AC197187

Germplasm
Stock NameType
Acala Maxxacultivar
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Sequences
The following sequences are available for this feature:

region sequence

>AC197187.1 ID=AC197187.1|Name=AC197187|organism=Gossypium hirsutum|type=region|length=89260bp
ggtaacgtagaggattcgtcacaccctgtgcactcacaatgtaaccaaga
aatgtaagtctgtaggaaaaaacagacatttctctacgttaccatacaat
ctttcttttctcaaagtctgcaatacagctctcagatgttctacgtgatc
ctgcaaagtcttgctataaactaaaatgtcatcaaagtacacaacacaaa
actttccaataaaagatcgcagaacatgattcattagtcgcataaaagta
ctaggtgcattacttaaaccaaaaggcatcactaaccattcatacaaacc
tagctttgttttgaaggctgtcttccattcgtcgccttctcgcatgcgaa
tctgatgatatccactcttcaagtcaattttggagaagatgacggctccg
caaagctcgtccaacatgtcatcaagtctaggaataggatgacgatactt
aattgtaatttgattcacagctctacaatctacgcacatcctccaagacc
catctttcttcggtactaacaacaccggaacagcacatggactcagactt
tctcgaatataacccttgtctatcaattctgcaacttgcctttgaagctc
tttcgtctcttcagggttagtacgataagctagtcgatttggaatggtag
cacctggaatgaaatcaatctggtgctcaatgccacgaagaggtggtaat
cccttcggtgtttctttcggaaacacatcctcaaactcttgcaaaaggga
cacaatcgatgcaggcaaatcaacagggaactcagccaataaacaatgat
ctttaaatattaaaataaacaaggattggtgagaggaaagacatttcctg
atttctcgactgcttgcatatacgctcatctttttcttctcctttgcaac
ttccttactctttttcaagcttgtttgatcttcaattacttgactcggtg
tcaaaggagccaaagtaatcttcttacctgcatgcataaaagagtatcga
tttgtaaaaccatcatgcattgccctcttgtcatactgccaagggcgccc
caaaagaaggtgagtagcatccatcgacacagcatcacaaaggacctcgt
ccttgtagtttccaattgaaaacggtacaaccacttgtttcgtcacttta
agttctccaccgtcattcaaccactgcaacttgtatggattcggatgttt
tgtcgtcttaagacctaatctgtcaaccatcactgaactagcaacattag
tacaactaccgctatcaataatcacaacacataccttatcttgaaccttg
catcgtgtgtgaaagatagtctcacgttgttgctcgtcttgcacctgttg
cacattcaaactacgtttgacaaccatgatctccataacttgaccagatt
cagcaacttctaggtcattctcttcatcttctttagtcgggagttcatgt
acatcttcctcagaatctgactcgatctctccatcttctcgcatcaacat
aaccctccgattaggacactggctagcaacatgtcctctaccaaggcact
taaagcactgaatatttcttgatcgttctgatgccaccattggttgtttg
ccacgtccattatcagcaatgggaggctttggtttgctggattcgcttgg
ctctcgaatccgtaatggcggttgtggtgcttgtttcctggcattgttag
gggtgtataaaggattcgaaaaagatttaaatggagtattacctcgagta
gaagcttttctacgttgttgtcgctcaattttgatcgccatatgcaccat
gtcatccaactcaacataatgttgcatttcaacaatgtttgctatttcag
aatttaaacctgccaaaaaccgagccatagtcgcctcacggtcctcaact
atgtttgcacgcatcatggacatctccatctccttgaaatagtcctcaac
gctcctgttgccctgtttcaaggtttgtaatttctgaaataaatctcgat
gatagtgagaaggaacaaatcgtctccgcatgatacgcttcatatcttcc
catgttctcactagaccttcacttgtacgtcgtcgactaatcagtaattg
gtcccaccataccagtgcatagtcaacaaactccatagctgctagtcaaa
cttttttctgttctgagtagttataacactcaaaaacgtgttcaaccttg
ctttcccatgtcagataagcatctggatctgaacgtccctgaaaagaagg
tatggcaactttaatgttagaaatattatcgtcaactgtgcgtcatgttc
gttgattcacccttggtgaatgttcaatgtcattttcatcattatgttca
ttatggacagattgtgaaccacccccttcaatcttgtccaaacgagagtg
tataggctctaatgcattttctaatagacgttgcaaggtacgagtaatag
cttgcatttgcaaatctggtggttgatctccaccacgactacgatcttct
gatcctgtcatctaaagcaacacacaaaaatacagataatgagttaagta
aaacaaaagtaaaagtcctcacagcacactctcaaaacctctcagttttc
actccaaagaactgtgcactctaaaatagcactcagcgctcgtgtttcac
tcgggagaatgcgtgaatgactctttttgtctccccttctgttctcacaa
cgctcaatgcctttttccctcacaatttctcgtgtttttagttctttaaa
ggactaatccaacatttcaaaacctgttataattgtgttggctataagga
aaacacatggttagagagagagagaaaaaaataaataaacaaagggaaag
gataagaaaagagtaaaaggataagaaaataaaataaacaaaggaaaaag
gatggaatttaaataatttagtttcttactgcaaagaagtgctttacaac
gttcctagctccgaacaaataagaatagttcgtttcggttgatatccaag
cacttcgcaattacagagtacaaaactaaacattattcaacatttcaaca
taacaaaacacactttttttttctttcccaaacttgataaatttcaattc
ctcctttattttttttattttttttatttttgaatctgatttttctttct
ctttttgttgttgtttttttttgaatttttgaaactgatatatatatata
tatatatttcttttgaatttcgaattttcttgttggagaagaaaagtaca
acaattccaacctatgctcggataccagatgatacgatgtagcctaacga
aacagactatcttcgtatgttacggatctaggaatgttgtaagcacgttt
ctgcaacaagaaaacagcaaggaattaaagaaataatcatggtaaaatat
gggtaaaataaaagaacgaaaatggaaggaaaatgaagttgttggcgttt
aaaacaaaaagaaattcaatcggtgaagtcgaacgcttcatgaaacggcc
aaggcagcaacttgagtgttcaacaatggcaaaggtaatcgttggaatag
attaacgttaaactcaaaagaacttgcacaatctactgagcaaacccgaa
tcgaatctgttcaacgtcaaaaggacttggaccctctagatagcgatcta
ggaacccgaagtatcaagaaaatttgacacaacaaactaagtctgaaatg
ccaaggaaagtttaatgaagaaccgaaattgagagaaattctcaaacgta
attgttttcataaatcatctaacctgaatacatcattttaatatgtattt
ataagtacaaaagaggggtgttgaatggaaattcgtggctgtaatcaaaa
gggtttaaaataaggagttataactccttttggcgtcattttaataacag
ccatacatttaaatttcaaacgacaacctcccttgttcttatccttgtat
attcggctacacatgcacacacacactcttgtgcacaagcggtcatgtgc
tcctcacatgtttggatgcctcatgggctaccacaaatgcataggacact
tgccattacataggacacgtttcaactgcttctggactcgtcagctggag
ttgagctggtggagctgagtttgagctagctagaaatgtattgagctgaa
atgagctagaaacaatctttcagaactatttcgagctgagatgagctgca
tgcacatatttgagcttcaaccgagctagaaatgatatcttaagctgctg
tccattacgtttccttatggtaaacaaaacaaacatgcattaaagtaatg
caaacttattgaaaacttattaacaagctgtaaacataatgcaaacttat
tcattaaaacacaaacaacatcaagtcaataccaaaacatacttaaatac
acacataatacatagtagaacctaaatacgtcacatatcagcatgcaaca
tgttataaagcctatgttctaaggcatgaacatgatcgaataaatatgga
atcgtagcacaagtaaggaacaaggcttccttgaatttctttgccctaga
tcgagtaataggtcctaatggtaagacctccggatcagtttgctttgttg
gtgtgagcgtgcgccatcataaaaggaccgtgaccctgtatctaagaaga
tagaaaccaatcgttatcaatggggttgcacgccacagtcaaggagtgat
aagttcagaaaggaaacaaattgacgctactagcaagctagataagtcaa
gttgaatcaccaagaacaatgagagttgaacatctcacaaataaactata
attcattcaaggtttaaaagaagtttttttaaaacaagttacaaacaagc
tattccattggagttgacttaattcagttaaacaattctttgagtggctt
aatgatcaactagtccattggagttctcggacagacctaaaacttgacac
ttgaagtccccgatcaaccatcgtagtagacttaatgattgagatgaagg
aagaatttaacttgatcggtcaatgtgtttaagacttgaagttcattctt
tcttgatgcaccgaatgcatgaatagtaaatgaatgtttcttgtggcgcc
aaacagtcatgggtgtaaacactcagatttgaatggatgcttgagtgtga
acaccaaaaactgaatggttggctgatcagctgaaagataagtttaatgt
ttattcatcctttcacgaatggacacctaggagaatatattcatcagctt
caaaatgcatgaacaatcggatgcaatgtccctcttaaatgagtccaatg
aatctagaaatggtgtatgtatgtccagccacctattgaataacctgcaa
gacaatttaaacatggtttaagggcttcaataagaaaaaccaaaaacaca
aattaaatgtgtaataagctaagacacaattaataaacatagaacaacta
aacaatcagatatgtaataaagttgtacaaactaggacacatttagtaga
cttaactaaaataatcaaacatgtaataatgttgtatgaaatcaaaacat
aaataatataattgaaataactaaaaatgtctaagtcttattcaacagct
gagttagctagttaagttgaattcggcttgaagtaaattacaaggagcac
ttgatgagccatcccaaacatgattgacaagtccagttgaagcttcctcc
caaactcattcaactaagaccaaaattgcctctttgaactgcttggctcg
agctctagtaaatggaccagctattagcttgattggatcaggaacgtatt
cagttgagcctttggacgagttcgtatcatcccccctcttcaaggtgatt
tgtcctcaaatcgttgcctacgtcaaaagaagacaagtcagacacattga
aactcgcacttacattatactctccttgatatgagctcgcccatgaagat
aggtgccgaatccatggagttgcctttggggccaattactcgagcacgtg
ccaagaagttccaagatgctgtagcaagctatattgctcgattgtggagt
gatgggttgattgcccataaaatgccagctcaactagcttgattcgcacc
atcctacagctgattttagctcgattcagcttaattcagctcaattcggc
acttaattagttcaaggagctgattatatttattttgaataaatttaatt
agttgtgttagttagaatcagctcaaaatcatttaattaaataaatgtgt
cttaatctggacattcttaattcagcttattaaatatgttttatattaat
acatgcctttaatatgtccatattaagtcataaattaaatgtgtttagtt
taattacaaagttttaatgtgtcttgacttagacaaatttattagtggct
gctagttaatttgtcttagttaaattaatgtgcagatttttaatatgtcc
agctgatgatttcatgagtattaaacttgtcttaaccacatttatttgat
gtttttcagctagcttaatggcaaaggaagctcataaagaaggagcatgt
atttgggcacatgcatggacggcatttaaagtgcagctaccttgtgtttc
cagctgattttttttgtgtagctcaatggacttcaaactgatattttgag
cttctccaagggtcaatttcgtggagagcaatggccaaaaggtgcttcat
aaattctagcaactaattcacttggtggctactcatattcggccaaagaa
gcataattcttgaagctgtccatttctcttctccatagcagcaattaagc
tattttaaaacattagttgaatgtgaattatcatccttaaaggggccagc
tgaatcatctcttctagaaggttattattcagattttttttgttgtttat
gaatgcatctaggaaattgctaggaagtttcctaaagaagcttaaggctt
aagaatctgattagactattcggctaccttagtccatcctataaataggc
catgtaattcacattttggaggttaatgaacaatttgatagctttgctaa
attgtgaggttgttttcaactctcgttattctccaaaaacttgtgagact
tatcaaacttctttgtggcgtcaaacttgtttttgtttctacccgaactt
atcactttaatcccaaaagtgtggcgttcgattcatactaaggttcctat
cattttttgatagcgggtcgaagtttttatccattcaaccaactatccat
ccacaccttaccaacctaagcattctcctaagttacgggttaacacattc
ctattgtgttagttcggctttcgaatccttagccaaattgcttccattgt
tttctgattcatttcctaaaccaacaaactcttttgagcctaaataaacc
tctttcttctagcctattttgtaaagcctcaatttactcctaattcacga
tcgggcaatctttacgactcacttcgatctcgaggtgagggcgtatcaag
ttggtatcagagcttgttgaattagagtaagaattgttgtaatcggtatt
acgagattgtaaaaaaaaattcgaaaaaaaattcgaaaaaaaaatcgaaa
aatatatatatattattttgtgttcaaaactttctattgtattcagcaaa
gtgtaaaaaaaaagttcgtagttggatagtaaaagcattgtttgctgccc
gaggaaccgtatttatatagccacactatttccttctatttttttctttc
tttgtttgtgatacgccccggcctcggtgatgagagtcgagtcgttgatg
tgcccgatcgataaaattaaggagtatgagttgaggttttcaagtcgggt
tgaaaagaacaaattggctggaaacaagaaaatatttaagtgattaaagg
atggatagggtaggttcgatttcaaggctgaagaaagaaccgatattata
tgcaatatcgacccaaatcttacgttagcttgaaatgatgaaaaattgtt
aatcgtgacccaatatctatgagagataagaaccaacgatataggattga
acgccacactttagtaaagtgataagttcgaaattgacaggattgacgcc
acaagaatgtcttgataagtcaatggagtcaagagagaacaaagggagtt
gaaatactcaccaattgaacaaaagttcataattgatcaaagtctcaaaa
ttagtaaccttcaaatgattacaaaaacaacaatttataggctggatatg
ttccagccgaatggactcaaagcaatcagcttaattacacttaattgaac
tcaaatggctgttgaaataaccaaaaagtcatttggaagcttctatgcat
aggtgacaccaatgggcaggttgtttagtcttccaattcagctaataatt
gcactaatgagctgaaatgattttgttcaatgtttgtttagctgaaaaca
ttatgagcagcctttaattcctccttgggcaaccaaataagcagcagcca
aattaatggtagtttaagcacacgaacagcccaagtgtgtgaacacttga
tctccaacagcctccaagtgtggatgaacgaaaatgaatagctctcatgg
tgtgaaaatgttttgtgagatgaatggtcttgtgtgaacaactctttgtc
cattgctcttcacgaacagccacttggagaagctaaaaactactgctgga
tttttaattcagctcatggtccattgagctttacgaatagtcacatgagg
aaaaggaatcatcaactctcttcatggccaatccatgcatgtacctgaaa
gcaatttaatttagcaacttaattcatattaggacacatttaaattgaca
gcaacaagacacattaaatctgctcattaattcagctggactaagaaaca
ttaaaatgatgtaataagttgaataaattcatgtcatgtgctaactaaga
catattaaaaacatgtaattaatttgcctaatctaagacacattaaaaca
aataataacttagacacaaatttaattcaacagcagctaagacaaattaa
ttagaatatgaaattaatttgtctccacttttagacacaatttaatcact
tctaattaaaaagtccagaattaaaaagcaatttaattatttaagctgaa
taaactaatttgcatttattttattccagcaactaaaattataaaacgca
aagtaagctcaaacaagcaaatgagctcaatgagctggaaacgagctgaa
ttgagctcaacgagctaagattaggcttcattttgcacttgggcccctca
agctttagccactcttgatgacatcgagttgtgttgaaacatgatgcgac
caggttcgcatcagtttgttagcctacccgatcctaaaataattccctac
caagccacatctattttgtaagccgaccccaatcgattttgatttgtcaa
acttagtttgcgaagaatttcgagaggcgaaaatcgagtggtaaaaggca
agagagattggtgagactattagagagtagaaaagccaaagtgagtgatt
attctttgtgagtgattggtgagttcttgttgtgagtctttaaagaattt
aaaaaaaaaatgtcacgaagtccggaaaggaatccaaatgaggtaggtgg
gtttcgtcccataagaaatgttggaggaggagtgccggatctcactttgc
aagccattatgcgagaaatggagtgattgtttgatcgcaagcttgaacca
atcgaagaccgcttatatcgagttgaaatccgaggacaacgcgaagcgac
tccggaagatgcaaggcgagaacgagagcaaccaattgacaactttgatg
aaggagaatccgaaggtgaccacttgtctgaacaaggaaacccacaatgg
ttccaacgaaatcgaggcccaagaaatcgagaccgtcctgatgacaatct
caaaaatatcaagatgactattccaccgtttcaaggaaagaatgatcctg
aatcttacttggagtgggaaaagaagatggaactcgtcttcgagtgccat
aactattcagaaaataagaaggtaaagctcgctgccattgaattctcgga
ttatgcgatcgtgtggtgggatcaattggtgactagccgaaggaggaatg
gggagaggcctatctctacgtgggccgaaatgaaggctgttatgcgcaag
cgatttgttccctcctattaccatcgagagttgtaccaacgattacaaag
tctcactcaaggcaaccgaagcgtcgaggactattacaaagacatggaaa
ttgctatgataagagccgacgtggaggaggatcgtgaagcaaccatggca
aggtttctagccggcctaaatcgggatattgccaatatcgtcgagctaca
acactatgtagaagttatggacatggtgcatatggcaatcaaagtggaaa
agcaattgaaaaggaaaggatccactcaaacatatccaacggcttctacc
aacaagtgggctcaagggactagcaaaactcctaatcggcctaaggagcc
ttttgttgctgctaaatccaaccaaccaagtgtcgaagctagcaaaaata
aaaacgaggctgcttcgaatcattctcgcgatatcaagtgtttcaagtgt
caaggaagaggccacattgcgagtcaatgtcctaatcgatgagtgatggt
ggttcgttcaaatggcgagattgaatccaaagatgaacaagaggaggagc
ccgaaattcccatggaggaaggtgacgagctcgagctgcccgttgaaggt
gaattacttgttgtcaaaaggagtttgaatatccaagtagccgaggagga
acaacaacgagataacatctttcacacccgttgccatgttcaaggtaagg
tgtgcagtttgattattgacggaggtagttgcaccaacgtcgcaagttct
ttgcttgttgaaaaacttggtttagccaccacaaagcatccaacccctta
caatctacaatggctaaatgacggaggtgaactcaaggtgactaagcaag
caaaagtggcgttttccataggcaagtaccaagacgaggtgatttgtgat
gtcgtgcccatgcacgcggggcatttgctattgggccgtccttggcaatt
tgaccgacgagtagtccacgacggttatacaaactgatattcattcaagc
accttggaaggaatgttacattagctcctctcacaccgaagcaagtgcat
gaagaccaactcaagatgaagcaatctattgagcgagaaaaagaaaaaga
gaaaaacaaaaagagtgaaaagaaaaggaaagaaacgaatgatgagagtg
aggtaaaaacaagagtgacaaaagacaaagaacaatagtatgaaaataaa
aaaacgagtgtttttgctacaaaaagagagattcgaaaattgatgttggc
aaggcaacccatctttgtacttatgttcaaagagtgtttattggaaacta
acgaacttgaaaatactttgcctactcctatcgtttctttgttgcaggaa
tttggagatatttttcccgaagaagtgccaaatggcctacctcccattcg
aggaatcgagcaccaaatcgattttgtgcccagtgctgcaattccaaata
ggccagcatatagaagtaatcctgaggaaacaaaggaattggaaaaacaa
gtagccgaattaatggagaagggctacatccgtgaaagtttaagtccgtg
cacggtttcggttttgttggttcctaaaaaggatgtgatacggggtggcg
cgcggaccaagatcaagttgccaagtcacgagaaactcctacgaaagctc
taaacgaatagatctgaaattaaaacaaagaacaagatttaactaatcag
atctggaattaaatccccaaattcaattaaatgaacagcaagacacaaag
aacgaatgaatagatgttttcgtagttcaagaagacaaaatcgaactcca
agatcaattctccacaagctgaatctgttcaagaacactaaacagcaacg
aattaaatcaatcagatcttaatagaaaattagggatttgggcgacaaaa
gaaaagaaagaaattaatgaaattgaacgaatttggaagtaaagaaagag
tgctaatctgtcaataacttgaatcggccaagaatgcccaaattccagca
gcctaatttcacccaacaagaagaaataaaaaaaatggcaagaaccctaa
attttggggatttttggatcgaatagttgctgccaataaaagggatcgat
taaacgaagagttcttggagtttaatcaaggctgaaacacaaacaaaaac
agcaaagaaaattagaagaagaatcggcacaagcaataataaagaaaata
aattgaacagcaaggaattaaagaaaagtcctaagaacccttgaattccc
gaaagaattcacaaattccttcaaacggctctaatctcccctccaaagaa
tatcgatggtaagaagaaggttgaagatggctcccacaatcaaaagattg
ttaaaacaacttctaaagaaaactcaagagagaattcttggagaaaaccc
caaagaaaattctgcactcaacaaatctgaaatttgatagaaaataataa
taagatgatttttacaaagggtggctggccaatgcttatataggcctcca
acaaatcctaatctcacaagtaactaataaaaattaaacctaattaataa
aataacaaggtaaattcggccatgcacttatatgggttgttttgggccga
attttacatgtaatgctcctaaagattaaaaaaattaaattaaacaagta
agatgtttacaaattgggccctttgacattttggcttgatttttcaacta
agtatgaagaaatttcttgattgggctaaattttggttattgggcctcgc
cttcaagaatttgggctcgtgatccatctcctaccaaaattgggtcgttg
acgctcgtaatggagatccaatgcgttttggctgcaagatttggtttctt
ggaccaagatttccaagatttgaaatcttgattttcttgattcttgaaat
ctcttcgaacagcaaaattgggccaagattcggtttcttgattttcttga
aaacaagaaagtgaatcttgattttcttgttctctcgtgtatgcatctaa
ggccttgctaacaagctcttaaatggtcccatttagtttggaccgcattt
gtcgggcctttgatcttgttattgggccttgtggcaatttgagcccatca
cgttcttgaacttggattgggcctttatgactcgtatcattccccccttc
ctcaaaaagattcgtcctcgaatctgaaaaatcaaatggggacaagtcag
ccacattaaaagtagaacttacattgtactcaccaggtagatcaatttta
taggcattatcgttgatccgctcgagtacttggaaaggcccatcgcccct
tgggtccaacttagtcttcctttttgtaggaaatcgttctttcctcaaat
ggacccaaacccaatctctgggttctagtacaacccgtttgcgccccttg
tttgctttgttggtgttggcgtcatttgttttggctattcgttgtctagc
cttctcatgtaaggatttcaccaactcagctttctgttcgccatctaaat
tcgtaacatgttcaagaggtaatggcgcaagatcaagtactgttagtgga
ttaaaaccataaacaagttcaaatggggaataaccagttgtagaatgaat
agatctattatatgcaaattcaacgaatggtaggcattcttcccaatttc
taatgttctttcccaccatagctcgtaatagagtccctaagattcgatta
actacttcagtttgaccatcagtttgggggtgacatgtagtagaataaag
caatttagtaccaagcttaccccacaataccttccaaaagtggctaagga
atttgacatctctatcagaaacaattgttttagggatgccatgaagtctt
accacttctttaaagaataagtctgccacatgtgtagcatcatctgtttt
gtgacaaggaataaaatgtgacatctttgaaaacctgtcaacaacaacaa
atatactatctcttcctttttttgttcgaggcaaacctaaaataaaatcc
atggataaatctacccaaggtgaagtaggaatcggtagaggagtgtaaag
gccatgaggcattaccttagattttgcttgtttgcatgtaatgcacttgg
aacataccttttccacatccttcttcatatgtggccaatgaaagtgttcg
tgcaagatatctagtgtcttggccactccaaaatgtcccattaaacctcc
actgtgggcttcatgaatcaataagtctctcatggaacactttggtatgc
ataacctgttcatacgaaatagaaagccatctacaagataaaatttttca
aaagtagtatgtccacaattcttatagatatggccgaaatcagtatcagc
atcatataattctttaatgtgttcaaaccctaagactttagcattcaatg
tagtcattaaagcatatcgtcgagacaaagcatctgcaactacattatct
ttacctgttttatattgtatcacataaggaaatgtttcaatgaattctac
ccatcgggcatgtcttttactcaacttaccttgtccctttaaccatttaa
gagactcatgatctgtatgtatgacaaactcattaggcagcaaataatgt
tgccatacttgaagtgcacgaactaatgccaatagttctttgtcataagt
cgagtaatttaactgtgcaccgttcaatttctcactaaaataagcaatag
gttgcttatcttgcattaaaacggcgccgattccaattcctgaagcatca
cactcaagttcaaaagttttagcaaaatcaggtaatttaagcaaaggagc
agaacataacttagcttttagagtttgaaaggccttttcttgggtttcac
cccatttgaaacccactgatttctttataacctctgtcaatggggcagca
atagtagagaaatctttcacaaatcgtctataaaaactagctaaaccatg
gaaagatctcacctcagttaccgatttaggagtcggccactccttaattg
ccttgactttgtcctcgtcgacatgaataccttgagcactaactatgaaa
cctaagaatattagtttatcacaacagaatgtgcatttatcaaggttggc
aaataatctttcagttcgtagaatatccaaaacggttcgaacatggaaaa
catgatcatctaaagtctttgagtaaattaaaatatcatcaaaataaacc
actacaaatttacccaagtgaagccttaaaacatgattcattaatctcat
aaatgtgctaggtgcattagtaaggccgaaaggcataactaaccattcat
acaatccaaattttgttttaaaggctgttttccattcatccccttccctc
attcgaatttgatgataaccgctttttaaatcaattttagtaaatataac
tgaaccatgtaattcatcaagcatatcatcaagtctaggaattgggtgtc
gatactttaccgttattttgttgattgggcggcaatcaacacacattcga
tacgtaccatctttctttggtaccaataggacaggaacagcacaaggact
taggctctcacgaatgtaccgtttgtctagtaagtcctcaacttgccttt
gcaattcctttgtctcctcgggattgcatctataggctggtcgattagga
atcgaagctccgggtactaagtcaatttgatgttctatccctcgtaaagg
tggtaaacctttaggggcctcactaaaaacatcctcataatcctgcaaaa
gagattgaaacatactaggcagattttcgttaatgttagataaagataaa
taattttgcctaaacctcacaaggatacaaggctgtttattaagtagggc
tctcttcatatctttttttgttgccaaaagattttttccactcattttac
cactagagggttcactcacctttgggctttttaaattttgactttttcca
ctactattagcctcttttctctctgtcttctgaacttgctctttctccct
taccccctcacaaaattttatcatcctcaattgatctttatatacatcag
taggatttaaaagagcaaaagtgaatttcttacctttaaatacaagggag
tatcgattaagtttaccttggtgtgtaacatcacgatcaaattgctaaaa
ccagaaaacccgaaaaactgcggagtaacttgacaacttcgttcgaggag
ttcccgatctctaaaaatcacgaaattaaatctggaatgtccttaaatat
tgaatttttgatctggaaattttgggcaccaaattcaacccgctgaatct
tttttttaattttttattgaatttcgtcttttttgattttttgacttttt
tgactgatttttttgcgggaataatttttttatattcaatcacagttcca
aaaatatgtatgtaaaatttcagatcaatcggacaacatttacccaccca
aatgaattttttttgaacaatttttctgggtaaaactgctgtttgtgctt
taaaaaataaagatcagtttagaaatcaaccaagaacacccaaaacgccc
aaaatctgataccaaatgatacggggtggcgcacggaccaagatcaagtt
gccaagtcacgagaaactcctacgaaagctctaaacgaacagatctgaaa
ttaaaacaaagaacaagattaaactaatcagatctggaattaaatcccca
aattaaattaaatgaacagcaagacacaaagaacgaatgaatagatgttt
tcgtagttcaagaagacaaaatcgaactccaagatcaattctccacaagc
agaatctgttcaagaacactaaacagcaacgaattaaatcaatcagatct
taatagaaaattagggatttgggcgacaaaagaaaagaaagaaattaatg
aaattgaacgaatttggaagtaaagaaagagtgctaatctgtcaataact
tgaatcggccaagaatgcccaaattccagcagcctaatttcacccaacaa
gaagaaataaaaaaaatggcaagaaccctaaattttggggatttttggat
cgaatagttgctgccaataaaagggatcgattaaacgaagagttcttgga
gtttaatcaaggctgaaacacaaacaaaaacagcaaagaaaattagaaga
agaatcggcacaagcaataataaagaaaataaattgaacagcaagaaatt
aaagaaaagtcctaagaacccttgaattcccgaaagaattcacaaattcc
ttcaaacggctctaatctcccttccaaagaatatcgatggtaagaagaag
gttgaagatggctcccacaatcaaaagattgttaaaacaacttctaaaga
aaactcaagagagaattcttggagaaaaccccaaagaaaattctgcactc
aacaaatctgaaatttgatagaaaaataataataagatgatttttacaaa
gggtggctggccaatgcttatataggcctccaacaaatcctaatctcaca
agtaactaataaaaattaaacctaattaataaaataacaaggtaaattcg
gccatgcacttatatgggttgttttgggccgaattttacatgtaatgctc
ctaaagattaaaaaaaattaaattaaacaagtaagatgtttacaaattgg
gccctttgacattttggcctgatttttcaactaagtatgaagaaatttct
tgattgggctaaattttggttattgggcctcgccttcaagaatttgggct
cgtgatccatctcctaccaaaattgggtcgttgacgctcgtaatggagat
ccaatgcgttttggctgcaagatttggtttcttggaccaagatttccaag
atttgaaatcttgattttcttgattcttgaaatctcttcgaacagcaaaa
ttgggccaagattcggtttcttgattttcttgaaaacaagaaagtgaatc
ttgattttcttgttctctcgtgtatgcatctaaggccttgctaacaagct
cttgaatggtcccatttagtttggaccgcatttgtcgggcctttgatctt
gttattgggccttgtggcaatttgagcccatcacgttcttgaacttggat
tgggcctttatgactcgtatcaggatggatcatggcgaatgtgcgttgac
tgtcgcgccatcaataaaattaccataaaatatcgccatcctattccccg
cctcgatgacatgcttgatgaacttagtggagcccaattgttttcgaaga
tcgatttaaaaagtgggtatcatcaaatcagaatgcgggagggagacgaa
tggaaaactgcgttcaaaactaaatatggtttgtatgaatggttggtaat
gccattcggacttaccaacgctcctagtactttcatgcgtctcatgaatt
atgttttacgttcgttcattgggaaattctgtgttgtatattttgatgat
attttagtttatagcaggagcttggaagatcatattcaacatctacgtgc
cgtgcttgaagtcttgcgaaaagaggtactttatgccaatttaaagaaat
gttctttttgcactaatgaagttgtttttctaggctttgtggtaagtgct
cgtggtttagaagttgaccaagaaaaggtcaaggcgatcaacgaatggcc
gcgtccaacaaacatcagccaagtgaggagttttcacgggttggcaagct
tctactgaaggtttgtgcctaattttagttctgttgctgcccccttgaca
gagtgtgacgcttcaggtatcggcattggcgctgctttgatgcaagatgg
acggcctattgcatactttagtgaaaagcttaacggagctacgttgaatt
atccaacgtatgataaggaactatatgtgttggtccgagctctcaaaaca
tggcaacactatttatggccgaaggaattcgtaatccattcggaccacga
ggctctaaagcatttgaagggacaaaccaagctcaataaacgtcatgcca
agtgggtggagtatttggagtcgtttctgtacgtgatcaagtataaaaag
ggtaaggaaaatgttgtagccgacgccctatcacgaaggtacgcacttgt
caatttaatggattctaaattgcttggttttgaatttatcaaagatcttt
ataaatccgatgctgactttggtgaaatttatgagtcttgttcgcatggt
gcttgtgaaaagtactttcagcatgagggctatttatttcgtgaaggcaa
gctttgtgtgcctcaaagttctgtgagaaacgtccttgtaagagaagctc
atagcggaggacttatgggccacttcggaattgctaaaactttagcaata
ttgcatgaacatttctattggcccaaaatgaaacgtaacgtaataaggaa
atgtgatcgttggatcacttgtaagaaggcaaagtcacgaatcaaaccgc
atggtttatacaccccgttgcctattctgatgctccgtgggtagacattt
taatggacttcgttctgggccttccaagaaccaaaagagggagagattca
atatttgttgttgtagaccatttttcaaaaatggcccattttataccttg
taataaaactgatgatgctactaacgttgctaatctgtttttcaaggaag
ttgttaggttgcatggaatccctcgaaccattgtctccgatcgtgacaca
aagtttctaagtcatttttggaggacgttgtgggggaaattgggcaccaa
acttctattttcgacgacatgccaccctcaaacggatggccaaactgaag
tagtcaaccgtgtgttatcaacattgcttcgagctattttgaaaaagaat
ttgaagatgtgggaagattgcttacctcatgtggagttcgcatacaatcg
aaccattcattctgctacgaaattttctccttttgaggtagtatacggtt
ttaaccctattactcctcttgatttgattcctatgccttctaatgaatta
gtacatgtatatggcaaaaagaaggccgaatttgttaaacaattgcacaa
aatgttaaggataatattgagaggagaacccgaacaatatgttcgagggg
caaataaaggggcgcaaacgagtcgtgttcgaacccggtgactgggtttg
gatccacattcgcaagaacggtttcccgatcaaagaaatccaagcttcaa
tcaagggtgatggcccttttcaagtattggaacggatcaatgacacgtct
acagattgacctaccgggtgagtatggagtgagtgcaagttttaacgttg
ctgatcttctcctttgatgtagtgacgattcgaggacgaatcgcttcgag
agagggaggatgatattgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnagttctagagattcgtgcctagatgcgccggg
acgttgaacgctactgtgaacgttgtgtgacaggtaagaaagcaaaatcg
aaggtttcaccacatggtatgtacttacctttacctattcctgaatcccc
ttggactgatatttcaatggaatttattttgggattacctcgaactagaa
caggtcgggatagtatatttgttgtggttgatagattctcgaagatggca
catttcatttcatgccataagactgatgatgctgttaatgtggctaactt
gttctttaaagatgttgtacgattacatggtattcctaggtcgattgttt
tctgacagggatgtgaagtttttgagtcatttctggaggactctttggag
caaactaggtacgaaacttatgttttctactacttgtcatccccagactg
atgggcaaactgaggttgttaacagagttttatctactttacttcgatcc
atcattaaaaagaacatcaaaacttgggaagattgttttccacacgttga
attcgcttataaccatgttgtacattctgttactaagatgtcaccttttg
atgttgtttatggctttaatcctattacgcctctagatatgttgcctttg
ccgcaggaacaggtgatgaacagggatggtaaagcaaaagcagaatacgt
gaagaaattgcatcaacaggttaaggagaacctcgaacgaaggactcaac
agtatacaaagcaaggaaacaagggcagaaagcgagtcaccttcgatgtg
ggagattgggtttgggttcattttcgaaaggaacgatttccagcccagag
gcggtccaagctgttaccgcgtggtgatggtccttttcaggtgttggaga
aagtgaatgacaatgcctacaagttagacttgccgggagaatacaatgtg
agtgccacatttaatgtatctgatttaaccccttatgatgattctacaga
tttgaggacaaatccttttccagaaggggggatgatgtgcgcacgctcac
accaacaaagcaaactgatccggaggtcttaccattaggacctattactc
gatctagggcaaagaaattcagggaagccttgttccttacttgtgctacg
attccagatttattcgatcatgttcatgccttagaacataggctttataa
catgttgcatgctgatatgtgacgtatttaggttctactatgtattatgt
gtgtatttaagtatgttttggtactgacttgatgttgtttgtgttttaat
gaataagtttgcattatgtttacagcttgttaataagttttcaataagtt
tgcattactttaatgcatgtttgttttgtttaccataaggaaacgtaatg
gacagcagcttaagatatcatttctagctctgttgaagctcaaatatgtg
catgcagctcatctcagctcgaaatagttctgaaagattgtttctagctc
atttcagctcaatacatttctagctagctcaaactcagctccaccagctc
aactccagctaacgagtccagaagcagctgaaacgtgtcctatgtaatgg
caagtgtcctatgcatttgtggcagcccatgaggcatccaaacatgtgag
gagcacatgaccgcttgtgcacaagagtgtgtgtgtgcatgtgtagccga
atatacaaggataagaacaagggaggttgtcgtttgaaatttaaatgtat
ggctgttattaaaatgacgccaaaaggagttataactccttattttaaac
ccttctgattacagccacgaatttccattcaacacccctcttttgtactt
ataaatacatattaaaatgatgtattcaggttagatgatttatgaaaaca
attacgtttgagaatttctctcaatttcggttcttcattgaactttcctt
ggcatttcagacttagtttgttgtgtcaaattttcttgatacttcgggtt
cctagatcgctatctagagggtccaagtccttttgacgttgaacagattc
gattcgggtttgctcagtagattgtgcaagttctttcgagtttaacgtta
atctattccaacgattacctttgccattgttgaacactcaagttgctgcc
ttggccgtttcatgaagcgttcgacttcaccgattgaatttctttttgtt
ttaaacgccaacaacttcattttccttccattttcgttcttttattttac
ccatattttaccatgattatttctttaattccttgctgttttcttgttgc
aggaacgtgcttacaacattcctagatccgtaacatacgaagatagtctg
tttcgttaggctacatcgtatcattttaccatctatccatctatcacctt
gatagccttataagattagggtctctattctttaatagaggttctttctt
ctgctattaagttcacattctatcatccatcaacttatctttaaaccatt
ttctttgttttaaaaatatcaacctttaaaacgtccattttttaaacaaa
aaactagttacttaattttacgatcggacaacaaatgactcaaatttgac
aatgaatacgagtttgtatctcttgccttttaccactcttgctcgtttct
ctaagttcttaagtgactaccttagacttagcagcaaccttgtggaatcg
acaaaatgatgtagaggtgggagttgatgtcaggaaatagggtaggctaa
aagaaaacaaaagttacatgaagtgtggctgaaaacgtttggtaaaggaa
aaatctgagctcgggaaacataaaactttcaagctagctttttctcttct
cctttttttacgtataatttcgagtctccccttttgtatttcaaacttgt
atttgcaatatgttgtattctttgttttgatcaatttttttttaatttca
accccaagagtgaaaaaaatgtggatacttaattttactagctttgatac
caaatgatgcaagctcgtattcatggttgattacaagttgcaaatgttcc
taatcataaattaagaagtattgaatcaaaaggctaggtataggtgtcga
aatggctagacaagcaaaatgggtgttttagatggatggaaatggctaag
ttatgtttcaagttaaggttgaagaatgaactaatattataaggtgaata
ttgactcgattcttataacaacacttagagatgttatggtaggatattaa
accgtgaccttctatctgtaaagataggaaccaatcggtataggggtgaa
cgccacacttgctagaagtgataagtttaaaaagaatcagattgatgcca
caaggttcacttgataagtcaatttgagtcaatgaagaacaaagagattg
aacactctcaattatataaaaattcatcaaaagtccttacaacatgtttc
aagcctagtatttataggctacacaaaatactagtagaatgggcatggtt
tacaatatagtttaatgtgcctagtgtccattgagttgtccaaaacatcc
cttgaagatttctagaagtggaagacaccaacagccttgttcacatggtg
acgttttcaatcccaaacaaccacttcattggtctttgaaaatgagctaa
atgtgcaaggagctgatcggttaaaatggtgtgaacttggtaaccgaatg
gcatgtagctctttattgttgcttgtgtcgcacgaagactcatcaaatgt
gaaaaaaaaattggatggtccctaaggtgtgaacatggcagccaacccat
tagtcaagtgtgaaaacacttgatgctttgctaatcacgaaatggctctt
gggaggttgtgttcagctccttaaatgtgtttgtgccatacgaacagctt
gaaggaagcttactagtagcagccaatgtgaacaacctgttacacatgaa
agaaacggttaaatgcaataataaacaaggtttaaacacacctttaattt
gtatgatctaagacaaacattaaagatgtcagaattaagacacaattaaa
acatgtactaaagatgttcaaactaggacataattaaagacacataataa
agatattcacactatgacataattaaactcatattaattatgttcaaatt
tatgacataagtaaaatcacaaactaaaataactaaaataatgaaaaatt
gaattagaatatttaccagcaaccgaattcaacaagctgaaaattaaagc
tttgcttggatcaaaatgcatgggacgcatgaagtgcatgcccaagcttg
atcaataagccccataatagcttctccccaaactcaatcaatgagacccg
taatggcttccttgaacctcttggctcatgcccgagtgattggccctatt
ggcagctcaattggatcacaagctattttggttgagtccttgttcatgat
cacatcaagaatgccacaaagcaaaaagccttgataagttcaatttttat
gttctaaagtactcaagagaaaattctcacaaaatgtatattcattcatc
atagtctaatcaaagttctatatacaggatatttataggcacttttgtga
ctattcaaatgcctatgtgggacttttcatattcggccattaactagtat
tattacaagcactaattttgtttttaactctagtagggaagccaatgagt
catgtctcttcattggaatctgatctagttgaaaaagcatgccaattctc
ttaggaattctacatatcacgttctatctttccatctatcttatttattt
tcttctttattaattctatatcttagatttcattcttctattttattcat
cttaattatttttttctttatttttatctgacttggatttgtttctgctt
ttggttgtttcaaaatctaagtttcattctgaacgtctagagccctaaag
tcaaatccacaactttgacaaactttatgatccacttccgcattcattcg
tctcattctttatcactcatgcacacgaactaattgaacatggaacttaa
atcaacttatttaaaatgaaaataaacacacattaatttatgcattaaaa
aagtaacaaccaaattaaataacatacttatataaacaaactcaaacata
tttaacaactaagatgcttaaatgcatggtttaagatgcaaactaaatga
acaaatgagttacttaatgcatgacttaatttaatgatgcaaaatttaac
taacatgggagttacataatgtatgtcataatttgtgatgcaaacttaac
tagcatgagagttacataatgcatgactttattaaatgcagaacacatag
tgcatgtcacaattaaaagatgtagattaataatgtaagacgttaattaa
ggatgcatataacaaacaaaaataattaaaagctctagagttaagtaaac
taaacaaacagccaaatgcaaaatattgcatggacttgggacgttatttt
gggaccaataagggttcgacatctcatgttcagcccaaacttgctgaatc
aggcccacctgatgcgatcatgaccaaggactcaaccaaggctactgatg
aaccaattgagctatcaacggggccgatcactcatgctcgagccaagagg
tttaaggaagctatttcaggcctcattgatagaatttagggagaagctat
agtgggactcattgatcaatcttagacaagcacctcatgcgttccatgca
gctttctccaagccaatctttaattttcagcttgctatcttcggttgctg
gaataaggacattaagtcattttagttgttttagttattatagtttaagt
ctttaaattgtgtcataatttgaacatcattaatttgagttttaaatatg
tcataatctgaccatctttaatatgttttaagtctattaattatgtgata
cgatctcggtttagtagttgagtccgagtcgtttggttcctgatcgtaaa
cgaagaagtagattagacgagaaggagttagaatatatttgtgtacaaag
aagtaagataagtttgtgcaaagttggatgtggatttggtttatgatacg
ccctcacctcgagatcgaattgagtcgtaaagattgcccgatcgtgaatt
aggaataaattgaggctttacaaaataggctagaagaaagaggtttattt
aggctcaaaagagtttgttggtttaggaaatgaatcagaaaataatggaa
gcaatttggctaaggattcgaaagccgaactaacacaataggaatgtgtt
aacccgtaacttaggagaatgcttaggttggtaaggtgtggatggatagt
tggttgaatggataaaaacttcgacccgctatcaaaaaatgataggaacc
ttagtatgaatcgaacgccacacttttgggattaaagtgataagttcggg
tagaaacaaaaacaagtttgacgccacaaagaagtttgataagtctcaca
agtttttggagaataacgagagttgaaaacaacctcacaatttagcaaag
cgatcaaattgttcattaacctccaaaatgtgaattacatggcctattta
taggatggactaaggtagccgaatagtctaatcagattcttaagccttaa
gcttctttaggaaacttcctagcaatttcctagatgcattcataaacaac
aaaaaaaatctgaataataaccttctagaagagatgattcagctggcccc
tttaaggatgataattcacattcaactaatgttttaaaatagcttaattg
ctgctatggagaagagaaatggacagcttcaagaattatgcttctttggc
cgaatatgagtagccaccaagtgaattagttgctggaatttatgaagcac
cttttggccattgctctccacgaaattgacccttggagaagctcaaaata
tcagcttgaagcccattgagctacacaaaaaaatcagctggaaacacaag
gtagctgcactttaaatgccgtccatgcatgtgcccaaatacatgctcct
tctttatgagcttcctttgccattaagctagctgaaaaacatcaaataaa
tgtggttaagacaagtttaatactcatgaaatcatcagctggacatatta
aaaatctgcacattaatttaactaagacaaattaactggcagccactaat
aaatttgtctaagtcaagacacattaaaactttgtaattaaactaaacac
atttaatttatgacttaatatggacatattaaaggcatgtattaatataa
aacatatttaataagctgaattaagaatgtccagattaagacacatttat
ttaattaaatgattttgagctgattctaactaacacaactaattaaattt
attcaaaataaatataatcagctccttgaactaattaagtgccgaattga
gctaaattaagctgacacgagctaaaatcagcttgtaggatggtgcgaat
caagctagttgagctgggcattttatgggcaatcaacccatcactccaca
atcgagcaatatagcttgctacagtatcttggaacttcttggcacgtgct
cgagtaattggccccaaaggcaactccatggattcggcacctatcttcat
gggcgaactcatatcatcctccctctcttcgaagcgattcgtcctcgaat
cgtcacctacatcaaaaggagaaagatcagcaacgttaaaacttgcactc
actccatactcacccggtaggtcaatcttgtagacgttgtcattgatccg
ttccaatacttgaaaagggccatcaccccttgattgaagcttggatttcc
tttgatcgggaaaccgttctttgcgcatgtggatccaaacccagtcaccg
ggttcgaacacgactcgtttgcgccctttatttgcccctcgaacatattg
ttcggttctcctctcaatattatccttaacatttttgtgcaattgtttaa
caaattcggccttctttttgccatctacatgtactaattcattagaaggc
ataggaatcaaatcaagaggagtaatggggttaaaaccgtatactacctc
aaaaggagaaaattttgtagcagaatgaacggttcgattgtatgcgaact
ccacatgaggtaagcaatcttcccacatcttcaaattctttttcaaaata
gctcgaagcaatgttgataacacacggttgactacttcggtttggccatc
cgtttgagggtggcatgtcgtcgaaaatagaagtttggtgcccaatttcc
cccacaacgtcctccaaaaatgacttagaaactttgtgtcgcgatcggag
acaatggttcgagggattccatgcaacctaacaacttccttgaaaaatag
attagcaacgttagtagcatcatcagttttattacaaggtataaaatggg
ccatttttgaaaaacggtctacaacaacacatattgaatctctccctctt
ttggttcttggaaggcccagaacgaagtccattgaaatgtctacccacgg
agcatcaggaataggcagcggggtgtataaaccatgcggtttgattcgtg
actttgccttcttacaagtgatgcaacgatcacatttccttattacgtca
cgtttcattttgggccaatagaaatgttcatgcaatattgctaaagtttt
agcaattccgaagtggcccataagtcctccgctatgagcttcttctacaa
ggacgtttctcacagaactttgaggcacacaaagcttgccttcacgaaat
aaatagccctcatgctgaaagtacttttcacaagcaccatgcgaacaaga
ctcataaatttcaccaaagtcagcatcggatttataaagatctttgataa
attcaaaaccaagcaatttagaatccattaaattgacaagtgcgtacctt
cgtgataaggcgtcggctacaacattttccttaccctttttatacttgat
cacgtacggaaacgactccaaatactccacccacttggcatgacgtttat
tgagcttggtttgtcccttcaaatgctttagagcctcgtggtccgaatgg
attacgaattccttcggccataaatagtgttgccatgtttcgagagctcg
gaccaacgcatatagttccttatcatacgttggataattcaacgtagctc
cgttaagcttttcactaaagtatgcaataggccgtccatcttgcatagaa
gcagcgccaatgccgatacctgaagcgtcacactctgtcaagggggcagc
aacagaactaaaattaggcacaaaccttcggtagaagcttgccaacccgt
gaaaactcctcacttggctgatgtttgttggacgcggccattcgttgatc
gccttgaccttttcttggtcaacttctaaaccacgagcacttaccacaaa
gcctagaaaaacaacttcattagtgcaaaaagaacatttctttaaattgg
cataaagtacctcttttcgcaagacttcaagcacggcacgtagatgttga
atatgatcttccaagctcctgctacaaactaaaatatcatcaaaatatac
aacacagaatttcccaatgaacgaacgtaaaacataattcatgagacgca
tgaaagtactaggagcgttggtaagtccgaatggcattaccaaccattca
tacaaaccatatttagttttgaacgcagttttccattcgtctccctcccg
cattctgatttgatgatacccactttttaaatcgatcttcgaaaacaatt
gggctccactaagttcatcaagcatgtcatcgaggcggggaataggatgg
cgatattttatggtaattttattgatggcgcggcagtcaacgcacattcg
ccatgatccatcctttttaggaaccaacaaaaccagaaccgcgcacggac
ttaaactttcacggatgtagcccttctccattaattcggctacttgtttt
tccaattccttcgtttcctcacgattacttctatatgctggcctatttgg
aattgcagcgccgggcacaaaatcgatttggtgctcgattcctcgaatgg
gaggtaggccatttggcacttcttcgggaaaaatatctccaaattcctgc
aacaaagaaacgataggagtaggcaaagtattttcaagttcgttagtttc
caataaacactctttgaacataagtacaaagatgggttgccttgccaaca
tcaattttcgaatctctctttttgtagcaaaaacactcgtttttttattt
tcatactcttgttctttgtcttttgtcactcttgtttttacctcactctc
atcattcgtttctttcctttttttttcactctttttgtttttctcttttt
ctttttctcgctcaatagattgcttcatcttgagttggtcttcatgcact
tgcttcggtgtgagaggagctaatgtaacattccttccaaggtgcttgaa
tgaatatcggtttgtataaccgtcgtggactactcgtcggtcaaattacc
aaggacggcccaatagcaaatgcctcgcgtgcatgggcacgacatcacaa
atcacctcgtcttggtacttgcctatggaaaacgccacttttgcttgctt
agtcaccttgagttcacctccgtcatttagccattgtagcttgtaagggg
ttggatgctttgtggtggctaaaccaagtttttcaacaagcaaagaactt
gcgacgttggtgcaactacctccgtcaataatcaaactacacaccttacc
ttgaacatggcaacgggtgtgaaagatgttatctcgttattgttcctcct
cggctacttggatattcaaactccttttgacaacaagtaattcaccttca
acgggcagctcgagctcgtcaccttcctccatgggaatttcaggctcctc
ctcttgttcatcttcggattcaatctcgccatttgaacgaaccaccatca
ctcgtcgattaggacattgactcgcaatgtggcctcttccttgacacttg
aaacacttgatatcgcgagaatgattcgaagcagcctcgtttttattttt
gctagcttcgacacttggttggttggatttagcagcaacaaaaggctcct
taggccaattaggagttttgctagtcccttgagcccacttgttggtagaa
gccgttggatatgttcgagtggatcctttccttttcaattgcttttccac
tttgattgccatatgcaccatgtccataacttctacatagtgttgtagct
cgacgatattggcaatatcccgatttaggccggctagaaacctcgccatg
gttgcttcacaaccctcctccacgtcggctcttatcatagcaatttccat
gtctttgtaatagtccttgacgcttcggttgccttgagtgagactttaca
atcgttggtacaactctcgatggtaataggagggaacaaatcgcttgcgc
ataacagccttcatttcggcccacgtagagataggcctctccccattcct
ccttcggctagtcaccaattgatcccaccacacgatcgcataatccgaga
attcaatggcagcgagctttaccttcttattttctgaatagttatggcac
tcgaagatgagttccatcttcttttcccactccaagtaagattcaggatc
attctttccttgaaatggtggaatagtcatcttgatatttttgagattgt
catcaggacggtctcgatttcttgggcctcgatttcgttggaaccattgt
gggtttccttgttcagacaagtggtcaccttcggattctccttcatcaaa
gttgtcaattggttgctctcgttctcgccttgcatcttccggagtcgctt
cgcgttgtcctcggatttcaactcgatataagcggtcttcgattggttga
agcttgcgatcaaacaatcgctccatttctcgcataatggcttgcaaagt
gagatccggcactcctcctccaacatttcttatgggacgaaacccaccta
cctcatttggattcctttccggacttcgtgacatttttttttaaattctt
taaagactcacaacaagaactcaccaatcactcacaaagaataatcactc
actttggcttttttactctctaatagtctcaccaatctctcttgcctttt
accactcgatttttgcctctcgaaattcttcgcaaactaagtttgacaaa
tcaaaatcgattggggtcggcttacaaaatagatgtggcttggtagggaa
ttattttaggatcgggtaggctaacaaacaaagaaagaaaaaaaatagaa
ggaaatagtgtggctatataaatacggttcctcgggcagcaaacaatgct
tttactatccaactacgaacttttttttacactttgctgaatacaataga
aagttttgaacacaaaataatatatatatatttttttcgaattttttttt
tcaaattttttttgaattttttttacaatctcgtaatactgattacaacg
attcttactctaattcgacaagctctgataccaacttgatacgccctcac
ctcgagatcgaattgagtcgtaaagattgcccgatcgtgaattaggagta
aattgaggctttacaaaataggctagaagaaagaggtttatttaggctca
aaagagtttgttggtttaggaaatgaatcagaaaacaatggaagcaattt
ggctaaggattcgaaagccgaactaacacaataggaatgtgttaacccgt
aacttaggaggatgcttaggttggtaaggtgtggatggatagttggttga
atggataaaaacttcgacccgctatcaaaaatgataggaaccttagtatg
aatcgaacgccacagttttgggattaaagtgataagttcgggtagaaaca
aaaacaagtttgacgccacaaagaagtttgataagtctcacaagtttttg
gagaataacgagagttgaaaacaacctcacaatttagcaaagctatcaaa
ttgttcattaacctccaaaatgtgaattacatggcctatttataggatgg
actaaggtagccgaatagtctaatcagattcttaagccttaaccttcttt
aggaaacttcctagcaatttcctagatgcattcataaacaacaaaataaa
tctgaataataaccttctagaagagatgattcagctggcccctttaagga
tgataattcacattcaactaatgttttaaaatagcttaactactgctatg
gagaagagaaattgacagcttcaagaattatgcttctttggccgaatatg
agtagccaccaagtgaattagttgctggaatttatgaagcaccttttggc
cattgctctccacgaaattgacccttggagaagctcaaaatatcagcttg
aagtccattgagcgacacaaaaaaaaatcacctggaaacacaaggtagct
gcactttaaatgccgtccatgcatgtgcccaaacacatgctccttcttta
tgagcttcctttgccattaagctagctgaaaaacatcaaataaatgtggt
taagacaagtttaatactcatgaaatcatcagctggacatattaaaaatc
tgcacattaatttaactaagacaaattaactagcagccactaataaattt
gtctaagtcaagacacattaaaactttgtaattaaactaaacacatttaa
tttatgacttaatatggacatattaaaggcatgtattaatataaaacata
tttaataagttgaattaagaatgtccagattaagacacatttatttaatt
aaatgattttgagctgattctaactaacacaactaattaaatttattcaa
aataaatataatcagctcattgaactaattaagtgccgaattgagctgaa
ttaagctgacacgagctaaaatcagcttgtaggatggtgcgaatcaagct
agttgagctgggcattttatgggcaatcaacccatcactccacaatcgag
caatatagcttgctacagcatcttggaacttcttggcacgtgctctagta
attggccccaaaggcaactccatggattcggcacctatcttcatgggcga
gctcatatcagtttaagtcgaaatggtatgaatagaatggaagagttcgg
tttaagataattaagaaatggtatttggttttggtacgtgttgggatttg
ggaattggtacgaaatggtatgaaatggtatggtatttggtacgaattgg
taatggttcaaagaggtcaagaatgaaccaacactaaagaaaagtgtcaa
cccaaaacttataggacctaaatgaattggaaatggttgaaaaggacctt
gacccgatacttaggaaagtatgaaccaaaggtatcaaaggtgaacgcca
cactcgggtttgaggagtaataagttcggaaaagactcgaaaagacgcca
ctaaaagcttagataagtcttacgggtctcgaacaaaatttgagagaaaa
tgcctcacaattttggcagcaattcgctaattaaaaatgttaaaagttct
ttacaaagtaaaatttcagctatttataagcaacacataagctagccgaa
tggtcacttacattccttaaaaattaagcaaatgaatcacttaaatgaac
tagctagattcggctgaacatggagctccattagacaccttctagatgaa
gcattggacttagaaaaacttggatgatgcatggatagctaggttcggct
aatgggcataaattagctcatttatgttgtaacttttggctgaaaggtga
ccagcaattaagaggataatgagcagccaattcaagtgtgaaagctcaac
gttgaagagtcatggagtgtgaacacatggaaccgaaaagccaagatgca
tccagcaaatgtgaaaggaattaatgggcagctttggagttggaaacatt
agctcccttggccgagtagtcacctaggaatgttgaattcagctcaccaa
tttgatgcatgtatctccaggtgcaatgtatctaacatgcatgcaccttg
ctaaaatgaatcttcaaattcggctaaccttgttaaatgatcccacacat
tcggccaacctatataaataagaagaactaaaattaatatgatatttagc
tgaacaaaattaatattaaaaccatgaaacattaattcggtcaactatat
cactaaaatcagctcattaaattcggcagctttaaagcaacttaaaatca
tgtaataaaacttgacatattaaaaacatgcaacaaacatattaataagc
tgtaataaactaattaaatcgacttaaataaatattcagctattaaatta
atgtctagttgatattaagctgaattgaaaaggtttgcgctgaaattgag
cgaattcgagctcattgagctgaaatggaagttaattcagctcatattaa
agtgcacggattgcttttcgagttggtccaagcttcctcgatgtgaccaa
ccaagatctcgccccaaactttgtcaactaaagccgaaacagcctccttg
aattgtttagctcgtgatcgggtgatgggaccttggggcaactccaacgg
ctccttgttcgagctaggtaggacttgaggcgtggccgtatcattatgtc
tgatgtgagcatggctgcatcatgtcatgatacaattcgaggaaatcgga
attggcccaagcactaggggcccaagtgcaaaaatgaagttttaatttca
gtttgttaatttggttgctagaaaataaggatgtttatccattttagtta
ctttagttcatttagtttgactctttaattatgtcataatttgaacatca
ttaatatgatttttttaattatttcataatctgaacaacattaataaggg
ttttaattatgtcatagtttaggacgtctttaatacatgttttaagtatg
ttttaaatttgaacatctttaatgtttgtttaatttcctacatatttaaa
atgtgtcaaagtttgtttattgtggcatttacccgtctctttaatgtgta
acaggttcacattggctactgctaggaagtttccttcaagttgttcgtgt
ggcacaaacacaattaaggagcttcatgcgtcacaagcatcaataatgaa
ctacatgcacattcgggtaatattcaaggtggttgtttgaatgggcaagg
cttagcttttcaagctccatccatcaaaccgaattcatgtgttcatgcaa
atcataaattggagagattcatagccattcacaaagtgcatggatggatg
gaaccaaggggaggagttccacatttaattggtagcattaaattatgttc
atacatgcaattattcaaaaggatcgaatctacccattcatgcactctaa
aaggtgcttgtacggtttaaatgtcacacattgaatccacaagatacatg
cttcatgttcatgaacaagcagctcattaattcagccaatgtaccaatac
atacatgcatcgaaattaggggatgaatcagctaaatacaaactgcccat
tcatgtgttcaagatgcattacacttcaattaaaggagatgcatgtccca
tgcatctatcattcggctaaaggggattgaaggggaattaaaggctgaac
atcatagaggatgaatctgcaagatgcatataactagttcatgaacctat
atgtcattaaagcgcctatttatgagaatgcatgttccatgcaagtgcat
gaatgatccaaggagatgaatgagactttggtgatcatacaaggcacttg
aaggtttcttctatgctaagaattcatgcacaaaaaaggaaggaagaatg
tgactcttcaagttaaatttcatgcatgaatatcattcaatgaggtgcat
gaacgtccaaatacatgccaatacaagggatgaacgtccatgaaccaaca
aaggggagcgaacaaccatttatatgcatttaagggagttcatgaatcat
tcggttcattgtatggtttgtgtacatgaactacattaatggttgaatgt
tggccattcatcttcttttatattttcctataaatagttgttttgtaaac
atttggaagaacttttgaacctttgatgaattttataactattgtgagtg
ttcaactctctttgttctctcttgactcaaattgacttatcaagtttatc
ttgtgacgtcaatttgattcttcttgaacttatcacttcttaggagtgtg
gcattcaacctataccgattggttcctatctcatataaatagtgggtcaa
gggtaagctatcaattccattttcaacttaaaagctactataagaattgg
gtcaatattaccatataattttggatctctctttagccttaagccaaacc
tgatacgaactcgtctcgtgatgttttgagtcgtatgtgttgcccaatca
tgaattgagtaaggatggattcgtttcggttttaaaatgaaacaaaatag
agataatggcttcaaacaaaggtaataaacaaaataaagaggaaacaata
acaaattaattggctaagaccaaaaatgaaccaacaataacgaattgttg
acccgaatctcaaaatggtctttaggtgtttttcggttaaaggaaacagg
aaaggaaccttgacccactatcaactatgataggaaccaaaggtatattg
aacgccacaccaaaggtgataagttcagcaacaaagaaaagatggacgcc
acaagctatgcttgataagtcaaatcaattccgaaagaacaaatagaatt
ggatagctcacaattcaaatatttcatctatattcagcaaaaagttcttc
ccctctgatacgagtcatagaggcccaacccaagttcttgaaggcaaggc
ccaataagaggattttaagcgcaaccaagaagtcaaaccatacttagttg
aaaatcaggccaaattgtcaaagtggcccaagttgtaaagttttattttt
atttatttatttattttttacttagtttaaatttttatgtaaatattcag
tccaagagtcccaaataaaagacccttggccgaatttctatattaaaata
attaggagttttttttattttagttttctaattagattaggactagttat
aaggcctatttaaaggcatggctggccaccttgtaaagaacttctcaatt
atatcaaaaatatcagatttgtttaagtgtggaattctctttgagttttt
ctccaagaattctctcttgagttttctttagaagttgttttaacaatctt
ttgattgtgggagccatcttcagccttcttcttgccattgatattctttg
gaggggagattagagccgtttgaaggaagttgtgagatctttcgggattt
caaggctttttaggacttatcttttaatttcttgctgtcaattctttctt
tatttctgcttgtgctgaatctttatctaatttattttctgtttttattg
tgttttcagcctttttctatcttaaggaatcagcccaaaaatccccaatt
tctagggttcttccatactctctttgggtgaaattagactgtcgaaattt
ggggaaaactatcttggtgtttaattgggcagaatcgcaatctcctttag
ggtttcaagaacccttattaacacttatttctattcacaatttgattctt
tactgttttggggattttatttcagatctggaaattcaaaattctaatct
tttaatttttgtttcgtttcagatctgattgtttagggtttttcatagga
gtttcccgtgacttggcaactcgatcttggtccgcgcgcaaaccccgtat
catttggtatcagattttgggcattttgggtgttcttggttgatttctaa
actgatctctattttttaaactataaacaacagttttacccaaaaaaatt
tcgaaaaaattcatttgagtgggtaaacgttgtccgattgatctaaaatt
ttacatacatatttgtggcactgtgatttaatattaaaaaattaatccca
caaaaaagcagtcgaaaaagtcaaaaaaatcaaaaaaaaaggaatccaat
aaaaatttaaaaaaatattcagcgggttgaatttggtgtccaaaatttcc
agatcaaaaattcaatatttaaggacattccagatttaatttcgtgattt
ttggagatcgggaacacctcgaacgaagttgtcaagttactccgcagttt
tttcgggttttctggtttcagcaatttttattgattcttagctgtaggtt
ttcatttgtttgctttttaatctccctttacaatatctaacaccttcttg
tttcttgtgttagtaggatttaaacttgtgcacaatttttcctcggtgca
acacgaatcaattggtgtctcgtcagtttttggcatcttagtgcaaatta
ggactctttggtagtttcggttcatacactttctaattggttgatataga
ctctactaaagaaatcacaagaatgaattctacctcattgagaaattttt
tttctttttgagtgattaacggtgaggtttgctaatttttctttttgagt
gttgagtgtttgttttgcaggtagtccaaaaaaataataataagatgctc
cgccgcacccttaacatccaaatgggagacgattgtgataaccaaaggac
caatattttccattctaggtgttttataaaaggtaacttatgttcactta
tgattgatagtgggagttgttcaaatgtagttaccagttatttggtggat
tccttaaagttaccttgtatcgagcaccctaagccgtatcaccttcagtg
gcttaatgaatgctcagaagttaaggttacaaaacagtccttgatcactt
ttaagcttgggaattacgaggatgaggtatggtatgatgtggtcccaatg
catgtggcacacttgctccttggacggccttggcaatttgatcgtgatgt
tacacacgaaggcaagctcaatagatactctcttgtgtttaaaggccgaa
aattcactcttgctcctttaaatcccaatgatgtatataaagatcaatta
aaaatgatgaaattttgtaagggggtgagggagaaagaaaaaataaaaaa
gacagagagaaaagaggctagtagtgaaaaaagtcaaaatttaaatggcc
caaaggtgagtgaatccgcaagtggcaaaactagagagaaaaaattgatt
gcaacaaaaaaagatgtgcggagagccttactcaataaacagccttgtat
ccttgtgaggtttaggcaaaactatttatctctatctaacattaatggat
atttgcctagtgtgtttcaatgtcttttgcaggattatgtggatgttttt
agtgagtcccctaaaggtttaccacctttacgtgggatagaacacttcca
ttggccacatatgaagaaggatgtcgaaaaggtatgttctaagtgcatca
aatgtaaacaagcaaaatctaaggtaatgcctcatggcctttacactcct
ttgccgattcctacttcaccatgggtagacttatccatggattttattct
aggattgccacgaactaagaaaggaagcgtgagttgttattctcttgatt
tgccttgtgtaaaatctgcgaatttttgcaaatctattttggtgaataaa
aaaagctttgaatgtaagttggtacgtatgcgaaaaccctcatggtttaa
cttgattggtttaatgaaatctttgttacacttcggcatgactaatcaaa
atcaagtttttaaacctggaatctattttggtattttttgttggaaaatc
aagcatcatctattgtgtacaaatactttctattgttttgatacttggtt
tttgaataaggtaacgaaatttgccaaatttgttttcaatttatattcgt
gccttaaacagtttctgtggttatacatgaagtttgagttgcatttgaca
aaggttaactcaacaacggagtttcgactacactatgcccccgatgagcg
aaggtttgtattaaatggaaaaggtaaaatcgacccttattcttctcatt
ataaaggtaagatgcttgaaacttttgaaacacctttgtactcctcggat
agtgacaaagatcatgttgatgatttaatttttgtaaaacacttagatcg
aaacatgcttgactgtcctattttatttattgatgatctatctgttttga
tggttgataaaaaaattattgtttttgataatttttatgatgcatgtgtg
agtgaatctatagccgtcaactaatgcatggtatgattgtgcaactctgt
gaaccgtgtgaaccttttcaaatacctacttgtgacgattacgtttacca
tttgatttattactcgcgatttattcatggtttgtggaaacaatttgaga
ggattgaatgctttaaaacatgtccatctttcaatgtggctgacttgtcc
ccatttgatttttcagattcgaggacgaatctttttgaggaaggggggaa
tgatacgagtcacagaggcccaacccaagttcttgaaggcaaggcccaat
aagaggattccaagcccaaccaagaagtcaaaccatacttagttgaaaat
caggccaaattgtcaaagtggcccaagttgtaaagttttatttttattta
tttatttatttattttttacttagtttaaatttttatgtaaatattcagt
ccaagagtcccaaataaaagacccttggccgaatttctatattaaaataa
ttaggagttttttttattttagttttctaattagattaggactagttata
aggcctatttaaaggcatggctggccaccttgtaaagaacttctcaatta
tatcaaaaatatcagatttgtttaagtgcggaattctctttgagtttttc
tccaagaattctctcttgagttttctttagaagttgttttaacaatcttt
tgattgtgggagccatcttcagccttcttcttgccattgatattctttgg
aggggagattagagccgtttgaaggaagttgtgagatctttcgggatttc
aaggcttcttaggacttatcttttaatttcttgctgtcaattctttcttt
atttctgcttgtgctgaatctttatctaatttattttctgtttttattgt
gttttcagcctttttctatcttaaggaatcagcccaaaaatccccaattt
ctagggttcttccatactctctttgggtgaaattagactgtcgaaatttg
gggaaaactatctcggtgttcaattgggcagaatcgtaatctcctttagg
gtttcaagaacccttattaacacttatttctattcacaatttgattcttt
actgttttggggattttatttcagatctggaaattcaaaattctaatctt
ttaattttctgtttcgtttcagatctgattgtttagggtttttcgtagga
gtttcccgtgacttggcaactcgatcttggtccacgcgcaaaccccgtat
caccctctatggctgattacatctatttataatgctagaacaaggtaacc
gaatggtcaaaaacatccacttaatgtgccataaaaaactgatgtctttt
cttattctttgaaccaaataactccttccataaaattactttaattcaac
tgatttgaatgtctttaatggcttagaaaaatgactcttgagttgtcctt
ggctagttgaatagtcaccatctcttaacctgctccttaatgacattcaa
aggcttgattaatttctcttgaaagctccaaaaacggctggaagtggaag
agttgctgctgaattttaaagggcataaaatgctctttaaaaactccttt
aatgatttttaagctccctttataacagcccctttaattgtaactcaaaa
gaacttgaacagccacttaattaaatgtgtaacagccttgaattgtaacc
actataagctaaaaagtcacctgcaataaacacattaaaatgagtttatt
aaacaaatgaaaacacttatttatcataacaaacattaaacttacttaaa
taaatgaactaaaacatatatgcaataattattccagcaactagtttaat
taaagaagcataatttaaaaaacttaatttatgcatcaataaataatcct
aggaactagatcaattaagaacaacacttattaaataaagttcaacaaaa
acacttattaattaaaactaagatgagttgaataaatgtccagcaactca
tttattaaactaagatgctaaaatgcatggttttgaaatgcaaatttaac
taacatgaaagtgacataattaaactaacttgacttaatttaatgatgca
aacttaactaacatgaaagttacataatgcatgactttattaaatgcaga
acacatattaatgatgtgcaaactataacataattaaaaacacaaactaa
aataactaaaaattaatgaatcaaagtccttttttttccagcagccaaat
tgacaaactaaaattaaaaacttcattttgcacttgggcccttcgagttt
ggaccaatctcggtagcatcgagttgtgtcgtaacatgatgcgacccgat
cgcatcaaaacctatcttttctatctctatctattaaaaattcttttgtt
tcaagccaactttgttcgtttgcaaccctttcaagtactaagtccatact
tcttaattttatgaccgggaacacaagcggcttgatttgcccaacgagta
gaagatcgcatcatgtcctattttgtacaacattaatacatgtcctagga
atcttcaagggaattatttttctattcaatagacattcagctcaattaag
ctgattaaaacatatccatttggttggaccttgtacaacctataaatact
aggcttaaatgatgtagaaagaacttttgaacctttgatgaattttataa
ttattgtaagtgttcaactctcgttattctctcttgactcaaattgactt
atcaagtttatcttgtggcgtcaatctgattcttcttgaacttatcacat
ctttgaagtgtggcgttcaacgtatacctattggttcctatcttttatag
atagtgggtcatggttaatctatcaacttcatttttcaacttaaagagct
actacaagaattgggtcaatattaccatataatattggttctttctttag
ccttaagccaaacctatctttgccatctctatccactaaaaatccctttg
tttcaagccaactttgtttgtttacaactcttccatgaactaagcccata
cttcttaattttacgaccgggaagacaagcggctcgactcacccaacgag
tacgagattgcatcaccatcatcacctctttaaacttttttgatctagca
cgtgttataaacctgatgagaatttcaattggatcctctcttaaaatggg
caactttgagtttggtccacttaatgaactcgaatacacatcaattgttc
ctgtgcatttatcaacaaggaaactaaatccaaattgaattgtttgaagg
agttaaagccgattagagacacactttgatgtgattctacataccaaggt
tgaatcaattcttgtcaaggtgaaacaagttgatattgggttgaatttct
atgagccacatctcttgagatggtcgaaataaagactgatcctttgtgta
taccaattaggccaactatgggggctcgaaccaagtgggtcaaagaagag
tttaaagtgcctatgtgtaggagttgggaacaagtttgaattaatcaagt
tctggttgggccaagacgaagtcaagtatcgatcaaaaagttgagggaaa
ccttcaatgggtttgattaattatgggacaattttaaaagactttaatta
agtttattttagtttatgtttgcatatttcaattactatcttgcattatt
aatctggatctttaaattatgacttgcatcatgtgttatgcttttaatta
tgccatgcattacataactcgtatgcttataaagtttgtgttttaaaatt
aagttatgcattatgtaactcatttgttcatttagttttcatcttaatta
caccatgcatttaagcatgttacttgttaattatgtttaagcatgagtta
gtttcataagtgtgtgaagtgtgtcattcattttggctgttactttttaa
tggagaagttataatgtatttatttccattataaatagggttttttaagt
tgaataataatttgaacagattgaaaatgtttaaatattcatttcttctt
gtttaggtgactattcaaaggaccaaggaaggctcttcaaattctgtttt
atttttggtgcacttaaagcttnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnngggaagaatcagcttgaattcgttatgt
tgtagccgacgccctatcacaaaggtacgcacttgtcaatttaatggatt
ctaaattgcttggttttgaatttatcaaagatctttataaatccgatgct
gactttggtgaaatttatgagtcttgttcgcatggtgcttgtgaaaagta
ctttcagcatgagggctatttatttcgtgaaggcaagctttgtgtgcctc
aaagttctgtgagaaacgtccttgtagaagaagctcatagcggaggactt
atgggccacttcggaattgctaaaactttagcaatattgcatgaacattt
ctattggcccaaaatgaaacgtgacgtaataaggaaatgtgatcgttgca
tcacttgtaagaaggcaaagtcacgaatcaaaccgcatggtttatacacc
ccgttgcctattcctgatgctccgtgggtagacatttcaatggacttcgt
tctgggccttccaagaaccaaaagagggagagattcaatatttgttgttg
tagaccgtttttcaaaaatgacccattttataccttgtaataaaactgat
gatgctactaacgttgctaatctgtttttcaaggaagttgttaggttgca
tggaatccctcgaaccattgtctccgatcgcgacacaaagtttctaagtc
atttttggaggacgttgtgggggaaattgggcaccaaacttctattttcg
acgacatgccaccctcaaacggatggccaaaccgaagtagtcaaccgtgt
attatcaacactgcttcgagctattttgaaaaagaatttgaagatgtggg
aagattgcttacctcatgtggagttcgcatacaatcgaaccgttcattct
gctacgaaattttctccttttgaggtagtatacggttttaaccccattac
tcctcttgatttgattcctatgccttctaatgaattagtacatgtagatg
gcaaaaagaaggccgaatttgttaaacaattgcacaaaaatgttaaggat
aatattgagaggagaaccgaacaatatgttcgaggggcaaataaagggcg
caaacgagtcgtgttcgaacccggtgactgggtttggatccacatgcgca
aagaacggtttcccgatcaaaggaaatccaagcttcaatcaaggggtgat
ggcccttttcaagtattggaacggatcaatgacaacgtctacaagattga
cctaccgggtgagtatggagtgagtgcaagttttaacgttgctgatcttt
ctccttttgatgtaggtgacgattcgaggacgaatcgcttcgaagagagg
gaggatgatatgagctcgcccatgaagataggtgccgaatccatggagtt
gcctttggggccaattactcgagcacgtgccaagaagttccaagatgctg
tagcaagctatattgctcgattgtggagtgatgggttgattgcccataaa
atgcccagctcaactagcttgattcgcaccatcctacaagctgattttag
ctcgtgtcagcttaattcagctcaattcggcacttaattagttcaaggag
ctgattatatttattttgaataaatttaattagtggtgttagttagaatc
agctcaaaatcatttaattaaataaatgtgtcttaatctggacattctta
attcagcttattaaatatgttttatattaatacatgcctttaatatgtcc
atattaagtcataaattaaatgtgtttagtttaattacaaagttttaatg
tgtcttgacttagacaaatttattagtggctgctagttaatttgtcttag
ttaaattaatgtgcagatttttaatatgtccagctgatgatttcatgagt
aataaacttgtcttaaccacatttatttgatgtttttcagctagcttaat
ggcaaaggaagctcataaagaaggagcatgtatttgggcacatgcatgga
cggcatttaaagtgcagctaccttgtgtttccagctgatttttttttgtg
tagctcaatggacttcaagttgatattttgagcttctccaagggtcaatt
tcgtggagagcaatggccaaaaggtgcttcataaattccagcaactaatt
cacttggtggctactcatattcggccaaagaagcataattcttgaagctg
tccatttctcttctccatagcagcaattaagctattttaaaacattagtt
gaatgtgaattatcatccttaaaggggccagccgaatcatctcttctaga
aggttattattcagattttttttgttgtttatgaatgcatctaggaaatt
gctaggaagtttcctaaagaagcttaaggcttaagaatctgattagacta
ttcggctaccttagtccatcctataaataggccatgtaattcacattttg
gaggttaatgaacaatttgatagctttgctaaattgagaggttgttttca
actctcgttattctccaaaaactcgtgagacttatcaaacttctttgtgg
cgtcaaacttgtttttgtttctacccgaacttatcactttaatcccaaaa
gtgtggcgttcaattcatactaaggttcctatcattttttgatagcgggt
cgaagtttttatccattcaaccaactatccatccacaccttaccaaccta
agcattctcctaagttacgggttaacacattcctattgtgttagttcggc
tttcgaatccttagccaaattgcttccattgttttctgattcatttccta
aaccaacaaactcttttgagcctaaataaacctctttcttctagcctatt
ttgtaaagcctcaatttactcctaattcacgatcgggcaatctttacgac
tcaattcgatctcaaggtgagggcgtatcaaatcgttcgttaacggattc
taactcacctcagatcatgcgttggatttctcgtaacaaggcttgttgag
ccaaatccagcactccacctcctccaggcgcaatgtttcggattggttgc
cttccacctccttctgccttatttcgttcaggactttgagacatgaaaat
aaaaaacctcacaacaaaacctcacgaatctctcaaaaagaaagaataac
actccactcgtgtttcactcaaatttttttggctttttcttttgatgtag
ctctcatgcctttttccactcaatttcctctcgtgatttcgtaagcgact
cgtcgtgaccttatcgtagttcaatgggtcggcttcaaatggctttacaa
ggatttgatgttagattacgggtaggctaaaagaaacaagaaaggcttta
ggctaagtgtggcttagaagatgaatagaagagaatgccaaacttacaaa
ctcgaaacactttttttttatatcgaatttttttttcaattgcgtgaaat
ttcactacgggggatataaaagagtgtagaatgagattttggaaaaattt
ctattgaagtgtctccagactctttttttttacggatctttcaagttctt
ttcgtccgcacctaaaccgtatacaatttttttctttcaaattttttttc
tttcaaatttttttttcaaatttttttttcgaacttttttttacgtacct
atttcaaaatgtcttcaaatgctcgtacttctcattttaaccagctctga
taccaaatgatacgatctcggtttagtagttgagtccgagtcgtttggtt
cccgatcgtaaacgaagaagtagattcgacgaaaaggagttagaatatat
ttgtgtacaaagaagtaagataagtttgtgcaaagttggatgtggatttg
gtttaagtcgaaatggtatgaatagaatggaagagttcggtttaagataa
ttaagaaatggtatttggttttggtacgttttggtatttgagaattggta
cgaaatggtatggaattggtatgaaatggtatggtatttggtacgaattg
gtaatggttcaaagaggtcaagaatgaaccaacactaaagaaaagtgtcg
acccgaaacttataggacctaaatgaattggaaatggttgaaaaggacct
tgacccgatacttaggaaagtatgaaccaaaggtatcaaaggtgaacgcc
acactcgggtttaaggagtgataagttcggaaaagactcgaaaagatgcc
actaaaagcttagataagtcttacgggtctcgaacaaaatttgagagaaa
atgtctcacaattttggcagcaattcgctaaaataaaaatgtcaaaagtc
ctttacaaagtaaaatttcagctatttataagcaacacctaagcaagccg
aatggtcacttacattccttaaaaattaagcaaatgaatcacttaaatga
actagctagattcggctgaacatggagctccattagacaccttctagatg
aagcattagacttagaaaaacttggatgatgcatggatagctaggttcgg
ccaatgggcataaattagctcatttatgttgtaacttttggctgaaaggt
gaccagcaattaaaaggataatgagcagccaattcaagtgtgaaagctca
acgttgaagagtcatggagtgtgaacacatggaatcgaaaagccaagatg
catccagcaaatgtgaaaggaattaatgggcagctttggagttggaaaca
ttagctcccttggccgaatagtcacctaggaatgttgaattcagctcacc
aatttgatgcatgtatctccaggtgcaatgtatctaacatgcatgcacct
tgctaaaatgaatcttcaaattcggctaaccttgttaaatgatcccacac
attcggccaacctatataaataagaagaactaaaattaatatgatattta
gctgaacaaaattaatattaaaaccatgaaacattaattcggtcaactat
atcactaaaatcagctcattaaattcggcagctttaaagcaacttaaaat
catgtaataaaacttgacatattaaaaacatgcaacaaacatattaataa
gctgtaataaactaattaaatcgacttaaataaatattcagctattaaat
taatgtctagttgatattaagctgaattgaaaaggtttgagctgaagttg
agctaatttgagctcattgagctgaaatggaagttaattcagctcgtatt
aaagtgcacggattacttttcgagttggtccaagcttccttgatgtgacc
aaccaagatctcgccccaaactttgtcaactaaagctgaaacagcctcct
tgaattgtttagctcgtgatcgggtgatgggaccttggggcaactccaac
gactccttgttcgagctaggtaggacttgaggcgtggccgtatcataggg
tgagatttcttgctggcctcaatcgagaaattgctaatgtcatcgaattg
caacattatgtagacgttaacatggtgcacatggcgatcaaggtggaaaa
gcaactaaaaagaaaaggcgccacccgaccctatccttactctatttcca
taccaaggtgggtacaagaagccaacaagaaggaagccccctataaaaac
tagcaaggccatggaaactttttacttggctaatgcttgttggtcgtggc
cactcttgaaattgcctttacattttcttggtcgacttcaagacctttcg
aactaaccacaaatcctaggaaaataagtttgttgatacaaaatgaacac
tttttaagattaggaaacaaagtttcctttcacaacacttccaaaacaga
tttcaaatgatgaatatgatcttccaaagacttactataaaccaagatat
catcaaaataaaccacacaaaatttaccaataaaagatcaaaagatatga
ttcatcaaactctgcttgatgactaatatttctccctccatagcatactc
caattcttcctcttcatcggtaggtgcatcaggctcatcttcttattcta
tttcagattcaatctcaccattgtccctaagaatcatcatgctctggttg
ggacattagctagcaatatggcccctcccaaggtatttgaagcacttgat
gtctcaggttctatttggcacaacctcatttttgcctttgcttgattctc
cattcggcttgctcggctttatggctccaacgttttctttggttcgaaag
ggggcttccttcttgttggcttcttgtacccaccttggtatggaaataga
gtaaggatagggtcgggtggcgccttttctttttagttgcttttccacct
tgatcgccatgtgcaccatgtcaacgtttacataatgttgcaattcgatg
acattggcaatttctcgattgaggctagcaagaaatctcaccctagtagc
ctcccgatcttcctccacgttggctcgaatcatggctattttcatctctt
tgtagtaatcttccacgctccagtttccttgggtgaggtattgtaatttt
tggtacaactcttgatggtaataggccaggatgaatctcttcctcatgat
agtcttcatttcagcccatgtagacacaggtcgttcaccatttcttttct
ggctcatggtgagttgattcccccaaataatggcgtagtccagaaattta
atggcagcaagcttggcccttttgctttctgagtagttatgacactcgaa
aatgagtttaattttcttttcccattttaaataagctttgattttccctt
agaatggaggaattgccgtctcaatatttttaaggttgtcatccacttgg
tttcgttctcttggccctcggttcctttggccttatcacccctcactatg
aattgaggtttgatcactctccatgtcactaggctcataaagaacatcca
gatttagcctaggatggcctcgttccctccttggattttgaagcattcat
tcccgttgggctcattcttccaatttgtccaatttatcttacatttgttc
taatcattgttgtaacattctatccatctctcatatgagggcttggtatg
cttagtcgggactttgagccatgtagtttccttaccacaaacatcacaat
cctctcaaaaagaaagaaaaatatgctctccactcgtgtttgtactcgtt
cttggcttttatacctctaatgctctcacacactctttgatacgaacttg
tccaagggctcaactaaattcattcgtgatccaatcgagctacccgctgg
tccaattactcaagctcgagccaagtagttcaaaaaggcaatttcggtct
tagttgaatgagtttgggaggaagcttcaactagactcattaatcatgtt
tgggatggctcatcaagtgccctttgcaatttacttcaagccgaattcaa
cttagctagctaactgagctgctgaataagacttagacgtttttagttat
ttcaattatattaattatgttttgatttcatataacattattacatgtct
aattattttagttaagtctattaattgtgtcctactttgtacaacattat
tacatgtctgattgtttagttgttctaagtttattaatggtgtcttagtt
tgtaccgcattaatacttgtctaagtcagattttttaattgtgtcttagc
ttattacacatttaatttgtgtttttagtttgtcttattgaagcctttaa
accaaatttaaattgtcttgtaggttatttaatagacggctggacataca
tgcaccatttccagattcattggactcattggacattccacctgattctt
catgcattttgatactgatgaatacattcttctaggtgtccattcgtgaa
aggatgaataaacattgaacttaactttgagctgatcagccaaccattca
gtttttcatgttcacacccaagcatccattcaaatccaagttttcacacc
catgactgttcggcaccacaagaaacattcatttgctgttcatgcattcg
gtgcattaagaaaccattaaatttaggtcttgaacacattgaccgatcaa
gttaaatgcttccttcagctcaatcattaagtctgctacaatggctgacc
gagaacttgaagtgtcaacttgatacgaccccgtcctcgttgatgaatcc
gagttgttttcgttgcccgatcaccttaacgatgaagtttcgttcgtctt
gattcaaagagttatatttgttcaatgaaggtgtttatggttcatttaag
gttaaaaggaaatggttggtaagatatttcgactaagaaagaaagaaaac
aaatattaaaggtatggaattttcggtttaaggtgaaatggaaacggatg
taataggacctcgacccactatctataaaagataggaacctcggtatcaa
atgaacgccacactttgggtgaaagtgataagttcgggatgcaaagaaca
aaggttgacgccactaactagtagataagccaactaagtctttggacgaa
attgagagaagaatttctcacaaaatacttaattcaataatcaaaatggc
aaaagtccctttacaagaaattcagcaactatttatagcttgagtgacta
gtagccgaatagacaagttcaagacttaatatctaagcaaacattgaaat
aaattcagcttaaatccatgtatattggccaatgtagattcggctgaatg
gtgaccaaaattaaagcttccaaattgatcaaatgaatttcggagattca
tgtagcagccaagttcacctaatgagtttaattgactcattcattaggca
actcttgatgaaaaacgaccagcattaaaagagaacttgagcagcctttt
tggggtgtgaatggacggttttgaagagtccccatggtgtgaacatggct
gaaccgaacagccatggtgtgaacagcctttatgctcccttgagaagaga
atcggccaagcttggagggatgaacaacttggacacttttggccgaatag
ttgccttgaaaaacactaaaattaatcaactttaatgcattaaaccagct
gcacatgcaccttcacatacattgaatctacatgcatgaatctgcccaat
gtatcttcaaattcgggtgcacctacataacacaaatgaacttaattaaa
aacataatgtgaacatcctaattaacattgtgacaactagaatattaata
aacatgacacataaattcggctggacaaatttattgcatgtataaattta
gacaaactaaataaaatcaagacatctttaatttaactagatcaagacaa
attaattaactcaacttattaatgccgaaaataataagacacattaaatg
acttaaagacacaattaacacctagttaaatagttaattagcttaaacta
aattaactaaaatttattccagcaaaataaaatgcaaaactaaagaaaac
taaaatgagtttattgatctagttcgagctcattgagcttgtaaagagct
ggaaacgagctaaatgaagctccgcaaaataaaattgagctacttccagc
ttgcaaacacgacgagccttgcttgtaggctgaaacaatagccgttcccg
ggggcgggtcatatcacaactttcaagtctgttcgggaactccaatggac
aagctgatcactaagccactctaagaattgttcagctgaattaagtcaag
tccagctttatttaagttgtaattacttagtgtctattcggctggaaatc
aagcagcctataaatagtttgcttgtaacttgttttaaaaaaaattttaa
actttgaatgaattatagcttatttgtgagttgttcaactctcgttgttc
ttggtcatttaaattgacttatctagcttgctagtggcgtcaatccgttt
cctttcggaacttatcactctttgaatgtagcgttcaatcccattgacac
cgattggttcctatcttcttagatagagggtcacggtccttttaccatct
atccatctatcaccttgatagccttataagattcgggtctctattcttta
atagaggttctttcttccgctattaagttcacattccatcatccatcaac
ttatctttaaaccattttatttgttttaaaattatcaacctttaaaacgt
ctatttttttaaacaaaaaaactagttacttaattttatgatcgagcagc
aaatgactcaaattcgataaaaatacaagttcatatcatttggtatcaga
gctagtcaaaattaagtatgtattttcattttcttactctcgagaaaaag
aatatataaaaaatcaatatataaaaaagttggtgtataaaaacaagtgt
tgtgcatacaaaattacaaattgcaaaaggggagtttcggttttgtgcca
tttcaaacaagaaaagctagcttgagaagttatttcccgattttaactca
tttcttcttaaaaacattttccagccacattccttgtttttttttttcaa
acctaccatacctaacagtaatccttttcttgttacccttttgaagccga
cctacatgccttgctaataggtttaaggtagttactaagaactctgagaa
atgaacgtgagaggcaaaaggcaagagaggagagttcatcaaagaggtaa
aagccaaaatctgagggaaacacgagtgaagagctcaactttgttttctt
tacgagagatttggtgaggatttgaagtgaggttttaaacaaattgacaa
agagccctgaacagaatactgttaaagagccctgaacagaatactgttaa
tggcaaagtgctagtcatcaaacgaagcctaaaccttcaaagcgtgaaga
acgagcagcaaagagagaatatctttcacactcgcttccatgtgcaacgt
aaagtttgtagtgttataattgatggtgagagttgcacaaatgtggccag
cacaatgatggtgaaaaagcatagtttacccactaccaagcatctgcacc
cctacaagttgcgatggctcaatgatggaggtgaactaaaggtgagtaaa
caagtgctctttgccttttctattcgcaaatactaatacgaggttgtatg
cgacgtggtacctatgcacaccggacatctactactaggaagaccatggc
aatttgacagaaggataattcactacagatacaccaatcgttacacattt
aaacatttgggaaacactgtaactttagcccctcttactccaaaataagt
attggaaggtcaacttaagttgaaagcttctattggaaatgcaagagtga
gtgatcaagaaaagaaaaatgaaaaagaaagataaatgaactcagaaaga
aagagaggaaaaaagagtttcaaataagggagaaaaaagaaaaagagttg
cagaaacaagaagaaaaagagagaaaaagagagagtgaatctgagaaggg
aaatttctttgtgaaacaaaaggagatccggaaatctttcttgttgaaac
agcctttgcttttacttatgtacaaagagagcttgatgggaactaacgag
cttaatgaaaacctaccttcttctgttttgtctttgttacaggaatttac
cgatgtctttccggaagaaatcccaaatggtttgccaccaatatggggga
ttgagcatcaaatagattttgtgctcggagttgccattacaaatagacct
gcctaccgaaagaaaccctgaggagactaaagagcttcaaaggtaagtgt
ctgagttgctagaaaagggctatgtgctcgagagcatatgtccctgtgtt
gttcctattcttttggttcccaagaaagatagatcgtggcgcatgtgcat
ggattgccgagccattaataaaattactatcaagtatcatcatcctattc
cgcatttggacgatatgttagatgagctgagtggagtttagctattctct
aagatcgatcttaaaagtggcaccattagattcggatgtgagagggagac
gaatggaaaacaacattcaagactaagcatggattgtacaaatagctggt
tatgccatttgggctaactaatgcccccagtactttcataagccttatga
accatatccttcgttcgcttattaatagattctgtgtagtttactttgat
gatatcttagtttatagtaaatcattggaagaacatgtgaaacatttaaa
agctgttttgaagttttgcgtaaagagactttatttgcgaattttaagaa
atgttcattctgtactaacaatgttttttttcttaggttttgttgtcagt
tgtgaaggttttgaggtcgatcaagacaaggtgaaagcaatacacgagtg
gccccgacggacaagtatttctcaagtaaggagcttccatggcatagcca
gcttttataggagatttgtgcctaatttcagcacatcggttgctcctttg
acctgggtaaattgaatcaactgcaactttcattggggtgataagcaaga
aaaagcttttatgaaaattaaaaattgtctaaccaatgcttctttgttat
ctttacctgactttaacaagactttcaagttagagtgtgatgcttcaagg
ataggaatcggaccggtgctaacacaagacgaacatcctattgcatactt
cagtgagaaactcaatggtgctaccctaattatccaacatacgataagga
attgtatgctttgattcgggccctagaaacttgacagcactatttgtggc
ccaaggagtttgtgattcacaccgaccacaaagctttgaagcatcttaag
ggacaaaaaaagcttaataaaaggcatgctaagtgggtcgagtaccttta
ttattttccttatgtcatcaaatacaagaaaattaaggaaaatatagttg
ccgatgcattatcaagaaggtatgctttacataatagtttagattctaaa
cttcttgggtttgcatatattaaagaactctatgattctgatgctgattt
tggtgaattattcaaagcttgtgagaagggagcatttgaaaaattttata
ggcatgaaggctatttgattcgagaaggcaaactatgcatccctcaagga
tctgtctgagatatcctggtgaacgaggcacgtagtagaggtttaatggg
tcattttgaaatgaccaaaaccatggccatattcaagaacacttcttttg
gccaaagatgaagcgagatgtggaacgactttgtgagtgatgcattacct
ataggaaggctaagtcccgcatcaagcctcatggtttgtataagcctcta
cctattcccgaaacaccttgggctaacatttctatcaattttgtgttagg
acttcctaggactaggaatggaaaagattatatctttgttgtagttgatc
cattttctaaaatggctcgttttattgcttaccataagactgatgatact
gtgaatgtagctaatctatttttcagggaagtagtacagttgcatggcat
gccaagaatgattgtgtccgatcgagacgctaaatttcttagccattttt
ggagaactttgtaaggaaggcttggcaccaagtttctattttctacataa
tgccactcccaaacagatggctaaatcgaagtagtaaatcaaattctatc
cacattgttaagagccatcctttgaaagaatttgaagtcatgggaagagc
atttacctaataacgagtttgcttacaatcgctcaattcacctagccaca
aaacactctccatttcaaattgtatacaattttaacccattgactcctct
tgatttaattcctttgtcttctaaccagtttgtgcatgtagatggtaagc
aaaaagctggatatgtgaaacaattacatcgaaagttgaggaaaacattg
aaaagaaaatcgagaagtaggtgcatagagccaacaaggggcaaaagcga
gtattttttagcctggagactgggtctgaactcacatgtgcaaagagagg
ttccctgcgcaaaaatccaggttacttcctagaggagatggcccgttcca
agtattggaacgaatcaatgataactcgtataaattggacctactaggag
tgatacgccctcacctcgagatcgaattgagtcgtaaagattgcccgatc
gtgaattaggagtaaattgaggctttacaaaataggctagaagaaagagg
tttatttaggctcaaaagagtttgttggtttaggaaatgaatcagaaaac
aatggaagcaatttggctaaggattcgaaagccgaactaacacaatagga
atgtgttaacccgtaacttaggagaatgcttaggttggtaaggtgtggat
ggatagttggttgaatggataaaaacttcgacccgctatcaaaaaatgat
aggaaccctagtatgaatcgaacgccacacttttgggattaaagtgataa
gttcgggtagaaacaaaaacaagtttgacgccacaaagaagtttgataag
tctcacaagtttttggagaataacgagagttgaaaacaacctcacaattt
agcaaagctatcaaattgttcattaacctccaaaatgtgaattacatggc
ctatttataggatggactaaggtagccgaatagtctaatcagattcttaa
gccttaagcttctttaggaaacttcctagcaatttcctagatgcattcat
aaacaacaaaaaaaatctgaataataaccttctagaagagatgattcagc
tggcccctttaaggatgataattcacattcaactaatgttttaaaatagc
ttaattgctgctatggagaagagaaatggacagcttcaagaattatgctt
ctttggccgaatatgagtagccaccaagtgaattagttgctggaatttat
gaagcaccttttggccattgctctccacgaaattgacccttggagaagct
caaaatatcagcttgaagtccattgagctacacaaaaaaaaatcagctgg
aaacacaaggtagctgcactttaaatgccgtccatgcatgtgcccaaata
catgctccttctttatgagcttcctttgccattaagctagctgaaaaaca
tcaaataaatgtggttaagacaagtttaatactcatgaaatcatcagctg
gacatattaaaaatctgcacattaatttaactaagacaaattaactagca
gccactaataaatttgtctaagtcaagacacattaaaactttgtaattaa
actaaacacatttaatttatgacttaatatggacatattaaaggcatgta
ttaatataaaacatatttaataagctgaattaagaatgtccaaattaaga
cacatttatttaattaaatgattttgagctgattctaactaacacaacta
attaaatttattcaaaataaatataatcagctccttgaactaattaagtg
ccgaattgagctgaattaagctgaaacgagctaaaatcagcttgtaggat
ggtgcgaatcaagctagttgagctgggcattttatgggcaatcaacccat
cactccacaatcgagcaatatagcttgctacagaatcttggaacttcttg
gcacgtgctcgagtaattggccccaaaggcaactccatggattcggcacc
tatcttcatgggcgagctcatatcatcctccctctcttcgaagcgattcg
tcctcgaatcgtcacctacatcaaaaggagaaagatcagcaacgttaaaa
cttgcactcactccatactcacccggtaggtcaatcttgtagacgttgtc
attgatccgttccaatacttgaaaagggccatcaccccttgattgaagct
tggatttcctttgatcgggaaaccgttctttgcgaatgtggatccaaacc
cagtcaccgggttcgaacacgactcgtttgcgccctttatttgcccctcg
aacatattgttcggttctcctctcaatattatccttaacatttttgtgca
attgtttaacaaattcggccttctttttgccatatacatgtactaattca
ttagaaggcataggaatcaaatcaagaggagtaatagggttaaaaccgta
tactacctcaaaaggagaaaatttcgtagcagaatgaatggttcgattgt
atgcgaactccacatgaggtaagcaatcttcccacatcttcaaattcttt
ttcaaaatagctcgaagcaatgttgataacacacggttgactacttcagt
ttggccatccgtttgagggtggcatgtcgtcgaaaatagaagtttggtgc
ccaatttcccccacaacgtcctccaaaaatgacttagaaactttgtgtca
cgatcggagacaatggttcgagggattccatgcaacctaacaacttcctt
gaaaaacagattagcaacgttagtagcatcatcagttttattacaaggta
taaaatgggccatttttgaaaaatggtctacaacaacaaatattgaatct
ctccctcttttggttcttggaaggcccagaacgaagtccattgaaatgtc
tacccacggagcatcaggaataggcaacggggtgtataaaccatgcggtt
tgattcgtgactttgccttcttacaagtgatgcaacgatcacatttcctt
attacgtcacgtttcattttgggccaatagaaatgttcatgcaatattgc
taaagttttagcaattccgaagtggcccataagtcctccgctatgagctt
cttctacaaggacgtttctcacagaactttgaggcacacaaagcttgcct
tcacgaaataaatagccctcatgctgaaagtacttttcacaagcaccatg
cgaacaagactcataaatttcaccaaagtcagcatcggatttataaagat
ctttgataaattcaaaaccaagcaatttagaatccattaaattgacaagt
gcgtacctttgtgatagggcgtcggctacaacattttctgatacagccac
gcgtcaagtccaacctagctcgagcaaggagcctttggagctgcctcaag
gtccaatcatccgatcacgagctaaacaattcaaggaggctgtttcggcc
ttagtagatcaagtttggggcgagactttggttggacgcattgatgaagc
ttggacaaactcgatgagccttccttgcactttgttacgagctgaattaa
gctccacttcagctcattaaattcgaaccagctcaaaattagctcaaaat
aacttagtcaataatatagtagctgaaataattaattgagttagttaaat
tagttatttacaagcttaattaatttttgttattaaattggtcttaaatc
tggtcaaacttaattatgcatgatattttagttattatgacatgttatta
attttgtcttaatttatacagcttataaatatgtttttaagcttgttttt
aatatgttaactttattacttgttttaattatgtcctaaggctgccgaat
ttaatgtgcagcattttagtgttaatttaatgtgtctaaacatgaatttg
aattatttgatgaatgttgctacaggtacatcatccatgaatttttttgg
agcatgaaaggtattaaaagagggtacatgaaggggacggcacatgcatg
aatgggagaatgaagttggctgctgtttgaagtctcctaagtgaccattc
agccgaatttattacttacacactgttgaatacatcatggctgttcggat
caaggtgttcacattcaaagactcttcaaaacttggttttcacactcaaa
gtgactactcaacatcttcttaattgctggtaatttttcagcaatagttg
ccaattaaatgagctcctttaagcacatcaaccgaatgtagctgctgcca
tttactccctcaagctccaagttcaattgtccatctagaaggtgaccatt
ggagctccaagttcagccgaatctagctagcccatttaagtaattcattt
gcttaatttttaaggaatttaagtgaccattcggctagcctagtggatta
ttataaatagctaaattttcactttgtaagggactttttgacattttaat
tagcgaattgctgccaaatttgtgaggcattttctctcaaattttgttcg
agacccgtaagacttatctaagcttttagtggcgtctttccaagtctttt
ccgaacttatcactccttaaacccgagtgtggcgttcacctttgatacct
ttggttcatactttcctaagtatcgggtcaaggtccttttcaaccatttt
caattcatttaggtcctataagtttcgggtcaacactcttccttagtgtt
ggttcactcttgacctttttgaaccattaacatttcgtaccaaatcgtat
taccatttcgaaccaaatcaccttaccaattcgtaccaaatcgtattacc
attttgaaccaaatcacattaccatttcgtaacaaacccaaaaccgaact
cgaccaaattcaaatcaattctttctcatctaaaccaaaaaccataccaa
ctttgttcatccgacttgctttctttgaacccaatttctctttactttct
cttgaatcgatttattcaaaatacttcttcgtttacgatcgggaactaaa
cgactcagattcaactactaaaccaagatcgtatcatttggtatcagagc
tggtaaaaacgagaagtacgagcactcgaagtcaatttgaaataggtacg
taaaaaaaagagttcgaaaaaaaaattcaaaatcgaaaaaaaaatcaaaa
aaaattgaaaaggaaaaaattgcatacggtctaggtgcggacgaaaagaa
cgtgaaagattcgtaaaaaaaaaaaagagtctggagacacttcaacaaaa
aatttttcaaaatcacattctacacccttttatatccttcttagtgaaat
ttcactctattaaaaaaaagttttagtgtttcgagtttgtaagttcgata
cctatttctactcatcttcttttcttctacgccacacttatcctaaaagc
ctttcttatttcttttagcctacccataacctaacatcgatcctttgtta
aaccttttgaagccgacccactggactaagactaagtcactacgagtcgc
ttacgaaatcacgagaggaaagtgagtggtaaaaggcacgagagttacat
caagttaaaagtcgaaattgagtgaaacacgagtggagtgtttattcttg
ttgtgagagattttgtgaggtttttgctgtgaggtttttatttacatgtc
tcaaagtcctgaacgaaatatggcgaaaggaggtggaaggcaaccaatcc
gaaacattacgcctggaggaggtggagtgccggatttggctcaacaagcc
ttgttacgagaaatccaacgcatgatccgaggtgagttagaatctgttaa
tgaacgattggatcgagttgaattggggaatcaacgagagcgtacacccc
aagggccgcaaagagggcgagaccaattggaaatcaatcaagacgaccta
tatgatccgaatgaagccgaaagtgatcaaggatcaaacataagtgaagg
acgaagaggtcaaaggaaccgaggtaatcggaatcaaagacgcatggatg
acgacttaaggaacattaaactatccattccatcctttcaaggaaaatct
gatccggaagcctacttggaatgggagaagaagattgaattggttttcga
ttgtcataattattctgagattaaaaaggttaagttggctgctatagagt
tttctgattatgctatgatatggtgggatcaactcactacgagccgaaga
aggaatggagaacggccaatatccacttgggccgagatgaaggccgtgat
gcgacgtcattttattccctcttattaccatcgggagctctatcaaaagc
ttcaaaacctcactcaaggttcaaggagtgttgaggattatttcaaagag
atggaaatcgcaatgatccgtgctgacgtccaagaagatcgtgaagcaac
gatggcgcgtttccttgctggtctcaatcgcgacattgccaacgttgtgg
aattgcaacattacgtagagatcgtggacatggtacatatggccattaag
gtggagaagcaactcaaaacgaaagagtaccacgcaaagttatcccacta
cgagcacaacgagatgggggcaaagcatgagtaagaataatccaccaagt
cgtgccaaagagccaatggtgcctgccaaagcaaacaaacccatgggcga
cacgagcaaaggtaaggccaccgattcatttgctaatcgttcaagggata
ttaagtgttttaagtgccttggaaggggccatattacgagtcaatgtccc
aaccgcaacgtcatggtggttcgagcaaatggagaaatcgaatcggagga
agaagagcttgaagatgagcctgaaaccgtctctgacaatgaagaagaag
tggagcacgcccttgatggggaactcttagtcgtcaaaaggagcctaagt
atccaaagcatcgacgatgaacaacaacgagagaacatcttccatactcg
ttgtcaagtacaaggaaagctatgtagtgtcatcatcgatggaggaagtt
gtacgaacgtagcgagcactctcatggtggaaaaattaaatctaccgacc
accaagcatccaactccgtacaaacttcaatggctcaatgatggaggaga
gttaaaagtgacaaagcaagttctagtctccttttccattgggaaatatt
ccgatgaagtgctatgcgatgtcgttccaatgcacgcgggtcacttgtta
ttgggccgtccatggcaattcgatcgtcgagttatgcacgatggttactc
aaatcgatattctttcaagcatctggggagaaatgtaaccttagcaccat
tgacgccaaagcaagtttatgaggatcaacttaagttgaaaaattctgta
gatcaaatgagagaaaaagaaaagagcgaaaatacaaaagaaaagaaaaa
tgaaaaaaagaaagaaaattcaaaaaaagagaatgaaaagagagcgagaa
aagaaaaagatgaaaaagaaaaagtgagtgaaaaattgaatgtctttgca
aaagcaagtgatgttcgaaaagtgtttttggcaagacaatcgatccttat
acttatgtataaggaaaatttgtttaatactaacgacttatccggagatc
ccccttcttctgttttgtctctcttgcaggatttcaaagacgtttttccg
gatgaactgccaagtggtttgccaccacttcgtgggattgagcaccaaat
caattttgtgcccggagctgttattcctaatcggccagtgatacgatgta
gcctaacgaaacagactatcttcgtatgttacggatctaggaatgttgta
agcacgttcctgcaacaagaaaacaacaaggaattaaagaaataatcatg
gtaaaatatgggtaaaataaaagaacgaaaatggaaggaaaatgaagttg
ttggcgtttaaaacaaaaagaaattcaatcggtgaagtcgaacgcttcat
gaaacggccaaggcagcaacttgagtgttcaacaatggcaaaggtaatcg
ttggaatagattaacgttaaactcgaaagaacttgcacaatctactgagc
aaacccgaatcgaatctattcaacgtcaaaaggacttggaccctctagat
agcgatctaggaacccgaagtatcaagaaaatttgacacaacaaactaag
tctgaaatgccaaggaaagttcaatgaagaaccgaaattgaaagaaattc
tcaaacgtaattgttttcataaatcatctaacctgaatacatcattttaa
tatgtatttataagtacaaaagaggggtgttgaatggaaattcgtggctg
taatcaaaagggtttaaaataaggagttataactccttttggcgtcattt
taataacagccatacatttaaatttcaaacgacaacctcccttgttctta
tccttgtatattcggctacacatgcacacacacactcttgtgcacaagcg
gtcatgtgctcctcacatgtttggatgcctcatgggctgccacaaatgca
taggacacttgccattacataggacacgtttcagctgcttctagactcgt
cagctggagttgagctggtggagctgagtttgagctagctagaaatgtat
tgagctgaaatgagctagaaacaatctttcagaactatttcgagctgaga
tgagctgcatgcacatatttgagcttcaaccgagctagaaatgatatctt
aagctgctgtccattacgtttccttatggtaaacaaaacaaacatgcatt
aaagtaatgcaaacttattaaaaacttattaagaagctgtaaacataatg
caaacttattcattaaaacacaaacaacatcaagtcaataccaaaacata
cttaaatacacacataatacatagtagaacctaaatacgtcacatatcag
catgcaacatgttataaagcctatgttctaaggcatgaacatgatcgaat
aaatctggaatcgtagcacaagtaaggaacaaggcttccctgaatttctt
tgccctagatcgagtaataggtcctaatgtaagacctccggatcagtttg
ctttgttggtgtgagcgtgcgcacatcagccagcataccgaaccaatccc
gaaaaaaccaaagagcttcaacgtcaaatcaacgaactcatggaaaaggg
ctatattcgagagagccttagcccatgcgctgtaccggttttgttggtcc
caaagaaggatggaacatggtgcatgtgcgtcgattaccgtgccgtaaat
aaaatcaccatcaagtataggcatcccataccgcgtttagatgatatgct
cgatgagttaagtggtgccaagttattctcaaaaattgatctcaaaagcg
gataccatcagattcgaatgcgcgaaggtgacgagtggaacaccgctttt
aaaacgaaacatggtttgtatgaatggttggtaatgccattcggcttaac
caacgaccctagcacttttatgagacttatgaactatgttttacgaaatt
tcattggtaagttttacgttgtgtatttcgatgatatcctcatttatagc
aaatcgatggatgagcatgtaattcatttgcgagctgttttggaagttct
tagaaaagagactttgtatgctaatcttaaaaagtgtacattttgttcta
acaaagttatctttttaggtttcgtggttagctcggagggcctcgaagta
gatagcgaaaagattaaggcaattcaagaatggccgagaccgacgagcat
aagccaagtgcgaagcttccatggcctagcaagtttctataggcgatttg
tacccaactttagcacgttggctgcaccgttgacaagcactatcaagaag
aattcgacttttcattgggacgaagagcaagaaaattcttttaatattat
taaagattgtcttactaaagctccgttgttagcattgcctgatttttcta
aaacatttgaaattgagtgtgatgcctcaggtgttggaataggtgccgtg
ttaactcaagacgggaggccgatcgcttactttagtgaaaagttgaatgg
tgccgtgctaaactaccccgtttatgacaaggagatgtatgcacttatcc
gcgctctcaagacttggcaacactatttgtggccgaaggagtttgtgatc
cattcggatcatgaagcgttaaagcacattaaaggacaacacaaattaaa
caaatgccatgctaagtgggtagagtatttggagtcatttccctatgtca
ttaagtataaaaagggtaaggaaaatatcgtagctgatgctctttcaaga
aggtatacccttttgtcgtatttggactctaaactgcttggttttgcatt
gttaaaagatttatatcctgctgatgatgattttggagaaatatttgttg
cttgtgaaagtgttgctattgataagttttataggagcgacggattcctt
tttagagaaggaaaattatgtgtgccgcgaagttccatacaaaacctatt
agtacatgaggcgcatagcggaggccttatgggccattttggcgttggaa
aaaccttagcaaccctccaagagcatttttattggccgaaaatgaaaagg
gacgttgaacgagtgtgtgcgcgatgtgtgatgtgcaagaaggccaaatc
caagattaagccgcacgggttgtatacgccgctccctatacccgacgcac
cttgggaggacatttccatggattttgtccttggattgcctaggactaaa
acggggaaggactctatttttgttgttcttgatcgcttttccaaaatgtc
tcattttatttcttgttcaaaaactgatgatgccattcacattgctaatc
ttttctttaaggaaattgttcgtttgcatggcatcccgaggacaattgtt
tctgatcgagatgcgaagtttttgagccatttttggagatcgctttgggg
aaagctcggaactaagttggttgttttcaaccacttgccacccccaaaca
gatagacaaacggaagtggtcaactgagtgctatcaactttgttacgagc
catcatacggaaaaatcttaagtcgtgggaggagtgtttgccgcatatag
aatttgcgtataatcgatccgttcactcggcaaccaaacactctcctttg
aaattgtatatggatttaatccgttaactcctttagatttagtatcttta
cctaacgatcaacttattcatgcagatgctaaaaagaaggccgagtatgt
aaaggagttacatcggaaagttcgagccaacattgaagcaagaatcgaaa
gttatgctaggaaagtgaacaagggtcgtaaaagaattatcttcgaacct
ggtgattgggtttgggttcacatgagaaaggaacgttttcccgctcaacg
aaggtcaaagctactaccgcgtggtgatggcccttttcaagtcttggaac
gaatcaacgagaattcttatcgacttgatctaccaggtgagtataacata
agtgcaagttttaatgtctctgacttatccccttttgatgcagattccga
tttgagggcaaatcgctttgaagagggggaggatgatacagccacgcgtc
aagtccaacctagctcgagtaaggagcctttggagctgcctcaaggtcca
atcacccgatcacgagctaaacaattcaaggaggctgtttcggccttagt
agatcaagtttggggcgagactttggttggacgcattgatgaagcttgga
caaactcgatgagccttccttgcactttgttacgagctaaattaagctcc
acttcagctcattaaattcgaaccagctcaaaattagctcaaaataactt
agtcaataatatagtagctgaaataattaattgagttagttaaattagtt
atttacaagcttaattaattttcgttattaaattggtcttaaatctggtc
aaacttaattatgcatgatattttagttattatgacatgttattaatttt
gtcttaatttatacagcttataaatatgtttttaagcttgtttttaatat
gttaactttattacttgttttaattatgtcctaaggctgccgaatttaat
gtgcagcattttagtgttaatttaatgtgtctaaacatgaatttgaatta
tttgatgaatgttgctgcaggtacatcatccatgaacgtttttggagcat
ggaaggtattaaaagagggtacatgaaggggacggcacatgcatgaatgg
gagaatgaagttggctgctgtttgaagtctcctaagtgaccattcagccg
aatttattacttacacactgttgaatacatcatggctgttcggatcaagg
tgttcacattcaaagactcttcaaaacttggttttcacactcaaagtgac
tactcaacatcttcttaattgctggtaatttttcagcaatagttgccaat
taaatgagctcctttaagcacatcaaccgaatgtagctgctgccatttac
tccctcaagctccaagttcaattgtccatctagaaggtgaccattggagc
tccaagttcagccaaatctagctagcccatttaagtaattcatttgctta
atttttaaggaatttaagtgaccattcgtctagcctagtggattattata
aatagctaaattttcactttgtaagggactttttgacattttaattagcg
aattgctgccaaatttgtgaggcattttctctcaaatttcgttcgagacc
cgtaagacttatctaagcttttagtggcgtctttccgagtcttttccgaa
cttatcactccttaaacccgagtgtggcgttcacctttgatacctttggt
tcatactttcctaagtatcgggtcaaggtccttttcaaccatttccaatc
catttaggtcctataagtttcgggtagtgttggttcactcttccttagtg
ttggttcactcttgacctttttgaaccattaacatttcgtaccaaatcgt
attaccatttcgaaccaaatcaccttaccaattcgtaccaaatcgtatta
ccattttgaaccaaatcacattaccatttcgtaacaaacccaaaactgaa
ctcgaccaaattcaaaccaattctttctcatctaaaccaaaaaccatacc
aactttgttcatccgacttgctttctttgaacccaatttctctttacttt
ctcttgaatcgatttattcaaacatacttcttcgtttacgatcgggaact
aaacgactcggattcaactactaaaccgagatcgtatcattttccttacc
ctttttatacttgatcacgtacggaaacgactccaaatactccacccact
tggcatgacgtttattgagcttggtttgtcccttcaaatgctttagagcc
tcgtggtccgaatggattacgaattccttcggccataaatagtgttgcca
tgtttcgagagctcggaccaacgcatatagttccttatcatacgttggat
aattcaacgtagctccgttaagctttttcactaaagtatgcaataggcca
tccatcttgcatcaaagcagcgccaatgccgatacctgaagcgccacact
ctatctcgaatgttttgttaaaatcaggtaaagacaacaatggtgcatta
gttagacattctttaagcttattaaaagaattttcttgttcatcagtcca
cacaaaaggagaatacctgtcaagggggcagcaacagaactaaaattagg
cacaaaccttcggtagaagcttgccaacccgtgaaaactcctcacttggc
tgatgtttgttggacgcggccagtcgttgattgccttgaccttttcttgg
tcaacttctaaaccacgagcacttaccacaaagcctagaaaaacaacttc
attagtgcaaaaagaacatttctttaaattggcataaagtacctcttttc
gcaagacttcaagcacggcacgtagatgttgaatatgatcttccaagctc
ctgctataaactaaaatatcatcaaaatatacaacacagaatttcccaat
gaacgaacgtaaaacataattcatgagacgcatgaaagtactaggagcgt
tggtaagtccgaatggcattaccaaccattcatacaaaccatatttagtt
ttgaacgcagttttccattcgtctccctcccgcattctgatttgatgata
cccactttttaaatcgatcttcgaaaacaattgggctccactaagttcat
caagcatgtcatcgaggcggggaataggatggcgatattttatggtaatt
ttattgatggcgcggcagtcaacgcacattcgccatgatccatccttttt
aggaaccaacaaaatcggaaccgcgcacggacttaaactttcacggatgt
agcccttctccattaattcggctacttgtttttccaattccttcgtttcc
tcaggattacttctatatgctggcctatttggaattgcagcactgggcac
aaaatcgatttggtgctcgattcctcgaatgggaggtaggccatttggca
cttcttcgggaaaaatatctccaaattcctgcaacaaagaaacgatagga
gtaggcaaagtattttcaagttcgttagtttccaataaacactctttgaa
cataagtacaaagatgggttgccttgccaacatcaattttcgaatctctc
tttttgtagcaaaaactctcatttttttattttcatactcttgttctttg
tcttttgtcactcttgtttttacctcactctcatcattcgtttctttcct
tttcttttcactctttttgtttttctctttttctttttctcgctcaatag
attgcttcatcttgagttggtcttcatgcagttgcttcggtgtgagagga
gctaatgtaacattccttccaaggtgcttgaatgaatatctgtttgtata
actgtcgtggactactcgtcggtcaaattgccaaggacggcccaatagca
aatgccccgcgtgcatgggcacgacatcacaaatcacctcgtcttggtac
ttgcctatggaaaacgccacttttgcttgcttagtcaccttgagttcacc
tccgtcatttagccattgtagcttgtaaggggttggatgctttgtggtgg
ctaaaccaagtttttcaacaagcaaagaacttgcgacgttggtgtaacta
cctccgtcaataatcaaactacacaccttaccttgaacatggcaacgggt
gtgaaagatgttatctcgttgttgttcctcctcggctacttggatattca
aactccttttgacaacaagtaattcaccttcaacgggcagctcgagctcg
tcaccttcctccatgggaattttaggctcctcctcttgttcatcttcaga
ttcaatctcgccatttgaacgaaccaccatcactcgttgattaggacatt
gactcgcaatgtggcctcttccttgacacttgaaacacttgatatcgcga
gaatgattcgaagcagcctcatttttatttttgctagcttcgacacttgg
ttggttggatttagcagcaacaaaaggctccttaggccgattaggagttt
tgctagtcccttgagcccacttgttggtagaagccgttggatatgttcga
gtggatcctttccttttcaattgcttttccactttgattgccatatgcac
catgtccataacttctacatagtgttgtagctcgacgatattggcaatat
cccgatttaggccggctagaaacctcgccatggttgcttcacgatcctcc
tccacgtcggctcttatcatagcaatttccatgtctttgtaatagtcctc
gacgcttcggttgccttgagtgagactttgcaatcgttggtacaactctc
gatggtaataggagggaacaaatcgcttgcgcataacagccttcatttca
gcccacgtagagataggcctctccccattcctccttcggctagtcaccaa
ttgatcccaccacacgatcgcataatccgagaattcattggcagcgagct
ttaccttcttattttctgaatagttatggcactcgaagacgagttccatc
ttcttttcccactccaagtaagattcaggatcattctttccttgaaacgg
tggaatagtcatcttgatatttttgagattgtcatcaggatggtctcgat
ttcttgggcctcgatttggttggaactgttgtgggtttccttgttcagac
aagtggtcaccttcggattctccttcatcaaagttgtcaattggttgctc
tcgttctcaccttgcatcttccggagtcgcttcgcgttgtcctcggattt
caactcgatataagcggtcttcgattggttcaagcttgcgatcaaataat
cgctccatttctcgcataatggcttgcaaagtgagatccggcactcctcc
tccaacatttcttatgggacgaaacccacctacctcattggattcctttc
cggacttcgtgacatttttttttaattctttaaagactcacaacaagaac
tcaccaatcactcacaaagaataatcactcactttggcttttctactctc
taatagtctcaccaatctctcttgccttttaccactcgattttcgcctct
caaaattcttcgcaaactaagtttgacaaatcaaaatcgattggggtcgg
cttacaaaatagatgtggcttggtagggaattattttaggatcgggtagg
ctaacaaacaaagaaagaaaaaaaatagaaggaaatagtgtggctatata
aatacggttcctcgggcagcaaacaatgcttttactatcaaactacgaac
ttttttttttacactttgctgaatacaatagaaagttttgaacacaaaat
aatatatatatattttttcgaattttatttttcgaattttttttacaatc
tcgtaatactgattacaacaattcttactctaattcgacaagctctgata
ccaacttgatacgccctcacctcaagatcgaattgagtcgtaaagatttc
ccgatcgtgaattaggagtaaattgaggctttacaaaataggctagaaga
aagaggtttatttaggctcaaaagagtttgttggtttaggaaatgaatca
gaaaacaatggaagcaatttggctaaggattcgaaagccgaactaacaca
ataggaatgtgttaacccgtaacttaggagaatgcttaggttggtaaggt
gttgatggatagttggttgaatggataaaaacttcgacccgctatcaaaa
aatgataggaaccttagtatgaatcgaacgccacacttttgggattaaag
tgataagttcgggtagaaacaaaaacaagtttgacgccacaaagaagttt
gataagtctcacaagtttttggagaataacgagagttgaaaacaacctca
caatttagcaaagctatcaaattgttcattaacctccaaaatgtgaatta
caaggcctatttataggatggactaaggtagccgaatagtctaatcagat
tcttaagccttaagcttctttaggaaacttcctagcaatttcctagatgc
attcataaacaacaaaaaaaatctgaataataaccttctagaagagatga
ttcggctggcccctttaaggatgataattcacattcaactaatgttttaa
aatagcttaattgctgctatggagaagagaaatggacagcttcaagaatt
atgcttctttggccgaatatgagtagccaccaagtgaattagttgctgga
atttatgaagcaccttttggccattgctctccacgaaattgacccttgga
gaagctcaaaatatcagcttgaagtccattgagctacacaaaaaaaaatc
agctggaaacacaaggtagctgcactttaaatgccgtccatgcatgtgcc
caaatacatgctccttctttatgagcttcctttgccattaagctagctga
aaaacatcaaataaatgtggttaagacaaggttaatactcatgaaatcat
cagctggacatattaaaaatctgcacattaatttaactaagacaaattaa
ctagcagccactaataaatttgtctaagtcaagacacattaaaactttgt
aattaaactaaacacatttaatttatgacttaatatggacatattaaagg
catgtattaatataaaacatatttaataagctgaattaagaatgtccaga
ttaagacacgtttatttaattaaatgattttgagctgattctaactaaca
caactaattaaatttattcaaaataaatataatcagctccttgaactaat
taagtgccgaattgagctgaattaagctgacacgagctaaaatcagcttg
taggatggtgcgaatcaagctagttgagctgggcattttatgggcaatca
acccatcactccacaatcgagcaatatagcttgctacagcatcttggaac
ttcttggcacgtgttcgagtaattggccccaaaggcaactccatggattc
ggcacccatcttcatgggcgagctcatatcacgattggatcgagttgaat
tggggtatcaacgagagcgtacaccccaagggccgcaaagaaggtgagac
caattggaaatcaatcaagacgacctatatgatccgaatgaagccgaaag
tgatcaaggatcaaacataagtgaaggacgaagaggtcaacgaaaccaag
gtaatcggaatcaaagacgcatggatgacgacttaagaaacattaaacta
tccattccatcctttcaaggaaaatctgatccggaagcctacttggaatg
ggagaagaagatcgaactggtttttgattgtcataattattctgagatca
aaaaggtgaagttggcggccatagaattctccgattacactatgatatgg
tgggatcaactcactacgagccgaagaaggaatggggaacggccaatatc
cacttgggccgagatgaaggccgtgatgagacgtcatttcattccctcct
actaccatcgggaactctatcaaaagcttcaaaatctcactcatggttca
aagagtgttgaggattatttcaaagagatggagatcgcaatgatctgagc
cgatgtccaagaagatcgtgaagcaacgatggcgcgattccttgctggtc
tcaaccgagatatcgctaacattgtggaactccaacattatgttgagata
gtggacatggtacacatggccattaaggtggagaagcaactcaagcgaaa
gagtaccactcgaagttttcctactccaagcaccactagatgggggcaaa
gttcgagtaaaactaatccaccaagccgtgccaaagagccaatgttgcct
accaaagcaaacaaacctatgggcgatacgagcaaaggtaaggcaactga
ttcatttgctaatcattctagagatattaagtgttttaagtgccttggaa
ggggccatattgcaagtcaatgtcccaaccgcaacgtcatggtggttcgt
gcaaatggagaaatcgaatcggaggaggaagaacttgaagacgagcccga
aatcgtttctgacaacgatgaagaagttgaacacgctcttgatggagaac
tcctcgttgttaaaagaagtctaagcatccaaagcatcgacgatgaacaa
caacgagagaacatcttccatactcgttgtcaagtacaaggaaagctatg
tagcgtcatcatcgatggaagaagttgtacgaacgtggcgagcactctca
tggtggaaaaattaaatctaccgaccaccaagcatccaaccccgtacaaa
cttcaatggctcaacgatggggagagttaaaagtgacaaagcaagttcta
gtctccttttccattgggatatattccgatgaagtgctatgcgatgttgt
tccaatgcacgcgggtcacttgttattgggccgtccatggcaattcgatc
gtcgagtcatgaacgatggttactcaaatcgatattctttcaaacatctg
ggaagaaatgtaaccttagccccattgacgccaaagcaagtttacgagga
tcaactaaagctgaaaaattccgtagatcaaatgagagaaaaagaaaaga
gcaaaaatacaaaagaaaaagaaaaatgaaaaacagaaagaaaattcaaa
aaaagagaatgaaaaaaaatgagaaaagcaaaagatgaaaaagaaaaagt
gattgaaaaattgaatgtctttgcaaaagcaagtgatgttcgaaaagcat
ttttggcaagacaaccgatccttgtacttatgtataaggaaaattttttt
aatactaacgacttatacggagatcccccttcttctgttttgtctctctt
gcaggatttcaaagacgtttttccggatgaagtgccaagtggcttgccac
cccttcgtgggatcgagcaccaaattgattttgtgcctggagccgttatt
ccgaaccgaccagcataccgaaccaatcctgaagagaccaaagagcttca
acgtcaagttaacgaactcatggaaaagggctacattcgagaaagcctta
gtccatgtgtcgtaccagttttgttggtgcctaagaaggactgaacgtgg
cgcatgtgtgtcgattgtcgcaccgtaaataaaataactattaagtatag
gcatcccataccgcgcttggatgacatgctcgatgagttaagtggtgcaa
agttgttctcgaaaattgatctcaaaagcggataccactagattcgtatg
cgagaaggtgacgagtggaaaactgcttttaaaacgaaacatggtttgta
tgaatggttggtaatgccattcggcttaaccaacgcccctagcactttta
tgagacttatgaactatgttttacgaaatttcattggtaagttttgcatt
gtatatttcgatgatatcctcatttatagcaaatcgatggatgagcatgt
aattcatttgcgagctgttttagaagtacttagaaaagagactttgtatg
ctaatcttaaaaagtgtacattttgttctgacaaagttatctttttaggt
ttcgtggttagctcggagggcctcgaagtggatagcgaaaagattaaggc
aattcaagaatggccgagaccgacgagcataagccaagtgcgaagcttcc
atggcctagcaagtttctataggcaatttgtacctaactttagcacgttg
gctgatacgatctcggtttagtagttgagtccgagtcgtttggttcccga
tcgtaaacgaagaagtagattagacgagaaggagttagaatatatttgtg
tacaaagaagtaagataagtttgtgcaaagttggataatgtggatttggt
ttaagtcgaaatggtatgaatagaatggaagagttcggtttaagataatt
aagaaatggtatttggttttggtacgttttggtatttgggaattggtacg
aaatggtatggaattggtatgaaatggtatggtatttggtacgaattggt
aatggttcaaagaggtcaagaatgaaccaacactaaagaaaagtgtcgac
ccgaaacttataggacctaaatgaattggaaatggttgaaaaggaccttg
acccgatacttaggaaagtatgaaccaaaggtatcaaaggtgaacgccac
actcgggtttaaggagtgataagttcggaaaagactcggaaagacgccac
taaaagcttagataagtcttatgggtctcgaacaaaatttgagagaaaat
gcctcacaattttggtagcaattcgctaattaaaaatgtcaaaagttctt
tacaaagtaaaatttcagctatttataagcaacacctaagctagccgaat
ggtcacttacattccttaaaaattaagcaaatgaatcacttaaatgaact
agctagattcggctgaacatggagctccattagacaccttctagatgaag
cattggacttagaaaaacttggatgatgcatagatagctaggttcggcca
atgggcataaattagctcatttatgttgtaacttttggctgaaaggtgac
cagcaattaagaggataatgagcagccaattcaagtgtgaaagctcaacg
ttgaagagtcatggagtgtgaacacatggaaccgaaaagccaagatgcat
ccagtaaatgtgaaaggaattaatgggcagctttggagttggaaacatta
gctcccttggccgaatagtcacctaggaatgttgaattcagctcaccaat
ttgatgcatgtatctccaggtgcaatgtatctaacatgcatgcaccttgc
taaaatgaatcttcaaattcggctaaccttgttaaatgatcccacacatt
cggccaacctatataaataagaagaactaaaattaatatgatattcagct
gaacaaaattaatattaaaaccatgaaacattaattcggtcaactatatc
actaaaatcagctcattaaatttggcagctttaaagcaacttaaaatcat
gtaataaaacttgacatattaaaaacatgcaacaaacatattaataagtt
gtaataaactaattaaatcgacttaaataaatattcagctattaaattaa
tgtctagttgatattaagctgaattgaaaaggtttgagctgaagttgagc
taattcgagctcattgagctgaaatggaagttaattcagctcgtattaaa
gtgcacggattgcttttcgagttggtccaagcttcctcaatgtgaccaac
caagatctcgccccaaactttgtcaactaaagccgaaacagcctccttga
attgtttagctcgtgatcgggtgatgggaccttggggcaactccaacggc
tccttgttcgatctaggtaggacttgaggcgtggccgtatcatccttccc
ctcttcaaagcgatttgccctctaatcggaatctgcatcaaaaagggata
agtcagagacattaaaacttgcgcttatattatactcacctggtagatca
agtcgataagagttctcgttgattcgctccaaaacttgaaaaggtccgtc
accacgtggtagtagctttgaccttcgttgggcaggaaaacgttcctttc
tcatgtgaacccaaacccaatcactcgattcgaagataactcttttacga
cccttgttcgccttccgagtataactttcggtttttgcttcaatgttggc
tcgaactttccgatgtaactcctttacatatgcggccttttttctagcat
ctgcatggataagttgatcattaggcaaagacactaaacctaaaggagtt
aacgggttaaatccataaacgatttcaaaaggagagtgtttggttgccga
atgaacggatcggttatacgcaaattcaatatgcggtagacactcttccc
atgtcttgagattttttcgtatgatggctcgtaacaaagttgatagcact
cggttgaccacttccgtttgtccatctgtttgggggtggcaagtggttga
aaacagcaacttagttccgagctttccccaaagcgatctccaaaaatggc
tcaaaaacttcacatctcgatcagaaacaatcatccttgggatgccatgc
aaacgaacaatttccttaaagaaaagattagcaatgtgaatggcatcatc
agtttttgaacaagaaataaaatgagacatttttgagaaacgatcaacaa
caacaaaaatagagtccttccccgtcttagtcctaggcaatccaaggaca
aaatccatagagatgtcctcccaaggtgcgtcgggtatagggagtggcgt
atacaacccgtgtggcttaatcttggatttggccttcttgcacgtcacac
atcacgcacacacttgttcgacgtcccttttcattttcggccaataaaaa
tgctcttggagggttgctaatgtttttccaacgccgaaatggcccataag
gcctccgctatgtgcctcatgtactaataggtctcgtacagaactccccg
gcacacataattttccttctctaaaaagaaatccgtcactcctataaaac
ttatcaatagcaacactttcacaagcaacaaacatttctccaaaatcatc
atcagcaggatataaatcttttaacaatgcaaaaccaagcagtttagaat
ccaaatacgacaaaagggtataccttcttgaaagagcgtcagctacgata
ttttccttaccctttttatatttaatgacatagggaaatgactccaaata
ctccacccacttagcatgacgtttgtttaatttgtgttgtcctttaatgt
gctttaacgcttcatgatccgaatggatcacgaactcctttggccacaaa
taatgttgccaagtctcgagagcgcggataagtgcatacatctccttgtc
ataaacggggtagtttagcacagcaccattcaacttttcactaaagtaag
cgatcggtctcccgtcttgagtcaacacggcacctattccaacacctgag
gcatcacactcaatttcaaatgtcttagaaaaatcaggcaatgctaataa
tggagctttagtaagacaatttttaataagattaaaagaattttcttgtt
cttcgccccaatgaaaagtcgaattcttcttgatagtgcttgtcaacggt
gcggccaatgtgctaaagttaggtacaaatcgcctatagaaacttgctag
gccatggaagcttcgcacttggcttatgctcgtcggtcttggccattctt
gaatcgccttaatcttttcgctatctacttcgaggccctccgagctaacc
acgaaacctaaaaagataactttgtcagaacaaaatgtacactttttaag
attagcatacaaagtctcttttctaagtacttctaaaacagctcgcaaat
gaattacatgctcatccatcgatttgctataaatgaggatatcatcgaaa
tatacaacgcaaaacttaccaatgaaatttcgtaaaacatagttcatatg
tctcataaaagtgctaggggcgttggttaagctgaatggcattaccaacc
attcatacaaaccatgtttcgttttaaaagcagttttccactcgtcacct
tctcgcatacgaatctggtggtatccacttttgagatcaattttcgagaa
caactttgcaccacttaactcatcgagcatgtcatccaagcgcggtatgg
gatgcctatacttaatagttattttatttacggcacgacaatcgacacac
atgcgccacgttctgtccttcttaggcaccaacaaaaccggtacggcaca
tggacaaggctttctcgaatgtagcccttttccatgagttcgttaacttg
acgttgaagctctttggtctcttcaggattggttcggtatgctggtcggt
tcgaaataacggctccaggcacaaaatcaatttggtgctcgatcccacga
agtggtggcaagccacttggcacttcatccggaaaaacgtctttgaaatc
ctgcaagagagacaaaacagaagaagggggatctccggataagtcgttag
tattaaacaaattttccttacacataagtacaaggatcggttgtcttgcc
aaaaacgcttttcgaacatcacttggttttgcaaagacattcaatttttc
aatcactttttctttttcatcttttgcttttctcacttttttttcattct
ctttttttgaattttctttctttttttcatttttcttttcttttgtattt
tcgctcttttctttttctctcatttgatctacggaatttttcagctttag
ttgatcctcgtaaacttgctttggcgtcaatggggctaaggttacatttc
ttcccagatgtttgaaagaatatcgatttgagtaaccatcgtgcatgact
cgacgatcgaattgccatggacggcccaataacaagtgacccacgtgcat
tggaacaacatcgcatagcacttcatcggaatatttcccaatggaaaagg
agactagaacttgctttgtcacttttaactctcctccattgttgagccat
tgaagtttgtacggggttggatgcttggtggtcggtagatttaatttttc
caccatgagagtgctcgccacgttcgtacaacttcctccatcgatgatga
cgctacatagcttttcttgtacttgacaacgagtatggaagattttctct
cgttgttgttcatcgtcgatgctttggatgcttagacttcttttaacaac
gaggagttctccatcaagagcgtgttcaacttcttcatcgttgtcagaaa
cgatttcgggctcgtcttcaagttcttcctcctccgattcgatttctcca
tttgcacgaaccaccatgacgttgcagttgggacattgacttgcaatatg
gccccttccaaggcacttaaaacacttaatatctcttgaacgattagcaa
atgaatcggttgccttacctttgctcgtatcacccataggtttgtttgct
ttggtaggcaacattggctctttggcacggcttagtggattagttttact
cgaactttgcccccatctagtggtgcttggagtaggaaaacttcgagtgg
tactctttcgcttgagttgcttcttcaccttaatggccatgtgtaccatg
tccactatctcaacataatgttggagttccacaatgttagcgatatctcg
gttgagaccggcaaggaatcgcgccatcgttgcttcacgatcttcttgga
catcggctcggatcattgcgatctccatctctttgaaataatcctcaaca
ctctttgaaccttgagtgagattttgaagcttttgatagagttcccgatg
atagtaggagggaatgaaacgacgtctcatcacggccttcatctctgccc
aagtggatattggccgttccctattccttcttcgactcgtagtgagttga
tcccaccatatcatagcgtaatcggagaattctatggccgccaacttcac
cttttttatctcggaataattatgacaatcaaaaaccaagtaggcttccg
gatcagattttccttgaaaggatggaatggatagtttaatgtttcttaag
tcgtcatccacgcgtctttgattccgattacctcggtttcgttgacctct
tcgtccttcacttatgtttgatccttgatcactttcggcttcattcggat
catataggtcgtcttgattgatttccaattggtctcgccttctttgcggc
ccttggggtgtacgctctcattgataccccaattcaactcgattcaatca
ttcgttaacggattctaactcacctcggatcatgcgttggatttctcgta
acaaggcttgttgagccaaatccagcactccacctcctccaggcgcaatg
tttcggattggttgccttccacctccttccgccatatttcgttcaggact
ttgagacatgaaaataaaaaacctcacaacaaaacctcacgaatctctcg
aaaagaaagaataacactccattcgtgtttcactcaaaattttttttttg
gctttttcttttgatgtaactctcacgcctttttccactcaatttcctct
cgtgatttcgtaagcgactcgtcgtgaccttatcatagttcaatgggtcg
gctttaaatggctttacaagggattgatgttaggttacgggtaggctaaa
agaaacaagaaaggctttaggctaagtgtggcttagaagatgaatagaag
agaatgccaaacttacaaactcgaaaaaatttctttgaatgctcgtactt
ctcattttaaccagctctgataccaaatgatacgatctcggtttagtagt
tgagtccgagtcgtttggttcccgatcgtaaatgaagaagtagattagac
gagaaggagttagaatatatttgtgtacaaagaagtaagataagtttgtg
caaagttggataatgtggatttggtttaagtcgaaatggtatgaatagaa
tggaagagttcggtttaagataattaagaaatggtatttggttttggtac
gttttggtatttgggaattggtacgaaatggtatggaattggtatgaaat
ggtatggtatttggtacgaattggtaatggttcaaagaggtcaagaatga
accaacactaaagaaaagtgtcgacccgaaacttataggacctaaatgaa
ttggaaatggttgaaaaggaccttgacccgatacttaggaaagtatgaac
caaaggtatcaaaggtgaatgccacactcgggtttaaggagtgataagtt
cggaaaagactcggaaagacgccactaaaagcttagataagtcttacgga
tctcgaacgaaatttgagagaaaatgcctcacaattttggtagcaattcg
ctaattaaaaatgtcaaaagttctttacaaagtaaaatttcagctattta
taagcaacacctaagctagccgaatggtcacttacattccttaaaaatta
agcaaatgaatcacttaaatgaactagctagattcggctgaacatggagc
tccattagacaccttctagatgaagcattggacttagaaaaacttggatg
atgcatggatagctaggttcggccaatgggcataaattagctcatttatg
ttgtaactttttggctgaaaggtgaccagcaattaagaggataatgagca
gccaattcaagtgtgaaagctcaatgttgaagagtcatggagtgtgaaca
catggaaccgaaaagccaagatgcatccagcaaatgtgaaaggaattaat
gggcagctttggagttggaaacattagctcccttggccgaatagtcacct
aggaatgttgaattcagctcaccaatttgatgcatgtatctccaggtgca
atgtatctaacatgcatgcaccttgctaaaatgaatcttcaaattcggct
aaccttgttaaatgatcccacacattcggccaacctatataaataagaag
aactaaaattaatatgatattcagctgaacaaaattaatattaaaaccat
gaaacattaattcggtcaactatatcactaaaatcagctcattaaattcg
gcagctttaaagcaacttaaaatcatgtaataaaacttgacatattaaaa
acatgcaacaaacatattaataagctgtaataaactaattaaatcgactt
aaataaatattcagctattaaattaatgtctagttgatattaagctgaat
tgaaaaggtttgagctgaagttgagctaattcgagctcattgagctgaaa
tggaagttaattcagctcgtattaaagtgcacggattgcttttcgagttg
gtccaagctt
back to top