatttgagaaaattgagagtttagagagaattgaga
gagttggattccagtggaaagaatgaaaaatggcttgatatttataggtt
aaaaaatattaccattggcctttttaaataactttatcgttgccaacatt
taaaaagttatgggaaaatgtttaatttactttgggatattcagatcccc
acaaaagttaagattcatctttagcgtcttcttcagagttatgtacctca
tttcaagaatttggagaagcggggattacggtctgactcggtgtgtcctt
tgtgcaaggcggagccggaggattcccatcatctattatggtattgtagc
acgttatggcagctctggttctatttgaaactccctatgggttttggtga
tttctcatccgatggaacaacaaattttgtaaaggcttttctagcaatga
atatgaattctagacaactcagtgctatttctttgtgggcactttggtat
aaaagaaataagcttgtttatgaggatttaaaatttgagctctttgaagt
agtgggttttatccagggctactttcaagaatttaatcgggccaaagcta
gagaattgaccgccggtataaaaagggatgttgcttggagacctccgcaa
tctggaattataaagttgaattttgatgcttctttcctgagtatttcaaa
ttgttctatttcagctgtgttagccagggattctgaaggtttaattatgg
gtgcatgtacgtactcggtggtggacattgcagatgcgtttgtggctgag
gcgagagctggtgaacgggctcttctttttgctctggatatgggttttcg
gaaagtgatattggagggcgattcactaactgttattaagaagttaatct
cacatagcattgatagatctgttcttagtccgatttctcagaatattcga
ggtttggcagaagcttttgaagaggtcacttacaatttcattcctagagc
agcaaatagagcggtgcatgagttggcgatggttggccggaaccagaatt
taccttgtttttgggttgaagaagcacctgcaaaagttattgaattagcg
gagttggatcgacatgagtggtttcgtcgggactgattttggactgggct
ttgatgttaggagaaggttcttggaatctcctaggttgttttcaaagcta
ttggttttccgatctcgggtatttttgttgttgttgctatcggaagtttg
ctggtattctgttggttttgttttgagtctggttttgctgttggttttat
tttgatgatctgtcttctttactgttgatggtttgttttccttggaataa
tgaatgccagttttttattacaaaaaaaaaagttatgggaaaaaatgaca
gttggagggaaacacacctaattaaacgcgctttgatattctctctaaaa
aaacaacgtatttctttatatatttaaaaaaaaagtcctaaaaattaacg
atatgtaaatctaatttaggccagttgtataataccataaagcaatgttg
agttatgaaattaaggtatattaggttgcatatataagtttataggattt
atttattaaaatgtatttaaaaattgtaatgcttgaggaaaatattattt
ttaaaacttgaatcaacatcgtcgtaatcatttatttgagcattattcta
aactttttttatatgcattgtaattatgtaaaataattataaataataat
tatatcataaataaactagtttgtaaaacaataaaaataaattaaagtgc
agaacttgtagaaattaaaacattaaataataagcacctaattataaaaa
tcaaaattgaacttagatattaaatcaaataaattaacatttcaaattag
agattaaattgaatgaaatgaaaaatgtgtaagggtcaaacacaagatta
aaccaaattagagttaaatttaatattttcaaaatctccacgtaaaaaac
gttcttaaaaatgtgcagagcatgagattagcttctgctgatgggttgct
acggaatgttgtgggcgagtagattcataggtttacggtgctgattggtg
ttacatatagttgccggtggaattatgcggtgtcacagaaggtttgcaat
gaaccaagagtttggagatcattcaactaattgtagagttgaacatgttt
tgggtggtgaatatattgtctcgatcttttgagggtagttacattttaag
tattttagtgaaagattatttagtcttgatacgggagggttaggtgttac
acatccgtcacattttctgggaagggaatcggtatgttgatcacctggcc
aacttagtttaggaggaaactattgtgcggttaaattattatagttgaga
ttcagggatcaacttgcaaggtcactatacaattagggatcaaaaattgt
aaatatctcatgttaaatttcaatcccgctttcagtgccttaaatctttt
atttccagtgccaacatatatttgtctagtttgtcactaagttgttgccc
ttctagcaagaggattcttaagagtgtggtaaaatatgcctgcaatttat
tttttttaagtataatgaattatttgattctctaattttataaaaaaaaa
tcattttagttattcataattttacacttttttttagtttttagtaaccc
aaaatagataaaaaaaaatatactgttattaattttgatgacataagata
ttccaaagcggaattattaatattaaaacctactaccaaacaagcgatta
tacctcgatcatctacaccttctaagaacatacctttcgagaaatccagt
ggagatgaccctgcatctgttacaacaccacctgcttcctggatgataat
aaaaagctgcatcttctcattgtttcccggttcttgcaaacttcataaat
atttcggcttcccatcgagctatggccacatatttcaccatgctctacac
acgcagcggttgcttcctgcatagacaaaacagataatcatagttaggac
aggttgtattaaaaatattagtgttacagaaatatcaaatagtaataatt
tcaaagtatttgattgggttctcgtttccaaaaaccttttggtaatggcc
ttatttaattattacaccactttatcatcagaaagcatgcatgagccatg
gagttagtagggttggctcgttagttgtgacaaatggaaagatattaaag
tggggttacatgttacatgattgattgagtgcttgtgattctgcatgttc
ttctcttagttttcaagggccattatcatcaattactaatttttgatata
tatatataattgctttcttctttctggctaaccaaactacgaaattaata
gcttttgatgttttctggtgaccaaactacaaaggctggtctccttgatg
cggacaattccaaaatgtaccttgttaattttactgcatgatagtccata
aaatcaagaaaatacagtcaacccatttcttaaaattgacttttgaacta
actgcaacagcaagagagaaaacctattcagcccagcagcgaccttacta
ctggtcctacagttctttcctcttgattagcttgcaaatttatactttac
tcctaagaaaactgattgttgctttatgtgcaacccattcaagtgaaatt
tcgttttctctgcaattcttggttcttcagctacaaaaataatcaggaac
catttctcacgagtcaataaactttggaagaataaatgattgtcaggtac
atgttgcgcataaaccagaatcccatgcgtcatttatcgactcggaaaat
gaagctgctgaacctctctctacttattcacttgtgttcactgctgctcg
tctcaactcagcccaccaatcagcctccattctcctgcgactcaactgac
ccactaaccaaatcctacaaattttgcaaaactacactccccatcaaccg
aagagttgaagacctcgtctccaggctgacgttagatgagaaaatatctc
aactcgttaacacagctgccgccattccacgactcggtatccctggctat
gagtggtggtctgaagccttgcatggggtggccttcgtggccaacataag
ccaaggtatccgcttcaatgggacaattcgatctgccaccagtttccctc
aagtcatcctcactgctgcttcatttgatccctatctatggtaccgcatt
ggccaggcaagtcctataactttgtattcatctgtctgctttaatgtcaa
ctccaaaagtattcaaagagaaagagttagataatatatgtttttaataa
gaaaactagtttaattagaagtcaaactcgatttagatattctatcattt
tcattgtgtgcttacgaacaggcaattggaatagaagctagaggagtgta
taacgctggacaagcaagaggcatgaccttttggacaccaaatattaata
tattcagggacccaaggtggggaagaggccaagaaacacctggcgaggat
ccattggttacagggaagtacgcagtctcatttgtgagaggaatacaagg
ggactctttcgaaggcggtaagcttggtgagagtctccaagtttcagctt
gttgtaagcatttcacagcttatgatttggataactggaaaggaattaac
cggttcgtctttgatgcaaatgtaagtgcattatcattatcattagtatt
gtttgtttgtgtttaaactaacttgatggatttcattcaggtgttatgtg
ctttatcaattgaccaatattgatgttgatgttccaccttttcttgtttt
tgtttctggattttgtgtaggtcacgctacaggatttagcagatacatat
cagcctcctttccagagttgcatagagaaagggaaagccagtggggtaat
gtgtgcttacaatcgtattaatggagttccaaactgtgcagattacaatc
tcttgtcaaaaacagcccgaggacagtggggtttcaatgggtaagaaaat
ggaataagattgataacaaggtctttttccttttagaaactacaacaacc
ataatacagaaaactattcaaaggtcattcagaagatgattctttgtttg
gttcaaaaactattcaggtacatcacctcagactgtgatgctgtctcaat
catatatgatgaacaaggatatgttaaagaaccagaggacgctgttgccg
atgttcttacagccggtaattatagttggcattttgtttctggttgatca
actctgtattctaaacttgttctaggttactccagctatgattctagttt
aagaatgctgataagatcagttaaggtttttatcgatacatttgatcagg
aatggacttggactgtggtgaatatttgaagaactacaccggatcagcta
tcgaaaagaaaaaagtagctgtgtctgatatagatagagcactccacaac
cttttctcaatcaggatgaggttgggacttttcaatggcaacccggctaa
acagccttttggaaacatcggttctgaccaggtctgctcccaagaacacc
tgaaccttgctctcgaggctgctcgcaatggcattgtccttctgaaaaac
gataacagactccttccacttgcaaaaactgaaattacttcccttgctgt
gataggtcctaatgccaattctagcgaaacacttgttggaaattatgcag
gtcctccttgtaatcctgttacaccattgcaaggattgcaaagctatgtc
aagaacatcaactaccatccaggttgtagtacggttaactgttcgtctga
tttggctgatgaagcaatgaagatagttaaagggacagaccaggtggtgt
tagtaatgggattggatcaaactcaggagagggaagctcatgatcgtgtc
gacttggttcttcctggacatcaacagaaactcgttacccgcatcgcaag
cgctgcaaataagcctgtcattcttgtgcttctttgtggaggtccagtag
acataacatttgccaagaatgatcagaacattggaagcattatatgggct
ggctatcccggtgaagctggaggacgtgcattagccgaaattatatttgg
tgatcataatccaggtgaagtttccgttaccaaatttgtatgaataaaat
tatattccttggttttgcaggataactggaaatgcaatcataatttgtat
acaggagggagattaccaattacatggtatccacaaaatttgactaaaat
accgatgacagacatgagaatgcggcctgaaccatcttcaggttatcctg
gacgtacttacagattctaccaagggctgaaggtattcgaattcggctac
ggtctcagctacaccaattattcctatgaatttctccctcttacaaaaga
taaggtctacttaaacaatcaatcaagtgataaaatagctctgggataca
agtcggtttcagagatgggaactgaactttgtgaaaagagcaagctccca
gtcacagtaagggttcaaaacaacggtgagatggatggtaagcatgcagt
gctgctctttgtgaggcaagcaaagactggtaatgaaaggccaataaaac
aattggtgggattcaacaatgttgatctaaaggcaggggaaaaagctgaa
atcaaattggagttgagcccttgtgagcatcttagcagtgcggagggaga
tggtcaaatggtggtagatgaaggatcttatttcttgagcattggagaca
aagaatcagagattacagtggttttctcggaagacactagcgatgctgcc
acatcaaagctcatgatccttccaagaatcctgatattcttttacatcta
ttcattcattcattcattcattcctatgcatattgttctgaaatgaatta
atggacggaccctctcaactttttacatgtaaaattctactgattgctca
gttgcctgtttttacaaaattattaagccaattttttttgttggtcataa
acaaaacaaagttcacaaaaacgaagctctcaaaacattcgtggagttta
aaaaataacacaaacttggatgtttccatttgataactcttttcattgag
tgttatggccttacacacttgggtgccaatctaggaaattacgggtgaag
ttgatcagctgcgaatagctacaaatacaagtttgtcgtaaaatcataat
aggctctatcttgcaaattgaagctggcatcttccttttttcttttctaa
tatcatgtttatttgtttttacttatagttgatgtgggtttgtttctcaa
cttgaaaactactttaatagtagtgtcaatgtgaattcggattcggtact
tgttatatttctatgaacctacgtacttacatcaaactctcctaacaaac
aataacgtataccacactgctttttattcgagacactgcaatttggattt
aacaattcaacttgatttgtagatttgaaaagtaaaagtactaaattccc
taaaataaaagcaggtgggctaaattctaaatttacgaagaatttaagga
cttagaacacattttaatctaatatataaataaataccacaaatcttaac
acattcgtctgcatgtgaaaatcacgtattaagaacacaaaggtgtgttt
aaaaataatatacaataaataatgaaaagtatgatttggaactaattaat
agtaacacatgaaatatgtatgatattaaaatacaaaaatataagattaa
attgtgagtaaaacaaaatttaaactaaaaagcacgacatattaagaata
ttaaatgaatacaattgattatcattgtttcatcattaatctttgagttg
gtgttgagctcatttgtgacactaactcaatcaacaacattattaacatt
cacaaaaaaaaaaaaaagagaacacagatatacttattcaagtttcatat
aaaaattaaattttattttagtttaaatggtaaatggaaaagttttatat
gcacggtattttttgtttaaatctcattgtagaaattttttattgacttt
taaaaatatataaagatgaaaatattcacataattatataacttactttg
taaataaaatgaattttttggtaattctctaactgagttgggatccagtt
aatggttgggtgacacaaactcaatgtgccatgtcaaatgcatttcatat
gttttgatgtaacaaataaaaatgcctttgaataaaagttgaagttgaac
aaaattgacaaaattatatttcaaatgagcctaagagatataattctgaa
cctactactttaaaatcttagaaaaaaaatttgaatcaacttttaatcaa
gttaaaatagtttcaatcgatcgagttatactttttcaatcaaagttaaa
attttttaaaacaagtcagtatagctccaagccaaaaagtatcgatactt
gttaaccaagtattgatagtttctaaaatatcggtacccctccgaaaatt
gataccaatttgacattttgtttctcaaatatttcagctaaatatcgatc
cagtatatcgatatttctggctccaacaatcacagaattttgcattaaat
tctaaaaatatcgataacttgttagcaagtatcggtactcgtgtttgcaa
gtgaattaaatgcactaattatttcatctccgacagctctatttaattct
ccaacaaccacaacggttggaaatcaattaaggggaataaatatcatttt
tcaaaaatcctacaacaacaaaagagattattaaagcttaaagatcaatc
aaaacaaacttttgctttcaattctcaacaatttcctttatacacacttg
taagttggtgtttttcttgcatttgtgctcaatttataaatattatgctc
ttttaagggtttgttcttagtttgcttatttgttattctctttgagaatg
ttttgtcttaatgtttgggtagaaatcttaagggagtttgtaaggttaaa
ccttatcctcaaaagttgtcaaattagtaaaattggagaaatctttagtt
aaggaaagctaaggtagtcgagtaggcaattagggccgaaccactacata
tcgccgtatttattgtctttatctattttcttagcatccacaacttttta
aaagaccagttcaccccctcttgacaatttcgagttgattaatcgagtta
acaaaaattaactaatattttcaaatatatatatctaacataacatatat
attaaaaatatatttttattagacttaaatactcatttaaccttgaaaat
catataacaattttttttattctaacatttaatcttaacaaaaaaaaaat
tctaacttcaaaatactattagcttcattatactggctttttattttcca
ggtttgatttttatgaaatctggatttgatatgtttttcccaatatcttc
ttcatgcttctttactagtccacacatctcccatcttctcccttccaccc
ccaactcagacgtccaacactactcctctcgccttcaaccgctcgttcac
actctctataacacaaaaacaaaaagtttatcaaatgacgcgtcacacag
aatcatatacttagtcaaaaaaagcactttacttatttatattatcttta
ttttaccaataacacattaaatagtagccatatatggagacttcgtcggg
cgggttattacactctcaagctccacctccaagcttcttgcacaacccac
caaagccatagttgattgaagagacaaaaggaaatgtttagggtttctcc
gatcaaataaaatcaaagagaaaaaatagtaaagataaaagattgtagtg
actttggtgattaattttaaatactcaacttgatttagtgatgaagagaa
agaagatttgagcttacttgaaagaaaaatatttctttgaatttttttat
gaaaggtgaattcattaattcattcaataaatgaaaccatacaacttaga
gaggaaaaaaaatagcaaacactcgtcgtaaatgatgaatgacaagctct
atcaacataatataaaagctttagcctcaacatcaatagaacattatgac
acgttgacaattggttttgtcacaactcaagcacgatatatctggagtga
ttgcaagcacttaatactataatgaaataagcccggatggtccaaagcgg
cgagcaaaaatcgacaaaagaattgagtattcaccaaactagagaggacg
acaacaaaatcatctgtaaaatcacttgtaaaactaaaattacatgcata
agcaagactaaaaaacgtgctacaagagtagacaaaaaacttctaaaact
gaagacttattaaagaatggaaaaacaaacaaaaaaacatataaaattta
agacaacatgggttcaaatcggtacgtgaaatcatttattattttaaaat
actctcaaaccaaaaacaaattaagaagttgacgaagagccactcacttt
ctaagaaaaattactgatggtcagtagagttttagcgaacaataggaact
gtcatctgtccatcacaacttgtgaagacaacaaagatacctacaaaata
gatctgcaaactgaaaagagagaagacatgtatattgaatgagaagaaga
aagaaataaatggttgatggaagaggaaaaaggcgtgtgataactagcct
ggaggcggcttggagtatttctttgaattttgagtattttatatttattt
tactactttattattgtatggatggtatgagattgaattatagaatgaaa
ataaaattgatttggatgtaaacattgtacagacccatttgcccgggccc
aacaaaataaatagaagcccaaacccaaacaaaacaaaataacaattaca
gcaaacccaattacggaaacaaagcccgatggcccaaaaccttaaaaatt
tttggaatggccagaacccctagggtttcggcgcccctcgcgccgctgct
accccatgtgcgccttcagcgcgcaccacgcccgaagtctgccacctcca
gccggcctttcaccaaaacggcaagttgaccttaccatgtacctgcaaat
agaatgaaaaagagaacaaaagtggaagagcaatagggataatggcagaa
acgaaagtaaaagaataggagaaaagtagcaatgtaatcggctataagag
ctgaatcaaacaaatgtaaatgggggcaacttttgtatcaaaaaacagat
tcaatcgaaataaaaaacagattcaaggtttttttttctttttttagttt
tgaagtattttttatttttattttgttctcctttcttttcgtttacatct
atataaataaatataaaaaaagagggtacctttcttacctacgccacgtc
ggaaggagggaaggcgaggggttttggctcgttttcgggtctttggcttc
cctttttacgagtttcggctccatatccgtggcctagaagcaatggggta
caaaaagggaccaaaaaggtccgattttgagcctccggccaccacacaca
gtggcgctacggcggaggctcgctggattctcaggtcggatttgtggcca
gagagagcatctctctctccctctttccctgtttttttttgtaaaatgaa
gaaactgattgtttttgcccttttttatttttatactaaacataaaacgg
cgtcattttgattttggggttcagaggccaaaacggcgtcgttttggtct
ctgacccgcgcggtgacccgaccctgggggaggatccgcgtgtttttgcc
tcttgggttatttgcgtaattggtcccaccaaatttgtgatgctttcaag
gaggtttttcgcatattttacaattttcgcgtctatttcgatttggtccc
tcgaccatgtgcgtgcatttcactggaacggcgacatttggtcagcatgg
gaatatttctgtcttggtcccccctctttcagcgcgcgtcacgatttagt
ccttttcgtcttttttattttgaattcgcccagtatttttgtttttattt
cgatttagtccctttttcagtaattttattattattattattattatttc
tattattattatttattatattattgttacttatcatattattattatca
ttacataatagcttatatacatatatgtaccttttatagtctttatatac
acccatgtacatatacatattttttatattttataacttaaaactatttc
catgcatatgtatattcatttttttaaatactaaatacatacgcatatat
atatatatatatattatattataaaacttaaaagctt
back to top