AC197193

Germplasm
Stock NameType
Acala Maxxacultivar
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Sequences
The following sequences are available for this feature:

region sequence

>AC197193.1 ID=AC197193.1|Name=AC197193|organism=Gossypium hirsutum|type=region|length=81806bp
aaaacataatcactcatccatattaaggaaatatatttggtgagcctcat
attttagggctcttgaaacctttagcacattataaagcaagcccctagga
tcggagggcttgagcattgttcttagcttcaatcagaattagcctgattg
aaagatattttatataaaaaacgaaaaatcagaaacaattcaagtcgaga
gacatcacactgtataaggttataaagatggcatgtattactagactcat
tacgtgctacgttcagtttgagaacccaactaaattgtagctcaatacta
ctaaatgtgacacccctaacctatctctattatcagattaggattacaaa
gcattacaatacaattcaaaacatttaacttcaaatagaaactattattt
agattaaatactaacattcaaactcatattacatttatagcacaaatata
cttatgggccctaaatcgagcttacgtggacctaaaaacaatttgggagc
aatctgggatcaattcgaaacaaaatagaaaattttggaaaaatcatcaa
aattttgaaaactggggtcacacggctgtgtggccaagccgtgtgacata
ccccagactgtgtgtatatactaacttgagacacacagccatatctataa
cacccctaacccatattcgtcgttggaatagggttacggagcattactga
aaaattgtaacataaaaacattcatttcaaaacatttcataatcattaaa
aaatctaatcgaacacatatttaacatccctttttcgagccctcgaggct
ttagaaacactttagaaacgattcgggactaaatcgaaaacattttgaac
ttcatggcaaaagatagaaaaattcctactacaaaggttacacagccgtg
tagtcaggctgtgtgactcacacggctgagacacatgcccgtgtcttagg
ccgtgtggacaaggaataggcaaaattcaagtaatttctttcaccaaatt
caagtacacttaaacaaatcttttgcacatatgaacaaggtatcaaaaca
tgttcaaccatgcataaaatgatcaatttccattcaaccaatatgccata
aaggcaccttaaatacaacaaccaaatatgtttaaacatttgcattatct
agctattcaccaaccatacacaactatctattttcatgtcaagtcatagc
acaattaaccatatgtcaaatacatctaaatagaccaatttttgtcaatc
aaaacatatcatcacttaaccatttcaacatcaaccatttgagcaccaaa
atgctagcatgtcatcaaccataaaaccacatgtatacatgccaacatga
caaatggttcatcaaccaaaataccatatttacaagccaaacgtaatggc
tatttcaacaagcacaaaacacctatacattaaacattcctaaacatgta
catatttaaccatttatcaactattttgtttccacgtcaaaacatatcac
aattgatacatatcaatcataccataatagattcataccatatcaaaaat
aaccttaccatttggactattcctctcatgcattgtaaccacctaaataa
cataaaccaaccatttccaaataatatcaaataaccgacatttataaacc
atatttacatcatacacatctagttctaaacctttccaaagtgaattata
tgttgaccatgttgagatcaatttctcatataccattttggccatttaaa
gatacattaacttataccaattttggtcatttcaaaacatgcatcaattt
gaccatactaaccctaaccaacaagacatcaatagtaccttaagtacttc
aaatccacggcaacatttcatgccatagtcatcaaccaaaatgacatata
tatgtcaaactcatcaattaaacattaaacagagtccacctatacatgcc
attataaccactaccaaagcatcaaaatctaccgataaaaaaattgatgg
atagtgtgatggatctccaactagcttccaacccgatcgagcttctgata
atctgtaaagtaaaggaaaaataactatgtaagtaatgtatgcttagtaa
gctcgtataaactttaagcatagaattccagttcaataataaaatttnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngtt
tggctcttagaatcagcttgattcgtttgatttatctattacggactaaa
ttataaattagtaaaaatagaaggattggatgtgaaattattacaaatat
gggctattttgtgtgccatgaatactcaactgatgtgatttggcattaga
aatggttaatttgtatgttttaggcccagggactaaatggaacaaaagaa
aattttaggggcaattttgtaaaaatttcaaaagtgactaaattgcataa
aatgagttgttttactatctaaattaatggattgaatgaaataactaatt
tagatcaagattgagtgaaaaatcaaggagaatggaaaattaccaaaatg
cccctatattttttcaattctgcaatttagctaggtcagttcgtatgaac
taaattctgtataatgttgattaaatttaatgttagtatgtgatctattg
tgattgaatcattatatatatgttattatgcaatttatcttgtcaagaaa
cgatggaaattcaacaacgtacaatgactattgagccttgtttaaacctt
agaaatatataggatacaaaggaaatgtaattagggttaccatgttttga
gtgccggtcttaaatgtcctaccgatagctgagttccagcatgtgttgct
gatacttgacaacttatgtgagcagcaccgtgtagctatgttccgattga
tagtttgtgtgagcaaacccatgttaccattttctagtgctagtcttgac
tatcctaccgatggctaaggtccgacattagttgtggatacttgacagct
tgtgtgaacagcatcgtgtagcttacattctgaccgacaggttgtgtgag
caggcctattttacagctcgtgtgagctatggctatatgtttagcacact
ttgtgtgagctttcctgcgtatctggtattattctaaatggttcaacggg
catgaaaaaggatgaaccggtaagggtttcaatgaaattcactatgaaat
tatggaaaggtatgatgtatcgaagattaaagtatgaacattcataatta
tggaaggtatgacataggtgatgctatgtttatgtatcgtatcttaccat
atgatgatattgttaaattatgtgtttaatcactagcttgtggctatggt
taatgttatgtttatgtcttatgtgttatgcaaatgaaatggtaactgtt
caatatgaaccaagacatgtatgtatgaaactcattgaaatggtgataca
tggaaaccatgatatgttatgaaggatgtatcatatcttacaatatggtg
atattgttaagttatgtgtttaatcactagctggatcatgcttaagtata
gtggttatctatgttaagttcatatgaattatgtttaagtatgctaacat
gagttgttgatgttcttaggcttgtgccaagcttatgattggattatatc
atgcttagtcttaatgaaatacattgaaacagtaagtgttcatttcgtaa
tatgcttatgtacatgaaaagggtggtataaattaaattatgtaatttct
tatgaaatggtttatcatgcagttgatttcaaaagagctatgctaaatgc
actagctcatggtcatggttgatgttatgcttatgtactgtattatacaa
aggaaacgagtataaaaaggtaatgaaattggtaagttcatagttgaaat
gaaatatgatgaaacaaaagggaataatgagttaaaatatgtacttgtat
gtgtgaagtttacgtatgttatggatgaatatacctagttcatgaaaaaa
atatgctaattaatgaagtgatgttgttatttaagctaaagtaagtatat
ggaagggttcaaagtcttatgaaattctactatgttaggaatgataaata
tatatatggtgttgatagacttattccattgtgagctgatgattatggtt
cgacaaatattgaggcattggtataggtttatatataacctataatgttc
attattgaaatggaatgctatgtttaagtttttgcaagcttactaagcat
acattgcttacatagttattttcctttaccttacagattatcgaaagctc
gatcaggttggaagctagttggagatccatcacactatccattgatttta
tcggtagatttttatgctttgatcacggttataatggcatgtataggtgt
tatgtgcttgatgatatgaccattatgtttggcttttaaatatggtttta
tgattgatgacattttggcatttttgggcttaatggctaatgttgaaatg
gtttagtgatgatatgttttgaatggccaaatttgtatgcttgtgtaata
ttggcatgaaatgttgctttgaatttgtgaaacttatgttattttgatgt
tttaatggttggtgtttataagatcaaattgaagtatggtttgtggccaa
actgataattgttggaatggttgcaaaatgatcatttatggcatgtattg
atatagtatttaaatcaaatatgtttagttgaattatgaccatttggaca
tcaatttgatatgtatatatattggatgttggaaccatttggtaatggct
agttttgtatcatttatacgattttgttattttgttattacatgaatcta
atatggtaaagttgatatgtgtcaattatggtatgttttggtatagaaac
aagttagttgctaaatggttaaatatgcacatgtttaggtatgtttaatg
tatgtgtttgaggtatctttatggcatattagtttaatggaatttggtta
tttaaaattggtcattttatgtatggttgaacatgttttgatactatggt
catatgtgcaaatggcttgtttaggtgcgcttgaattgggtgaaagaaat
ggcttcaatttggcctatttcttgtccacacggcctaagacacgggcgtg
tgtctctgccgtgtgtgacacacagccacgagacacggccgtgtgtcccc
tataggtttttaaaggttgtatttcgagagttacacggcctggcacacag
gcgtgtggctttggccatgtgaaccaagtcaaagagttacatgggcacgg
acacaggctaggacatgggttgtgtgtccctattttcgactgcccacacg
ggcacctgtctcaaccgctttgagttgcacgggccgtgtgacctctgtag
tgtgaatttttccatctttttccatgaagtttttaaatgttctgatttag
tccgaatcattttgtacagtgtttctaagacctcaaaggctcgaataagg
gacgatatgcatgtgtttgaatggaatatgatgtgattcatgagatgatt
tggaatgaatgttttgatgtttcaattttacggtaatgctccgtaaccct
attccgacgatggatacgggttaggggtgttacatcaatactagcggatt
gtggcattttagatctacaaaaaggtgtaggttcaatacgattagttgtg
tgtgatgtgtttattttttctatattaataatttaattataattaactgt
gagtatattaagtattcaaagaggatgtgaaaaactcatcaaaaggtatc
caagtaagtgactctaactgagtacattttatgaaatgcatgatatacga
tatgattattgctatgataatgatgtatgtgtagatcttatcctcatgat
atgtgatgcatggcttatgtgatacgtttgatgatttaaacatgtgatat
caacaaatgagtatgttaatattgagatctatgatctaatgtgataagca
tgttaaacatgttaaagtaattactaagtgatatgtgagcatgtctacat
gcctaagggtaaaagtgattcaaaggtgtgaaaatttaaattgccatatc
acaagcatgggggaacgaatcaagcataaaaaaaaannnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagttaattaggaac
aagaaccaggaaaatgatttattcttattcatgatcacaacataaagaag
aaaataaatagaagggaactaggaagcaaatctagtatttctctgaaacc
aggctagtgcgttcctcttcttctctgctcgttgtgttgaattgaggctt
ctatgaaaaattgaatgatgctattccaaaggtggaagaaggctcttttt
caagagggaaatcggcaaggggaatgggaaaataaggaagggaatggaag
agagaaaagaaagtgaaagagagagatatgtgggaaataaagggtgtgtt
gaatgaggtagcaaatgtgggtatttataggtgtgaatggttactaagaa
tagaaaataattagcagccacacactcttacttggccagacatacaacaa
gcaagtttgattgttttaaacttactattttaacctaggggcaaagattt
gaaggcacgaaaagtggaggggtttgaatggagtttagggaaaatttgat
ggttgttttgcaagcataaaaatcagaaaagaatcaactgattgggtcag
cttattggagggttttgggatattattttcttggtggatcaatcttctct
tcttagcatactgggccactttctccttcaggctttgtattaaattttaa
cccaattaaatttggataaaaattaaatataaattatataaaataatcac
aatttcgaccttccttggctgaaaaaatatttagctttctcttggttcac
tcgatgcaaaaatttcttcaacagttcaagcccttcaaggtgtctgccaa
gccaattttcaccttttatgcaaaactgtcgaaaataaacaaattttgtg
aaaattaattataaaaataattaaaattcaatatgttaataatttaagtg
aaagttaattattttataattaaagtgtgaatttcaacaaaatttactat
gaaactgaatgaattagggctcaaaaggtgctaaaaaattctatatattt
ttgtgttttcatacccccaaacttaattcattgctcatctcgagtaatgc
acaaatttaaaagaggaagtgcttgaaatcatcattcaaaaatgtcttta
gaatacatttccaacagaattatgagtttagtgtaactatgctcaagaac
aagaattttgaaattatgcaactcaaatatacatattgttcgaattattc
tcaattgttattatgttaataagaatagactaaatgttttcttaataaag
acatactaattcttaccactaaatttttttctcttatttaagactaaact
ataatcactaagtttaacttatgtcttcatatgttaaacttagcaatttc
tctacactaatgtaggtaacatagaaatcgtaatcgaaaggtcttttaaa
taggttgtaacatggctaggctaggggtaggtaaaagatagataaattta
agctaaaaaccctagactcagcttgcattgaaccttcagaataagtatct
tcaatacaccaaatcatttttctttcacattctcttttgtacatctaatt
atttcgagtacatatgctctttcttattattcttctcttttttttagaat
acgagcattttactatatatactacaattttttgagcatttgatacttct
tttcaactcccccaaatttattttcaaagaatattctaaatagattgatt
ctagtgcttgggtcaatttaaagataattatgaaagaagcgatggctaaa
tattgcaaaggtttaaataaaattaggccatatagtctcaaatttgggtt
tcaagcgataaaaattcattaaggttggcttgaaaggctcaaacagtcca
aacaaaagtttgcctaaatcattttcaaaatttcatgcttcctaggattt
cgcctcaagaaattactaagtcaattctagagacttaaactttcatgcat
gtctagctttcctgaagaaaaaaaattatggtatgatttgcaaactttat
taagagtaatattatgtcatagttcagctaacatagtaattattgagata
atagaactttatttatactagaagttagcataattaacaaaaattcaaat
tttttaacaaaatataacttaatcataattataagaataatgtatcttga
agaacaattttaatttttggtccccctacttaagatgaacaatgtctgca
ttgttcaaaacaataggtagaatgagaatatagaagtgaatagatactgg
acaccaggtaagaccctaggaaaaagaggtgagtcaagtttgattgctta
aataccaaactttaccaacacaaatccaatcctagacatgtacatgtcta
ctgccacacttcttattttgcaatttgttcaattttattgatgattccca
acttttattttattatgtgagaaataaaaatcctaatagaacctaatcct
aaaaaatttaaatatcctaataaagaaaataaaataaagtaaaaattccc
cctttttatttatttgtagatccctcagaatttgacttgtcttttgctcc
atcgtctttgtttttgcatgaatcgcttcgtttcctctttgatgttgggc
tccatggttcaaatataaaatttggaaactcaggtacaaaaataaatggg
tcatgaattattttcgtaaaagcacttctcatttagtcatcccgtatttt
tgaatatctctaataagcttgttgctgccactgcatatgttgcattaggt
ccatcaactttgacagctcgccatgaagatctaggcgaggtgaatgagtt
ttgaatgttgaggtcaccatgtcaagtttgtttattagttcaattggttc
ttccttatcagggatttcagctgactgcactggttcgatctatgtgggat
cttcttcttcttctttgggatcctcgctcaatttaactcgttgctacaga
acaaaatattcggttactcggtagaggtctcaatctatgattgtgccttg
gttataacatgtcttctttatgtttgtgagaattttagcttttaagcaca
gaatttttatcgtaaagggaaattatgatgatccagaacgtctggcggca
cagttctgaatttcccttagaatgatttttcccaaatcaacggtctttgc
cattaaaatcgagtataacaagaccattcactctaatgaaattgtggtcc
catgtgaaataggcataaggctaaatcaaatgaaagaaaaccatacattc
actagtggtgtcaaatattctctacgacaactgtgagttccattctttga
cacagtccacttagaacctagaactgtacgttccttgagaatttcttgca
attttttggcctcaatatttttcattaaggaataatattcatcgtcttca
aaatcaggtaaatcaaagtcgcaaaaaaatcacaaattaactcttcattt
gcacttaggcttttcttacaaaatacttcccaatttaaagtttcagcaac
ctttctaatgctcgccatgaaattactgcaatttctttctttcagtgtaa
agcctttttctgggagcatttgtttattttttaaaatattgtcatatctt
gctttggcttcttcacactggaatttcttttatgattcttcaacttggaa
agaggcacgagttcttttgcgaggcatgattaacctggacataagatgga
acaaatattttctcccaaaattcaatttgtattaaatattaataatttaa
taaattgaaaattcaaataattaaataaaatttaaatttaggagaaagtt
tttcttaccacatttgtataaaaattgcaacctcaaaaataaaaattaat
acggagctacaccaactcatatattaatttatcagttgctaatactttat
ttatttaaataaaatatcttaaataaaatattaaagaaattctaatccta
tataaagttgataacaattaatatatattacataaaatgtaattatatat
tagttattatcatcttatttattaaaaaataaattaaaaattttatttta
gctgcttttaaagatatttacaaaaagagacagctaatttcaatatttac
aaaaagaacaaccaaattttgcacataattatattaagtacctaaactta
aagaaaatttgaaaattgagttgtaattaaaacttggatcaaaattgacc
cttttctttgcaaaattaaaaatttattttgccatttaggaaataatttc
tcgaaagattatgttaaaatcaattctcaggaaagattggaagggtcaca
agtagtccagcttaaggtacaatctcctagacagaatttaatttaacata
ctaatccagaaaatataccttaagtcatttatttaaaagaaaacgagaaa
aattaagtatccgataaaatgaacgagactttctcttgttcaattttatc
cccccaataatgttttaagcactgagcattaactcaagaattacctccct
taccttgaagttcgacaactccgtatggaaaaactaatgaatagtaaata
gaacgcaccaatgtgatttcaacttacttggaaaaaaccttaatctagat
ttgaataacaaaacttactgacctgtttcaaattcttgaactcagatgtg
cttatcatgccatctctttaatccctcattgaataacttggcattttcat
atgagaaagttcgaaattcttctaactcgttaagttgaagcatctgtttc
actttggcaagcttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnngaattgggttaaacatcccattaggttccaccaagg
ctcttcaatcaatttctgcttcaataaactcaaatggaatctacatcctt
tattataattattgtgataaaaatctacaatttcttcctaaactattgtg
tcaacaatctccatgatgtgccatttttcatctgtatatacacacttcat
agcatcaaaaacattaaaagttatctgttgatcattaactctcatagtta
attcacctttttggacatcaattaatgttttgccagttgctagaaaaggt
ctcccaagtatgattggtacctttttatcatccttacatttcaaaataat
aaaatctactggaaaaataaatttgtcaactcttaccaacatgtcttcta
ttttaccttctcgatgtgtatatgaacgatcagctaattgcaaagtgaca
gttgtaggtgtcacctttcttattcccagcttcctgaaaatagacatagg
ccttagatttatactcacacctaaatcgcatatttctttgccaacataat
ggtttccaatagagcaaggtgtagtaaaactccctggatccttctggttt
gctggcaatttgtttcttagcaatgttgtgtatccttcagtaagagcaac
agttttgaactctcctaacattctcttctttgatacgatatatttcatga
attttacatagttgggcattttttccaatgcttccaccaatagtatgttg
atatgtaattgctttaggacatccaagaatttcttgaattgaaaatctta
cttagatttttggaaacgctaaggaaaaggtggcggtaaccttccttcca
tttgttaaggttgttttgcagtggcagttttactggcaatgcaagatgaa
tctgcttcaacatttttctagttgttcttttcctttgtagcttgctgcac
tactgattctgaattcttcttatttgtgaaatttgaactactttcttcaa
tagtggtctcattaacaactcctgatagttgcataccacttctgagcata
atggctttacactattcctttccttgagatcgtgaattttcagtatcact
cggtagtgctccttgcagtcttgagcttaatgctttggcaattttcccta
cttgattctctaaagctcttaaagaagcagcttgactttaaatgatagca
tcattcttggccatgtattccttcaatatatcttccatcgatgaagaact
caaagctgaattttgctaaatactttgccgtggcatgagttaattgtatc
catgcggtgcacctgtaacattttgtcgaatagcattgttggaatttccc
atcgctagattactccaattgaagttgggatgtcgctttccacctcggat
tatatgtttttggaatatggtttatttttttttctacgatcaaaatttcc
cattataaattgagttttggattccatgggcattcatgaaaaaaacatga
tctttctcccgcaataaacacatgctaacttgggttgtttttaatttctt
gcactgcagctggtctttttagtgttttaatcatattcattaaagatggg
acctgagctattagagaagtaatcgcatcaaggtttcattactctagaaa
ctcttttgtattcccaactctggtcgtggggtattgataatcaatgtttg
ctatcctttctagaattttatatgcctcattatatgatttatcaagaaaa
gtctcattgccagatgtgtcaaccaccatccttatatgcgcattcaatct
gtaaaacatttccatttgtgtctaatgttgaaaaccatgcatcaggaatt
ttctaattaactccttgaatcactctcatgcttcatataatgtttcgtcc
tcagatttttggaaagacgtaatatcgttcctcaatttggcattcatgtt
cggaggattatatcttagcagagacctctgacaaagttcatttcaagatg
ccatcatacttgacagcaatgcatttaaccatgcccaggcacaatctcgc
aatgaataatggaataactacaatttcagggcatcatcaagaatacccta
ctgcttgaacgaattgtagactttcaaaaagagtcttcagtgcaattgtg
gatcctcagtaggaaatccactaaactgccctactttttgtaacatttga
aacatcactgactttaactcaaaatgttgaacctaaatatgctgcctaac
aattcctggattcaaatcatctaagatcggtactacatgttctctgatgg
ttctatctctttcatctattattcgaggaatatcagcatcccttccttct
tgatgtaatggttctatctcctttttctcaaggttctcttaatttctgga
tcaaaagaatactcttcaattgcaaaatatctctattcattcaccaaccc
aaaatcctaaaaaccaaaaaaaaaaatcaagcaactaattaagctaaact
actaaaattaaagagataataacataccaaatttttttcaccaaaattgt
gatccccggcaacggcaccaaaaacttgtcgtgtgtgaatgtgtaatatg
aatgtgtaagtatacatgttgaatcaggtaataaagtgatgagtgagtat
catctccacagggatcaaaattgattaaaataactggttatgctaatact
ataaaattgattaattaaactatgaaaaagaaacaagtgactaattgata
aagaaatgtaatgaatggattaataaaatcaattatgaatgaaaatatgc
taggtcaattaaaatgttgtggcaattcttaatgaatcaataggaaagag
ttcgtactattgaatgataaaggttagaattactcgggcttatttttata
acataataatgccattggaaaatcttgatcgttctactactcagggactc
actactgcagtcagcttctttcaaaagctataccttgagctatcattcaa
agtttttgtatgtctacagaactcaagaatgatatccagatttttctgcc
tgtccatgtacagattgcaacctctacgtctagagtgctgtaaatattat
tttgaatacatgcctgtatcaaccacttataatctaatgtaattaatcct
tccagaattaaatcagatctaataacataccacacagttatctatgttta
gagtttgcatgcatgtatttaaaataatcacaactcgaatgaaataatat
cctactcaaaatcaaaccatgggcattaaagataataaaaattcacccaa
ataattctaacccaataagaattagttcatgggttgaacattcaaatcca
taacaaaaccattcaacataattttttaaattcacgaatcacaaagttca
aataaaaaaataaaggcagaactgcaggaagctttcgttactctagcttt
tactctaataatgagatttgatgcaacacccaaggtagatttcttttccc
cctccttgcatctgtaattcttctgctctgttagctgctaccctctccac
tatttctctgagatttcacgagaacctgatggagggagaaaaaactattt
tctagttactcttcctctccaaatttttcctttctcttttctctttcctt
ctttataaggtaggtccctccctctcagcacacaccttttgcttcccctt
ttccagggtggtttatctaatacaagtatagtttgctgagagtgacgtgg
actgagtgttgtgtcatcttcctggaattaccatggtatttgtgttggca
gtttaaccaacattttcttatgggaatatttcacttccttcattttccta
ctctttttctcttctcttctttatcctacacctgctaccaaccacaaaca
acatctttcttacctaataataaaagtaacaaataacaacatttatagca
caattcaagctttgttatgtaaatttctataaatatctaaaaatgcaaat
atatttacttaattacaaacaattaattcaatctaaaggcttgaagtata
actcttttcaagagttatcaaatggtaaggaggtggggtaagcttggtta
attgtgaccaagttcattgaatcatagcaaatagtcaagaatgaagtgaa
aggaaagaaaaaggacatatgagtataaagggggatcctgtaagaattgt
aaaagaaattatttgaggaagggaatcaacttatttgaggaaacagaggg
tggacagtaaccacttaagtcacatggaagaattatagaaaaaattaaat
aaaaaaatgtgaacattaagacttgaaccttggacccttaagatagttaa
gaagtctctaaaccactaatccattcaaacatgcaagtactcagtccaga
tcagaatttcagatagaaatctcatgtatgaaacttttactcgatccatc
gaaattatttcaaaacattcagtataattaacttagatcaatttcttgca
acagttttgaatatacatatatgaacatcaataacaatatttaataatga
attataaccaaaataactgtagaaacttacccagacaaaaatagttggga
aaataaggcttcgattaatccgttaatttagcttttccattattagagtc
caattgtttcgttccttgatctaaataatttttatttcgttccattaatc
cattcaaacatctcaaataattgaacttaagcttataagcccttttaata
taaatttacaaaactacccctaaactttacaattttgtaatttagtccct
aatcccaaaacttacagtttaatcacatttaagcaacacccattctagtc
aatctctatatagtccctaatcatcccaaaactatcaaagtttcacaata
attccatgtaatttcactattttaacaattaaattcttaaacattaaaat
ttctaaaaatcactttacgaattactcctatttaacaaccaagctaataa
tctaccattaaaattcagcaacacttctatttaattaatggactagttta
aaacatttaacagttttacaaattaacccccaagttagctagattaagct
acaatgatgtcaaaaacataaaaatcactaaaaatagttgaaaattacat
accatgcaaggtggtgtaacttggccgaaagctttatgtttcttttcatg
gaggaatcgatttttggccaaataaattaaggaatattataaccgttatc
atcttttttttagataaattaataattaaattacctttttacctttttaa
cttaacaaaaattccttaataaaccaaaccaaatcgtccactatctttat
atatggtttaattacctattaaggcccacaatttataatttcataaccat
ttaacataaataaactaatagcgattaaatttttgtagttattacaattg
agacctttttatttaattaactatccaaacgtcaaaacttctggaccaca
attcaatacacctatataatcactccataactaattagtaaaaatattta
tgggatccttttatagaaaatgaggtcttaatacctcattttctaaaacc
acttgactttagagacaaccacttgaacttatcacttcttttaattgcag
aaattattaaatcaacattcaatataattttataattgactcgtagatat
taaataataatatttacaacaccacttgtcagatttgttgtcctcagaac
cattatttttgacgccactgaaaaataggctgttacaactctccccctta
gaaaattttgtcctcgaaatttctcaccttataatagttttgattattgt
gttctcatagattcttcaattttccaatcaaatctatcctgactagcttg
ttctcgcaaaattgaattggatgatacaacactgtaatatgttctcttaa
atctgaagtattttttttgactgtctatttgtctgtaccatagtttcttg
tatttcagatacatataactcaactagctttcaagagagtaacctatttt
gatcggaaataaatgaatcaatttagtttgacaattataacctggattga
ttctttctttcatagcgtcaaaaatagtctagatatagaattcatcgtga
ttcgtcttcatatcaaatcagaaatcaaaacaatccgtaataacccagac
attacttgattttcaacttttctatactagatatctcgattcaaactcca
aattttcacattttatttccaaccatcaataactttgtttcaagtcattt
cacagtttgtcacacttgattgaatcaagcaaacactgcattaagcctct
cataatatgtctcgtataatctcagatttgttcaatatatatatttgatt
taaaaaatatagattatcatcataatcagtattgaaattagtgatttgat
cattttgattttgttcccgttcaactaacaaagtaggatcttttccttgt
aacccacaaattttctgaagaaataacgatttaactttcagctccatgat
aaacaaactagcataaatcaaaatcatctgactgaagcattactatattt
aatgagttcctccttggactaaattggatcagtagcggagcttctatcaa
taacatctctattggcacttaactgatcaaacaaattcaacgtatctcta
taatagcttcatcattggtaataattatcgagaaattcttaataaatcat
ctgtcaaaaagtggttgagaaacctgattcaccaaatcctcaaatgctac
aagggcatatttaattcgaaagacataactagaaactcatagtgtccgta
acatttttgaatgttgttttcagttcatctatatctttaactcacaattg
atgatataatttatacacaatcccatcgacccatctttctttttcacaaa
cagaataggtgcgccccaaggtgatgtactcaatcaaacaaaatctttgt
caattaatctttgcaactaatttttttaattctttaactcaattggagcc
attatgtacagagcaatcaaaattgaagcaatcactgacattaattctat
aatgaactcaatgtctcgctctagcagtaacccagcaattttgcaagaaa
aatatatataaacttgcatgctgttgataattgattgactttcattttag
atattctataatccaggatataaattaaaacatatcaaaaccattttgta
taaatttctgtgcagataccactggaaccatattcataaaataatcatac
atagcagattcaatgaaaatcaaatttgtttctatcggtaattcattaca
acatcataaacagtagctattttttcccaaagataacgtcatatttatta
aaaacaatacatcaatttaacagaaaaatcgtaactctaaattctcagtg
aacactatttccagactaaaacatatatgatactttagcctaaattattt
gttactttaataacatattaaagcgacacaaccgataaactcttttctgt
tactaacttagtgcacatataatagtgtctttaccaagagtcaacaaatg
catacagtaacatcaaaggtaagaaagataccaacaaaacatcaagagct
gaggcttccacacgtgctcaaatcacctaaattccagtgagaactcaagc
tccagatcgaaccgttattctttttttcttcttctattgactctaacagt
gcttcaaattcctggtagtccacctctcgcaaaagtaacaacaggttttt
tttgttcagatctcggttcaactcaactcgaatcgggcaatctttattaa
aatgatcaggaaattcaaaaaacaaaacatgatccttcttttaatctaca
tattccagaatgattctgggcataacgatcacattcaaatctaatcacat
tccgaacactaactactaaaatcattgatggtcttacattactttatttc
aatttatctttactagaaaatcctaataatactgagaaacgattattaaa
ttccttctcttttttggcgagaaaatagaaaacattctgaatatattatt
ttattgcaatctcaaactctcatcttgctctgtttcttgtgattacaaac
ttattctgtttcctgagctcgattaggtaaaactatgaagtaacaaaatt
caattgtatctacaagcattttgatctcatcattgaatccatcatcaaac
taattacataattcctcttcaatcggtaccgtctcatagacatatttact
gagctaaacaaaccctcacccaaaatctacaactgacctatttcccagct
ttaactcaggaaattcattttcatttttttcttgcctaattgtcgcttgc
tgacaattctttcagaaaccaattcagaagaaatcctaattaatctgttc
tttcgataccataatagttaaagttgattaccagagaataactttcttct
tttaacagtaacacaacacacctcagataattcttgaaagagcacaacat
ttgtcacatcccaaaaattgggttagtagaaattaggttaatgaaccgag
agtgttcacgagcgaatttttatttagataatattttacttatttgataa
taaataattatcaattatagtgattgagtaatggtggagctgtccttgat
tatatgagttcgaacccctcccctctcattaatttctttttggtgcaagt
ttgttttaaacccttagcaaaggtcatcctatgtttttaaatattttctg
ttaaaataaaaaacaaggaagtaaagtggccaagtggttaagtgctccta
agctattctagaggtcttaagttcaagtccctttgtttttatctttttat
ttaattttcaacacaaaaatcgatgtgattattaagcttgtcatccaccc
tatagcttccatgaataggaggattcctttcctccattttgggtcaaaca
taccataagttgaatgagcatgatcccattttcactccatgtctccctct
cttaccatttcatctcacccttgccatagtagagatttattgaacctaaa
cttagttgaccaacctttcctcccactcacccacctatcattgtcgcccc
ctcctcctcctcctccatattctttttatttcactccgttctcacctatt
tttttcttcttttttttttgcaacaccaccaccctttctactttttactt
taacttcctccactatgaccgaaccctccaccattgaccaccgtacctca
tggccaccacacctctttttccacctcttcctcttcccgtcgtcgcccat
caccaccgtgaccaccacgacaaaccatcgtggttttcttttctcttgta
ttcctctttctttcatcataatatttcacctttgttttatctaaccttca
ttgtttcttttactacacctttcatcggactatcgcagtagtcaccaaac
caccaccgccaccgctgttggttttgttttcctctttttctccacatttc
ttttccattattttatttttattaatcttataccctctcactttaatagt
tctttaagatcacccaactctccgatctcgtgtctatattcatccatcgt
tcatctcgaattgatcaagtgtgtaagtaagggttatttaatcataaaca
catcctcttggtgatttcctcttttggtcgaatggtatagtagtcatagt
aattattgttatttaattattcacgtattaatactatcatttatgctctc
taaagttccaatcaataataatagtagagatccttaaactttggatcaaa
gatcgtagatttgagtgtgcaaaccgtgaggtaagtgttatggtcagatt
tttagtgatcaatctattaataataaatatttttcgatcgattctaacca
atagatatcatttgtgtgtttagatacatctttcgagtttagatccaagc
agaatcaattgtaacaaatcgtttttcagtagtttcagaaacagtggttt
tggggccaccaaatctgacgagtaagttcgtaaatattattatttaatat
ttataagtcaaatgtgattttaaaaagttttttgatttgataatttatat
tatataagcgatttattaagttcaagtggtaagaccctaaggtcaagtag
ttttagaaaataaggtatcgggacctcgtttctataaaatgagccgtaaa
tatttttataaatatttacggagtgtcattaaggttctattcaagtttag
atgaaaatttttaatgtttcaatatttaattaattaaaaaggactaaata
ataaaagttgaaaaagtcaatcgctattagtttaaagatgttaaattaat
taaagaattataattagatggccttaatgggtaaattacccattttcaag
ttggtggacagttaaagctttaaattttttaaatttatatgtttatatga
tatttttattattaaaataaagaaaaaaatattaaaaaaaagaaaacata
atcttttcttccccattttgcatttcatcaccaaatttgccatggaaata
aaaagggagaagcttaaagcttcagctttcacttttaagatgtatgtaag
tttgttttagcctcgtttctaataatttttatctctttaagattgttgca
actaggtccagctagcccgtaccttcgattttgaaaatgttaaagatttg
aaatgttgccattaatgaatctagagatttttatgttaaatgatgaattt
gaaatattatttttccttttaagcattttgttaagtgatttttgatgaat
ttatctattacggactgacgaatccttttagtttcgtttcannnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntggggggct
ggtcgtatcagcttgattcgttcccgcttaagttccaatctccttagaca
gaattgattaaatgtaataagttaagaaaataagttctaattatttatat
atttacaaaatgagttcatgaaaaattaaaggtctgttaatttgagcgag
gattcaactcgctcaacttcaccatcctagtagtgtttgagacgttgacc
attaactttaaatgtacctccgtaattgttgtataattcaatagatccat
aaggataaacatggtagatggtataaggtcctttccatcaggatttaagc
ttcccaggaaataacttcaaccttgaattaaataacaacaccttctgacc
ttctttaaactcgcgaggttgtatatgactatcatgccatctctttgatc
tttctttacacattttggcattctcataagaaaacaacctcagctcttcc
aactcatcaagttgtaacatccttctctcaccggcttgcttaagatcaaa
gttcaactccttcaaagcccagtgagctttattctccaactctaatggca
aatgacatgcctttctaaagactaaccgataaggagtcattcctaacgga
gtcttaaatgttgttcgataggtataatgcatcaccgagccttcgagacc
aatcttttctgctagggcgtactaccttttcaatgatacctttgatttcg
cgattcactctttcaacttgcccattagagtgggggtgataggcagtagc
aatcttgtgcttcacatcatatttttcaagcaaccacttaagccatttgt
tcacaaagtgagaagcttcatcactaataatagctcttggtgtgccaaat
tgtgtaaacacatgcttatgtaggaatcgcatgactaccttagcatcatt
tgtagggtatgcttcagcttcaacccacttagatacatagtccatagcaa
atacgatgtatttgttctcatacgaagaaggaaacggggcctaaaaagtc
aatgccccatacgtcgaacaattcactctccaaaatgtttgtcaagggca
tctctttcctccttgatatatttctagtcctttggcatttatcacagttg
ttcatataagcataagtatctttaaatagtgtaggccaaaagaaacctgc
ctgcaaaatctttgctgcagtacgtgaaccatcaaagtgtcccccgcttg
gagatgaatggcaatgatacaatatctcagcaatctcgctttcaggtaca
cactttcggattatattatctccacaatgtttaaacaaaaaacggatcct
cccaaagataataccgactatcatgaaagaattttttcctttgttggtat
gtcatttctcgaggaattattccacatgcaagataattggcaaaattagc
aaactagggcatttcatgaattcgatttacctcaaataagtgttcatcta
ggaaattctcgttgataggcacacatgactgagttacctcatcttgctcc
aacctcaacagatgatcatctatttgattttcgacaccatttctatcttg
gatctcaaggtcaattcttggagtaaaagtatccaatgaattagccttgg
ttttgcatctttcttcgtgagcaagtatttaatggccgcatggtcagtaa
atactgtaattttggtacctataagatatgagcggattttttcaaaagaa
aaaactatagtgaagagttccttttcggttatcatataattgcgttgggc
tcccatcaaagttctacttgcatagtaaatagggtgaaacattttatttc
ttttttgacccatcacagctctaacgacatagtcacttgcaccgcacatc
aactcaaaagttgagttcgaatcaggtataacgattattagggctgagat
taaccgcttctttagctcttcaaaagcttccaaacatgctttgttgaaat
caaacaatgtatctttctttatcaacaaacacaacggtttagaaattttt
gagaaatctttgataaaccttcgatcaaaatctatatggcctaaaaaaat
ttatattcctttcacattcattgtggccggtaatctttcaattacgtcca
gctttgctttatcaacttcaattcctttctttgagatctaatgacctaag
acaatcccttccttgaccataaaatgacatttttcccaattaaggacaag
attcgtctcttcgcatctcttcagtaccttagccaaattactcaaataga
tatcataagtgttaccaaaaacagaaaaatcatccatgaaaacctcaaca
aaattttcaaccatatcagtaaatattgccatcatgcatcgttcaaaagt
tgcaggtgcattgcataaaccaaaaggcatttgcctaaaagcaaacatac
cgtatggacaagtaaaggttgttttatgttggtcctctggagctacaact
atttggttatatcccgaatagccatctaaaaaacaatagaattcattacc
tgccagtcaatctaacatctgatccataaaaggcaacagaaaatggtcct
tccgagtggttttgttcaactttctgtaatcaatatagattttccaaccg
gtaacagttctcgttggaattaactcgttatgatcatttttaacaatcgt
gattccacctttctatggcacacactacacccgacctacccacgaactat
ttgaaataggatagataattcttgcatctaaccatttgatcatttcattt
ctcacaacttctttcataataggattgagcctcatttgcccatcaatttg
agctctttcaccttcttataaaatgattttatgcatgcaaaaaaagaagg
gcttataccttgaatatcagctatggtccaaccaattactttcttaaatt
tctttaaaacaacaattagttgctcattttgatctttcatcagttctgct
aaaataatcacaggcaaggtagaataatcacctaaataaacatatttcag
ataggaagcaagtacatttagttcgagtttaagtagttcttcaattgcca
acttgggttgcacaaattctctgacttccagctccaacggttaaaccgtg
tggattgaataaaatttctcggattggcttccatcaaagccatgttttct
tcacattcttcatcctccaaaaggtcaagatctaaggctttctccaatgg
atattcttcaaaatttctttccatagaaaccaaggtttttatctcttcca
caactgaacactcctatgtcggattgggaaatttcattgctttaaaaatg
ttaaaggttacctgattgttttaaacttgcatggtgagttctcctttctg
cacatcaattaacgtttttcccgtggctaagaaatgtctcccaaggatga
tcgacagttccttgtctgcttcaaaatctaagacaatgaaatcaatagga
aaaataaatttatcgacttttaccaaaacatcctcgatctttccttcggg
atatgctaaagatcgatccgctagctaaagcatcacaattgtaggtctta
cttcacctatccctaacatcttgaaactagactaggaatcaagttgatac
tcgctcctaagtcacacaaagcattaccacagtaagatttcggtggcaat
ttgttctgcaggaacgcactacactcctttgtcaaggcaacagtctccta
ctcactcagtcacttcttcttagataatatatccttcataaacttcacgt
aattcggtatttgttctaaagcctccaccaatagaatattgatgtgtaac
tgcttcagaccattcaaaaacttcttgaattgcacctcctgtttcagctt
gttttgctataatctttatggatatcgaggtgatggaacttccggttgaa
cctaaaaacctttctgatagagggttgcacgtggaccaagatcgagttgt
caagtcacgggaaaattcttacgaggctctagacgatcggatctgaaaat
gaaatagaaaaataagattagattcgattagatctgaatagatagtatcc
aaaaaaataaagaacagccaagaaacaaatgcccttaagaataacaaatc
ttggatgtcaagaacacggattggtaattgaattaaaccccaatctgccg
aatctgaaaagaacaatcacaaacagtaagttaattttaaaagtctagca
aattgatggaataaaacataaggtatggccggcaagaactaaagaaagat
ttaagaatcgaaaacggttcttggagcccaaggagatgtcggtttgccca
aattgagacagtaaattaatttcccccaaaattccagcaaccgaattcaa
ccagatttgaaaaggagaaatcggcaagaacaatggaatttagggatctt
gaatcatctttgctgccaagaacaaagggggccgatccgattttgaatga
tgaagagatcttagagttttggaaaggctgaaacgcaacaagaacagcaa
ataagttagttaataaaaatcgacacgagcagaatttaaaagataggatg
aacagcaagaaataaagataaagtcctaagaagccttgaaatcccgtaag
atttcacaactcccttcaaacggctctaatctcccctcgaatgaagatca
atggcaagaagaaggctgaagatggctcccacaatcaaaaagattgttaa
aacaacttctaaagaaaactcaagagaaaatttttggagaactcaaagag
aattttcactcaaaaacaaattgaaattttcaaagtgtttctaatgtgtt
tacaagggttgctagccatgcctatttataggccttaatattttcctaat
cctattagaaaactaaaactaaaaaaactcctaattaaatattaaagaga
aattcggtcaagggccttaaattgggcctcttggactgaataattacata
aaaattaatttagaaagtctaaaattgaaactaagaattaaatttttaca
aattgggccactttaacgatttgcctgattttcaactaagtatgattttg
acttcttggttgggcttggaatcgtcttatttggccttgccttcaagaac
ttgggcttgtagtccatctcctaccgaaattggttcgttgatgctcgtaa
cggagatccaatgcgccttggctgcaagattcggtttcttggaccaagat
ttccaagatttgaaatcttgattttcttgattcttgaaatcactccaaac
agcaagattgggccaagattcggtttcttgattttcttgaaaacaagaaa
gtgaatcttgattttctttttctttcgtgtatgcatctaaggccttgcta
acaaattcttgaatggtcccatttagtatggaatgcatttgtcgggcctt
tgacctcattattgggccttttggtaatttgagcccatcacgttcttggg
ttgggcctttgtgactcgtatcattccccccttcctcgaaaagattcgtc
ctcgaatctaaaaatcaaatggggacaagtcagccacattaaaagtagaa
ctcacattgtactcaccaagtagatcaatcttatagggattgtcgttgat
ccgctcaagtacttggaaaggctcattgccccttgggtccaacttggaat
ttctttttgtaggaaatcgttctttcctcatatggacccaaacccaatct
ctgggttctaggacaacccgtttgcgccccttgtttgctttgttggtgtt
gacatcatttgttttggctattcgttgcctagccttctcgtgtaaggatt
tcaccaactccgctttctgttcaccatcttaattaacaatgtgttcaagt
ggtaatggcacaagatcaagtactgttagtgggttaaaaccataaacaag
ttcaaatggagaataaccagttgtagaatgaatatatctattatatgaaa
atttaacaaatggtaggcattcttcccaatttctaatgttctttcccaca
acagatcgtaacaaggttcctaagattcgattaactacttcagtttggcc
atcagtttgggggtgacatgtagtagaataaagtaatttcgtaccaagct
tttcccacaataccttccaaaagtggctaaggaatttgacatctctgtca
gaaacaattgttttagggatgccatgaagtcttaccaccttcttaaagaa
taagtctgccacatgtgtagcatcatctgttttgtgacaaggaataaaat
gtgccatctttgaaaacctatcaacaacagcaaatatgctatctcttcct
ttcttagttcgaggcaaacctagaataaaatccatggataagtctatcca
aggtgaagtaggaattggtaaaggagtataaaggccatgaggcattacct
tagattttgcttgtttacatgtaatgcacttggaacataccttttcaaca
tccttcttcatatgtggccaatggaagtgttcttgcaagatgtctagtgt
tttggccactcaaaatgtcccattaaacctccactatgggcttcatgaat
gaataagtctctcatggaacactttggtatgtagaacttgtttatacgaa
aaagaaagccatctacaagataaaaattttcaaaagtagtatgtccacaa
ttcttatagaaatggtcgaaatcagcatcatcatcatataactccttaat
atgttcaaaccctaagactttagcattcaatgtagttattaaagcatatc
gtctagacaaagcatctgcaactacattatctttacctgttttatatttt
atcacataagggaatgttttaatgaattctacccatcgggcatgctgttt
actcaacttaccgtgtccctttaaccatttaagggatttatgatctgtat
gtatgacaaactcattaggcagcaaatagtgttgccatacttgaagtgca
cgaaccaatgccaatagttctttgtcataagttgagtagtttaattgtgc
accgttaaatttctcactaaaataagcaattggttgcttatcttgcatta
aaacggcgccaattccaattcctgaagcatcacactcaagttcaaaagta
ttagaaaaatcaggtaatttaagaagaggagcagaacataacttagcttt
tagggtctgaaaagccttttcttgggtttcaccccatttgaaacccacag
atttttttatcacctctgttaatggggtagcaatagtagagaaatctttc
acaaatcatgtataaaaactagctaaaccatggaaagatctcacctcagt
tactgatttaggagtcgaccactccttaattgccttgactttgtcctcat
cgacatgaataccttgagcactaactatgaaacctaagaatattagataa
tcacaacagaatgtgcatttatcaaggttggaaaataatcttttagctcg
cagaatatccaaaacggttttaacatggaaaacatgatcatctaatgtca
tggagtaaattaaaatatcatcaaagtaaactactacaaatttacccaag
tgaagccttaaaacatgattcattaatctcataaatgtactaggtgcatt
agtaaggccgaaaggcataactaaccattcatacaatccaaatttagttt
taaaggttgttttccattcatccccttccctcattcgaatttgatgataa
tcgttttttaaatcaattttagtaaatatgattgagacatgtaattcatc
aagcatatcatccagtctaggaattggatgtcgatactttaccgttattt
tgttgattgggcggcaatcaacacacattcgatacgtaccatctttcttt
ggtaccaataagacaggaacgacacaatggcttaggctctcacgaatgta
ccctttgtctaataattcctcaactttcctttggaattcctttgtctcct
cggattgcatctataggctggtcgatttggtatgaagctccagacgaatc
aagctgatctcagtgtccggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnngcttgatgaatcagcttgattcgtccatgc
tcaaataagttgatatgagatgtcatacttatttgtatatcgtagtctgc
ttaagatatcaaggaacatggaatggactatgcaagtgtgactattccat
gacttgtgtccaatccagagataaaggacttaaggattattgcataaaag
gttaatcataaaaaatgttatgtcgaatcatgatttcttgtgacttaggt
agcaatgatgcattgctagatgccactcattgtttgtaacattggaatcg
ttctagtattactgctaacgttataggaacctacaaggtcacaccctata
gttgaaatgaacggaataagctatagttggtattgtctttgggggtcgct
tgaattaaattaattatagaattaatttaattcggtaatcaaatttccaa
cacattatgtacaaggttgttgtacgcataatgaggacatgaatttggtt
agcatatgaatttgaataaatatatggtttaccgaaattatattataatt
aatgtaattataatttttagtttaaaatattattatatttatttaattcc
taaaaaaccctaaaaataaaatatttataaggatcccgtttttcctttgc
ttgggtctagcagccgtcaaagaaaaatcactttcaaaactgttttgggg
atttcttccgttcgtagtcaactgggtggattacatagaggccgggatca
cgatagattgtgacagcagatcagattactcgttgctgagaagttactgt
ctactctgaataaacattaggtaatttcgcaaccttttcaccccgattcg
ttcctcacacatggattcttggttgggatcgccgaattattattttttcg
ctgcaccttaggggtgccggtgatccaacagtggtatcagagccacttgt
gtgatacagactcgggtttaaatacttggttgacgcaattgtatgagatg
catgcttcgattttattaaatttctgactgtttgaatcgtttaagagtaa
cttgataaccgctccttttgaaaatggattaaatgttaatcatggtgtta
tggcctattcggttttatgttattactgttagatgttaatagatctataa
tggtgcgacggtggtgttgacagtttccagtaagagttaactggttagtg
gaacaagggttgtttcggcatgaaacctcagggattaaaatcccgaaaac
gcgattctgttgataaaagttatcaaactgtgagttttcatttgaatggg
gtatgcagttcgtaccgcaggggctccgctacctccaccgcctcagtccc
catcttcttaaagtatgttttataataaataaaacttggtgggccataaa
agttgaaaggatatgttttaatacaccttaacaaaagtgtttatttatgt
atgctatttttgacatgcacagtgtttgaaatgcatagttatagcccgat
agcccatttgataaaaggttgtaattttataaatacggcctgcgtgtcgt
gccttactactattctcttgtatttctcttctcatcttactccctcgtat
gtaaaatgagtttctacatattgtaatttgcaagagttgctttgggctag
ccaagaaggaagatgagccaaccagtgtggactgatagcttgaaaaccgg
cttacacctttaggtttccttttggttctcccattggctttggttgcgcc
accttagtttatgggctataactattgcatttatttattcctttattcgt
gtatgagatgctatggatgtctaaagcatgccatattttaaacatgttaa
aatttgataataatgaaccacattaattgatgagaccaattaaatggcta
aatggactaaagtaaaccataattagtgagatggaacgatcttaataaaa
tccctctattaaaaaattaaatcaacatagccttccaatttttccctcgt
taaggcctccatcaatactgtgtaggttctgctaaagcgaagtactagta
tttatcttggttaaacgcaaagaataaacaagtgatatttgctggttaaa
attggttaataacttaactaggttattctaataggattagaaacctagag
gcaagtaatttggataaatcataagatgattagaacaagagttgttcacc
aaactttaggagttacatatgatgtaattagcaagtgttgcttacctaga
taaccataatcttgagagtaaagccaaagctgacttaagaggtggtgaaa
tatggatccttaacccacttgaaatgcttttcgagaaagtctttccgaaa
gtaacgtatgagggtattagttttgtagtaaaatagtgggaacatcattt
aattaagtccttttaatgattgatataaatttgataaattttcacacgca
taatttcattgttgtagatatattgtggctgcaaacacaaatacattacc
attgcgatcggtccttgaaaagaacaagttgaatggtttaagttttcttg
attggttccgtaacttgaggattgtcctcaaacaagaacaaaaattatat
gtcattgaacaaccagttcctaacgaaccatccgctaatgcctagagggc
tgatagagatgcttacaagaagcatctcgatgacatggtagacattggat
gtcttatgcttgccactatgaatcttgagcttcagaagcaacatgaggac
atggttgcttatgaaatgattgagcacctgaaagaactttatcaggggca
agcacggcaagagaggttcgatatctctaaggccctattccaatgtaagc
tggctgaaggaagcccagtaggacctcatgtccttaagatgattggctac
attgaaagcctgtctaagcttgggtttccattgagccaagagttggccac
tgatgttattctgcaatcattgccggatagctacagccagtttgtcctca
attttaatatgaatgaaattgataagactctgccacagttgctcagtatc
ttacgatctgctgaaagcaacatgaaaaaggttggacccaagcctatagt
gatggtccataataacaagggcaagggaaaggccaaaattcggacaaagc
ccaagggcaaaggtaggcctaagcctggaaaagtaaaggctgcattgaaa
cctaaaagaggggtggctaaggaaggaaactgctttcattgtggtgtgac
tggacattggaagcggaactgccctatctatcttgaggaagtcaagaagg
ctaaaataagcggaacgtctgcttcaggtatttatgttattgatattaat
ttatcaactactacttcatgggtattagatactggttgtggttctcacat
ttgtacttctgtatagagactgcaaaggagtaggactttggctagaggtg
atgtggacctacgagttggaaatggagcaaaagttgctgcattaactgta
ggaacatataatttatctttgcctagtggacttggtttatgtttagagga
ttgttaatatgtgtccagtttgactaaaaacattatttcaatttcttgtt
tagacaaaattggttttgggataattattaagaataattgttgttccttt
tatctcaataatgttttctattgttcggcacaattgattaacggcctcta
tattttagatcaaacaaatcccatttacaacatatatactgaaagatcaa
aaataaatgactcaaatcaaacttatctatggcattgtcgtttgggccac
ataagtgaggaatgcatatccaagctccataaaaatggtttcttgaattc
atttgtttttgaacaatttgaagtatgtgaatcttgcttattgggaaaaa
tgactaaatctccttttactggtaaaagtgaacgaactaatgatttattg
ggcctaatacattctgatgtatgtgggccaataaagatacaggctagagg
aggatttcactacttcatcactttcactgatgatttcagtagatatgggt
atgtctatctcatgcgccataagtctgaatcccttgaaaagttcaaggaa
ttcaaaaatgaagtacaaaatcaactaggaaaaacaatcaagacacttcg
atgtggtcgaggtggggagtatatgagcttagagtttgatgatcttttga
agcaatgtgggattgtctcacaacttactcctcctggtactcctcaatgg
aatggattttctgagagaagaaatcaaactttgttagacatggttcgatc
catgatgagtcatgctggtctgtcgacttccttttggggacatgcacttg
aggcagctgctttcacactaaatcgtgttccatctaaatcggttcaaaag
acaccatatgagatgtggactgggaaacgtcctagtatgtcttttatgaa
aatttggggttgcgaagcttatgttaaacgtcagacgtctactaagcttg
aacccaaatctgaaaaatgtgtttttgtggggtatccaaaagaaaccaaa
ggatattatttctttaatcccactgagaacaaaatacttgttgctcggac
tggtgtcttcctagagagagaatttgtttctagaaaaggaagtgggaaaa
agattgaacttgatgaagttcaagaatcacaaaataccactgaactagag
atagaacaacagcaagttccacaagggattgaagaacaagtaattgttgt
agaaacacaaccaccgcgtagatatttaagagaacgccaatcacctgaga
gatatggatttctcattacaatgcatggtgacattctaattatagatcaa
gatgagcctagaacttatcaagaagcggtgacgagcccagactctaagaa
atggcttgaagccatgagatttgatatggattccatgtatgaaaatcgac
atggatggtaatgtacaaacatacaaggggcgattagtcgctaaaggttt
tcgccaagttcatggtgttgactatgatgaaaccttttctcctttagcta
tgtttaaattcatcaggatcttgctcgctatagctaaatttcatgactac
gaaatctggcagatggacgccaaaacagctttcctcaacggaaaacttga
agaggatgtgtacatgacacaacctgaaggttttgtcaatccaaaggatg
ctggaaaggtatgtaagctacaaagatccatttatggattaaagcaagct
tctcgaagttggaatcttcgttttaatgatgcaatcaaagattttggttt
tatcaaaaatgcagatgcgccatgtgcttacaagaaagttagtgggagca
ctataacattcttggtactgtatgtggatgacatacttatcataggaaat
gacatacctaccctgcagtctattaagacttggttaggaagttgtttttc
catgaaggacttgggcgaagccacttacatcttaggagtaaagatctata
gagatagatcaagacgactactaggtctaagccaaagtacttacatagat
aaagtactgaaaaggttcagtatggaagaatctaagagaggattcctacc
tatgagacatggtatttcactctcgaaggaaatgtgtccttcaacttcac
aagagagagaacgcatgagtaaaattccatatgcttccgctattggatct
atcatgtatgtcatgttatgtacccgtccagatgtctcatatgccttaag
tatgacgagcagataccaagtagatcccggtgaaggtcactggaccactg
tcaagaatatccttaagtacttgagacaaacaaaggatactttcctaata
tatggaggtgaggaagagttaagtgtaaaaggttacactgatgccagctt
ccaaaccgataggacaattctcgatcacaatcaagttttgtgttttgcct
taatggtggtgctgtgagctggaagaattcaaagcaaagtatagtagccg
attctacaacagaggccgagtatattgcagccaatgaggcagcaaaagaa
gcagtttggatcaaaaagttcattactgaactaggggttgtgcctagcat
atcagatgctatagaactttgatgtgataacaatggagccattgcacaag
ctaaagaacctagatctcactagcgatccaaacatatacttaggcgctac
catcttattcaatagattatcgatcgaggggatgtagagatatgcagagt
acctacagatgataacattgttgatcccttgaccaagcctctgacacagc
agaagcatgatcggagattgttagagtatacccaaagatcaatcatgaga
tggttgtaataacatacttgatttatcatgtttattaatataagtcgtta
ccattattattttagtttcttttctgtgtgtataaataaactgttttata
ataatgtcctaagaataatatgattattcttaaaagatccttagtcaaat
attattgttggataggacaacgataatgcattaagactaacatgcagttg
attgatgataaagagttgtcattgatatggaatgtcagaatcgatgcatg
aatatgtgtgttagagaataacatattggactgacccattatgagtatgt
ttcttggattattatgtaattgtctcgacattactcatagtgattaatat
gtatatgatcctcatacttgagatcatcataatcccaacatcgtgagtag
tatatctagatacagtcaaacgtacaccgtaactagttgttctataaagg
ctgatgttggatataccataatcgatgtagagggatatggttggtcgata
tagaataagtccctcctacatgataggagtaatatcttaggccacttgat
taagtgagactagaaatgcatggccatgctcaaataagttgatatgagat
gtcatacttatttgtatatcgtagtctgcttaagatatcaaggaacatag
aatggactatgcaagtgtgactattccatgacttgtgtccaatccagaga
taaaggacttaaggattattgcataaaaggttaatcataaaaaaggttgt
aacaccccttactcgagaccgtttccggagttaagcacgaggcattactt
agcttatcttactaattcagagcataaaaatttactttgaaaattaattt
cgctatttacagcaaatctgtccaattgcgcagtagttactaaattgatt
ataactcgagctacaggacttaaaatttaattccgtaaattttccctaaa
actagactcctataacttcctaccaaaaaatttttagcatttttggctta
gccaattagtacagtatattagttaaagtatcccctgtttcaccattcga
ttgttctaacctcttgttactaaaaatagattctcattataggattttca
tttggtgttcccacttgttcctacagaaaatagactcattaaggaatcta
agaatataaaatataactcataaccatttttgtataatttttaatgattt
tataaactcataacaggggactccaaaaacatatctgaccctgtcgcact
aaaattcacatatctcaaaatataaaattccttttgttaaacgattattt
ttccataaaaatagactcaacaagatttaattccatatatcattcacttt
ctaattcattttataccatcctaggtgatttttcaaaataacgtcactgt
gctgcttgaattctatttctctacaaaaattttacccatttcatgatttc
catgcataatttatcacctacactcttataacaacaaacagcttcatact
taaccatttttaataatcattcatcatcaaatagttacacctcattcttt
agcaaaatcataattacaaacaggcaaaataactaaatccctatacatgc
cataactcaaacgtgtttcatcataaaataccgagcagttgtggttgatt
gtgtggaggatctccgacttctttaggatccttgaagtagccttgcaata
ctataagagaaagagaaataaaagaattaagcataaagcttagtaagttt
actagcaaataaataacaacattaaacacaaataattaaactcaagtgtc
tatatctctagtttactctttagataatctcattctagttctcttgcttg
ttttcttagtatacttgtatgtataacttactcttctcttgctgcatcat
tgaatatcaattggtaatataataaattcttaactcctataacttacccg
agcttgccatttatgtttttaaacgaactttcctgaacatgattcgttta
ttagcccgttgagttacattggaacaataaggatactcgggtctcttctg
gtaaaaacatgccaaagccatgtcccagacatggtcttacatgggatgtt
ctcatgttggtgcccataccatgtcccagacatggtcttacgggggacct
ctcatctaggtgccaacgccatgtcccatacatggtcttacatgggacct
ctcatctcggtgcccatgccatgtcccagacatggtcttataggggacct
atcatgatctcaaggatgccaatgccatgtcccagacatggtcttacatg
ggatctctttacccaaatgtcatgacatttgtatccaatactttccttat
gtatcaacgggatttttttaatattaattctttatcattttatacttgaa
tcataatgaaataaattcatggaataaattcatagttgctagaaaatagc
agaattaataataattattgaaatattgcatttatttactgtaaacttac
ctcggtaccaaatatagcccaattcaccaacttagtcttcaactttattc
ttccctttgcctaacctcaagtttcattcttcttgattatggagcttgga
agcttgaaaaccctaactatggcttccccacttgctgatttcgtccaaat
gaagaacatgagcacaatttgccatctttttcccttttaattcattttaa
ttactagattaccaaattgcccctaacttaaaaattttctatttcactta
tttcatgtccatttttgtctaacaacttaaccaatggtctaattatcata
taaggacctccaatttaaagtttcataacaattggacacctctaacatgt
agaactcaacttttgcactttttacaatttagtccttttgactaaattga
gtgcccaaacgttgaaactttcgaacgaaattgtcacgaaatcattttgt
gaaattgtagaccataaaaatataagaaaaataatttttttcctcatcag
atttgtggttacgaaaccactattctgacaaccttaaatttgggacatga
caactctcccccctttaagcattttcggcctcgaaaatcttaccagtaaa
gaggttcgggtattgtttcctcactgcttcttctggttcccttgttgctt
cctcaatcccatgcttttgccataacactttcaccagatttacctttttg
tttctgaactccttcgtttcccgtgcttatatcttaactggttcttcatt
ataagtcatatccggctgaatctccacttctatcggagtaataacatgtg
aaggatctgatcgataccgtcgtaacatagatacatgaaaaaaattatga
attctatcgagttccagtggtaaagccaatcgataagcaaccggtccaat
tctttctatgatttcatatggtctgataaatcttagactcaatttacctt
ttcgaccgaaccggagaactttcttccaaggtgtcgcttttaagaatact
ttatcaaccacctgaaattcaatctcttcatgacgaatctctagatcgta
atannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnattttcccgaatcacctttactttttcttttatttcccagattaaat
aaaccctgtgtatcttcttttcactgagctctgtccaatataacggtgtt
ctacactttctaccatacaaagcttcatatggagccattttaatactgga
ctgataactgttattataagcaaattcaatcaaaggtagataccttttcc
caattaccttgaaactctagtacacaaaatcggagcatatcttccagtac
ctaaattcacgctcagattggccatctgtctgaggatgaaatgcagtact
gaaatgcaactgagtacccaaagctttttgtaatttttcccagaaacgag
atgtaaattgggggtctctatctgatataatggagacaggcactccacgt
agtctaacaatctcagatatgtacagttcagccaatttatctaaagaata
atccatacataccgaaataaagtgcgcggactttgtcaatcgatcaagaa
ttacccaaatggcatctttcttcttcggagacatcgataacccagataaa
aaatccatagcgattctttcccatttccattctggtatagtgattggctg
aagtaaccttgaaggtacctgatgttctgctttaacctgctgacaaacta
aacatcttgatacaaactcagagatatcacatttcatacccggccaccaa
tacatctttttcagatcattataaattttattactccccggatgtacaga
catagtactgctgtgggcttcctgtaggatcttctgtataagcccaaaat
tcttcggtacacatactctgtctctgaataataaaaaaccatcagtccta
gtctgaaattctgaatcattaccggatttacaatgtacccgtttagcctg
taacttctcatcatttttctgagcttcacaaatttgttgagaaatatcga
tttagctctcatttcagctatgattgaaccatcatcagtcagtgacaacc
gggcattcatagcttgtaaagcaaatagagatttttggctcaaagcatca
gctaccacattagccttacccggatgataatcaataaccaattcataatc
ttttatcaattctagccacctgcgttgtctcaaattcaaatctttttgtg
tcatcaaatatttcaaacttttgttatcagtataaatatgacatttctca
ccatataaataatgctgccatattttcaatgaaaatacaatagcaactaa
ttcgagatcatgtaccgggtagtttctttcatgtggcttaagttgtcttg
aagcataggctattgctttatctgctttcatcaaggcacaacctaaacca
tttaatgatgcatcactataaataataaattccttacccgattcaggctg
taccaatacaggtgctttcatcaacaactccttcaatcaatcaaaacttt
gctggcatttatctgtccattcaaatttaacatctttctgtaataaacgg
gttattggagaagctatcatagaaaacccctatacaaatctccgataata
accagctaaacccaagaaacttctaacttcagatatattcttcggtggac
tccaattgacaatagctgaaattttacttggatctaccctgataccttct
gcagatacaatatgtctgagaaaacctacctctcgaagccaaaattcaca
tttactgactttagcataaagcttcctttcacgcagaatttgcaacacta
ttctcaaatgttctgcatgctcattttcatctcgagaatagactaaaata
tcatcaatgaaaactactacaaacctgtccagatacggtatgaatatccg
gttcatcaaatccatgaatactgcaggtgcatcagtcaacccaaacggca
taaccagaaactcataatgcccgtacctagttctgaaagctgtctttggc
acatctgactttttacccgtaactggtaataacccgatcgaagatcagtc
tttgaaaatactgtggcacctttcagctgatcaaataagtcatcaattcg
aggcaacgggtacttattcttaatagttaccttattaagctgccaaataa
acatcatacccttttctgacacacctctgagttgacattactaaaatcac
atcagataattcctctgtctgatcggatttaacctgaagtaattctccat
tctggcacttcaacataacatatttctgtttacagtttactactgcatca
tgctgagttaaccaatccatgcccaatattacatcaaactcatcaaaagg
caataacatcaagtaaaccgggaaacaaataccttttaccatcagtggac
aatttttacaaactttatccaccatcacaatctgggccagagggtttgag
actttaaccacaaattcagtaggttcaacagacaaatttttaacaaatgc
taattttgtgcatatgtatgaatgtgtagaaccaggatcaattaatgcaa
taacattagtgtcatagagagaaaatgtacccgtaattatatcaggagag
gacgcctcttcactcgtaggaatagcatatgttctcgcaggtgctctaac
atctgatctaactactgaatctctggatgcacccctattactcgctccca
ctcctggatttctttgtggtctacctctggtaggagcatttcctaatctc
gcactcgttatctcttctcttttagttgtttcaggacaatcctgaataaa
gtgatctgatgctccacatctaaaacaaacattttcacctgctctacact
ctccggggtggcgtctcccacattgaggacattccagcctaggaggccga
gtactacccgtgcttacaactgtagtggtttgagctctagaaccctcaaa
tcttctgcccctgcttcagctagaatagctaactgaaaaatgtgatccgc
tagagagctccctaagcctcttagacatagactgaaatgatctactcatt
tgcctcttctttgtatcgtccacttcagcttcagtttttcctttcttttt
ttcttttagcaaatcttctactttacaggctctctcaactaaaacaacaa
actctctaatttccaagacacccactgctaatcaaatatcatcattaagc
ccttcttcaaatctcttgcacatgtttacttcagtagacacaaattcccg
agcatacttactaagtctgacaaactcgtgttcatattcagtcacagaca
tcttaccttgttttagctcaagaaactccttccttttctgatctataaat
ctctggctgatatacttctttcggaactcctcttgaaagaaatcccaagt
aaccctctcacttggtactactgatacaagggtcttccaccaatggtaag
ctgaatctcgaagaagtgaaacaacacacttcatacattcttccggtgta
caagataattcttcaaaaaccctgatggtattctcaagccagaattttgc
tttttctgcatcatcatctttcgtagcccgaaattcttcagccccttgct
tcctaatcttatcaacaggtggtctctccctgataactatacctgtagct
gggaagctacatggggaacctacgaatcatgagggggtggaggttttaca
actggattcgtatgaacgaactcaacaaaccaatcattcatggcttggaa
gaaggcttctctagctcctcctccctgtctaactgatgcaggcctttcac
taacattaacacctggtggcgccgtcctttctgatggagcaagcgtatta
ctctctacttcatctatactagctcgttcaggatccataactataaaaga
aaacattttaaaatcgtcaggagtcatcacactatcagaatatataagta
tggcatgtataggtagactcttattcatactgagtatttccgagaactga
ctaaacctgctctgataccaacaaaatgtaacaccccttactcaagaccg
ttgtcggattcaagcacgaggcattacttagcttatcttactaattcgaa
gcataaaaatttactttgaaaattaatttcactatttacagcaaatctgt
ccaaccgcgcaacagttactaaattgattataactcaagctgcgagactt
gaaatttaattctgtaaattttccctaaaactagactcatatatcttcct
accataaaatatttagaattttgtgcttggacaattagtacattttatta
gttaaagtctcccctgtttcaccattcgactgttctgacctcttgttact
aaaaataaattttctcattataggattttcatatggtgtttccaattgtt
cctacagaaaatagagtcattaaggaatctaataatataaactataactc
ataaccattttttttataatttttaatgattttataaactcataacaggg
gactccaaaaatagatctgaccctgtctcactaaaatccacatctctcaa
aatataaaattcctcttgctaaactgttatttttacataaaaatagattc
aacaatatttaattccatatatcattcattttctaattcattttatacca
tcctaggtgatttttcaaagtcatgtcactgtgctgcctgaattctattt
ctctacaaatattttacccatttcatgatttccatgcataatttatcacc
tagactcttataacaacaaacaccttcatacttaaccatttttaataatc
attcatcataaaatagttacacctcattctttagcaaaatcataattaca
aacatgcaacataactaaatccctatacatgccataactcaaacgtgttt
catcataaaataccgagcagttgtggttgatagtgtggacgatctccgac
ttctttaagatccttgaagtagccttgcaatactataagagaaagagaaa
taaaagaaataagcataaagcttagtaagtttactagtaaataaataaca
acattaaacacaaataattaaactcaagtgtctatatctctagtttactc
tttagataatctcattctagttctcttgcttgttttcttagtatacttct
atgcataacttaatcttctcttgctgcatcattgaatatcaattgataat
ataataaattcttaactcctataacttacctgagcttgccatttatgttt
ttaactgaacattcttgaagatgattcatttactagcccgttgagttaca
ttggaacaataaggatactcgggtctcttctggtaaaaaacatgccaaag
ctatgtcccacacatggtcttacatgggatgttctcatgttcgtgcccat
gccatgtcccagacatggtcttacaggggacctctcatctcggtgccaac
gccatgtcccagacatggtcttacatgggacctctcatctcggtgcccat
gccatgtcccagacatggtcttacaggggacctatcatgatctcaaggat
gtcaatgccatgtcccagacatggtcttacgtgggatctctttacccaaa
tgtcatgacatttgtatctagtactttccttatgtatcaacgggattttt
tttaatattaattctttatcattttatacttgaatcaacatcaagtaaat
tcatggaataaattcattgttgctagaaaatagtagcattaataataatt
attgaaatattgcatttatttaccgtaaacttacctcggtaccaaatata
gcccaattcaccaacttagtcttcaactttattcttcccattgcctaacc
tcaagtttcgttcttcttgattatggagtttggaagcttnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncagaacgaatc
tagagattcgtctagataatcatattattctcaggacattattataaaac
agtttatttatacacacaaaaaagaaactgaaataataatggtaacgcct
tatattaataaacatgataaatcaagtatgttattacaaccatctcatga
ttgatctttgggcatactctaacatgattaagctacaacgactctaaaaa
tatagaaatcattaaaaaccgaacaaaaatgcactcacatgcatgcaagg
actatggtcgaaccttggaaagtctttaatggcttccttagatgctaatt
tcagttgaagaagaaagaaagaatgatgatatctttcttttttcttattt
tatgatgttttattaatttaccaaattaacattaagtaatagctttttaa
accattaaaaagatttccatctttgtccactaattatattaatggtctaa
ttaccattttaggctactcacattcaaattccataacaattggtaccttt
tactaatagaatataagttttgcaccttacgggatttaatcatttttatc
aaattcagcatactaatgataaaatttcttcacaaaatttttatgcgatg
ctactatcatgctgcagatcttaaaataataataaaataaattttataat
gttggatttgtgatcctgaaaccactattctaattgggttcccaagtggc
ttcctctatcccgtgacgtttctaaagaaccttcactaaagtcatacttt
tgtttcttaactctttaaaatctcgtgccaaagttctgactgcttatttg
ttatacgacatatcgggttgaatctcaacatctgtcggtgaaattatatg
cgaagggtctgatcagtatcattgtagcatggatacatgaaacacattat
gaatcgtttctaactctgacggtaaagctagctaatacgccactggccct
attctttcgataatctcgtatgcccgataaattgcggactaagcttccct
ttaggaccaaaatgaagaaccctcttccaaggcgatactttcagaaatgc
tctatcgccaatctgaaataaaatatcttttcatttcaaatctgtatatg
atttctgtcaatctaaagctgctttcagaaacttacagatttctttcact
ctttcctcagtctctcgaattaaatcaactccgtgaatctttttctcact
aagctcggtccaatacaaagaagttcaacatttacgaccatataaagctt
tgtatggtgccatctttatacttgactgataactgttattgtatacgaat
tcaaccaacggtaaatatttctctcacttaccttcgaattctaatacgta
aaaacgaagcataacttcgagtatttgaattactcgcttgaattaacaat
ttgtcttgcgatgaaatgcggtactaaaatttcaccgcgaacctaaagct
ccatgcaatttactccaaaatcgtgacgtaaaccgaggatatctataaga
aataataaaaactagcaccccatgcaatatgataatctcagagatgtata
actcagctaatctctcaaaggagtaatctgtacgtaccggaataaaatgt
gctgacttcattagacgatcaacaacaacccaaataacatctttctttct
cggagattggggtaaacccgatacgaaatccatagtaacacgctcccatt
tctactccggtatcatcactggctgcaacaaaccagaaggtacctaatgt
ttagcttttacttgctgacatactaaacatcttgatacgaaatctgaaat
ctcacgcttcattctcggccaccaatacatctattttaaatcattgtaca
ttttggtgctacctggatgaatggacaatctaccataatgagcttcgtac
aaaatcttcctaatcaaatctgaatctcttggtacacaaactctacctct
aaatagtaagcaatcatcagacctaatttgaaaatctgaatcaaaagtca
tctcacataattttcatttagctatctacgcatcatcgcatttctgagct
tcacaaatctattgtagaaataacgatttagcttttaactcagctaaact
cgaaccatcaacggacaatgacaaccgcatattcaacgcttgcaaagcaa
acaaagattttctactcaaagcatcaaccactatatttgctttacccagc
tgataatcaataatcagatcatagtcttccagcaacttgagtcatctgcg
ctgtctcaaattcaagtctttatgcgacattaaatacttcaaactcttat
gatcgatataaatgtgacattattcgccatacaaataatgtcaccatatc
ttcaatgcaaacaccaattgctaccaattctaaatcatgtgtcgaataat
tcttttcatgcgactttaactgtctggaatcataagctatcactttactt
tcctgcatcaaaacacaacctaaaccattcaaagatgcatcccaaaaaat
taaaaattcgttacctgacttaggctgaactaaaacggtactttacacaa
tgctttcaactgattgaaactttactgacatttctcaggtcattcgaact
tcacatttatctgtaagaaatgcgtcattggggtagtatcatcgagaatc
cctagaaaaatattctgtaataagcagctaatcccaaaaaaattctaact
tctgatacatttttcggaggtttccaattaaaaactgctgaaattttact
cggatccactctgatgccttcagctgatactatatgtctcagaaaactac
ttctcaaagccaaaactcacatttactaaatttggcaaacaaatcttctc
acgcaggatctgcgatacaattctcaaatgcttagcatggtcagcctcat
ctcgcgaataaaatagaatatcataaataaaaaccatgacgaatcgatct
aaatacggtctgaaaattctagtcattaaatccataaatactgcaggtgc
gttagttgacccaaatggcaacacaagaaattcatagtgtccatactttg
tcctgaacgcagttttttacacattcgaatctttaactcgcaactgacaa
taactagaatgtaaatcaatcttcgaaaatattgtggcacctttcaattg
atcaaaaaaatcatcaatttgcggcagtggatacttattcttgatcataa
ctttgttgagctatcaataatcgatacacaatctcattgatccgtccttt
ttcttaacaaacagaaccggtgcaccccaaggtgtgaaactaggtcgtgc
aaaacctctatccgttaactcttccaactaagctttcaaatctgtaagag
ccattctctacagagctatcgatatcggtgatgttcctggtactaactca
ataacaaattcaacctctctgatcggtggtaacccgagtaactcttttgg
aaacaaacctggatatttatagactacaagcactgattcaagtttcaact
tagacacttttaaatccagaagataagcaaggtgtgcatcataacctttt
ctcacatagttctgcgctgccatagaagaaataacaatagtcaactcgct
cgattcattagattcaatccgaagtgtctcaccattcaaacattttagta
caataatctttcgtccacaattcactacaatatcatatagagtcagccaa
tccatacctagaatcacatcaaactcatcaaatggtaataacatcaaatt
ggccagaaagctataaccctgagtcatcaaaggacagttattgcggactt
tatcaactgacacatactgacctaaggggttctatactttaaccacaaat
tcagtggactcaacatgtaaatttttacttgacactagattcgtgcatac
atacgaatgagttgatcctggatcaaccaaagtagtaactttagtgtcaa
agatagaaaaagtactcgtaataacatctggagcagaagcttccttacat
gcacgaattgtataggctctagctggtgctcgtgcctcaaacctcacagt
cgaatccttagttgcactttgactattatttacatttctaggattccttg
acggtttccctcttgtagctgtattgcttgatcaaacagtctaaattttg
tatttttcacgtaactcaggacaatcctgaataaaattctcctgcgaacc
acatctgaaataggctctgtcattcatctgacattcatcaaagtgtcgtc
gtccacatctttgacaattaggtttgttggccttaactctaccaataccg
gctactgatgtagcttgagctttagaacctgcgtgttgcttacacgatct
ctactaggatatccgactgaagcaatcgaacgattatggtaatcctccaa
tatctttgacgatgaatgatacgatttccccgttgatctctttcttgaat
ctctagcttctaaatcagattttcttttctctttactaagctcctcgact
ttgtgtgctctatcaaccaaaacaataaattctttcaactcgagaatttt
gactaaaagcttgatatcttcattcaacccgtcttcaaaccgtttacaca
tagaaacttcagttggaatacactcttgggcatatttactcaatctaaca
aactctcttcatattcagatactggcatatgaccctgtttaagctccaaa
aattatttgcacttctgatcaaggaacctttgacttatatatttcttatt
aaactcggtttgaaagaattcccaagttatctactctctcaatactagtg
aaatcaacgtgttccaccactgatatgctgaatctttcaatagagatacg
acacattcgacacattcggtcggttaacatgataactcataaaagactcg
gatcgtattttctaaccaaaactcagctctttttggatcattatcaactg
tagccctaaattctttggacctatatttgtggattttatgaacaggaagc
ttactcacacgtaaaggttccaaaccttcaggaactactagaaccagttg
gggaacaggtgagggtagaggtcgttaagcagccggattagttcggacaa
actttgtgaaccactcgttcatcatttgaaagaaggattctttagcctct
cctccttggccctcagatatgggcctcgatctagacgacactgctccatg
aacggaggcttgcaaattactttctatatcatcggagtctgctcggttgg
aatccattactatataagaatataattcaaaacgtgtcaggagttatcac
actatcaaaagttatataatggcatgtatatgtagactcacataaactat
gcttagtccaagaatcgactaaaccgtagctctagtaccaataaatgtaa
cacccctagcccgtatttgtcaccggattagagctacatatcattaccaa
agcataacgtcatacaatgaacaatttaatccataaataaattacaaggt
aaaacaaaacaatatcaagccaaaaacatgcatatgatcccttataaaag
ccctcaaggcccaaaatagacattggaaactattctggactaaaccagaa
acatatgaaattttttagaaaaagtgaaaaattttcaaactgtagaggtc
acacagccgtctaactcacacagccaaaagacacacccgtgtcttagccc
gtgtgggcattttgaaatagggacacacgaccgtgtaccaatccgtgtct
gaacccgtgtaactctctggcttcggccacatggccaagccacatgcctg
tgtaccaggctatgtacccttcgaaataatcccacacgcccgtgtgccag
gccgtgtgctaggccgtgtaacagcttgacttgcaaccctttgatagcta
taaaggacacacggccatgtcgcctgaccgtatgtcacacactgctgaga
cacacgcccatgtctctgccagtgtagacgaaaaataggctatttccaag
ccatttttcttacccaaactcacaatttatgctcaagccattagcaccta
aattcaagcattcaaaactcactttacctaagcatattaaagcattcaca
tcataggaactatccattcaaccaatatgccaaaatggcacctcaatttc
atcattcaaacttatccaaacacctaaccaaattattcactaattaaact
accaattaaacaaattcactaacacatttttcataatgatcttatatcaa
aagttcatgaacaactaatgcaaaaatgaccatttctcacctaacatgaa
ccgtaccaatttgaccaaagtgcttacttccaaaataccaaaaactaacc
agtttcaacattatgctacattcattccacatcaacaataaattgctact
aaatcattcccaccaacatttccttaccattatcttaaccaacacaacat
caatttaacaactaaacaaaatgccacataaatatagatcataccaaaaa
gatcataaactataatgacaaatatattatccgcacttaatggctagaat
tcatcaaacaaaacacatatacatgccattatacccatgacacaaaactt
tcaaaatataccgatataaccaatggatagagtgatgaaacctcagacaa
cttccaacccgaacaagcttccgattatctagacacacacaaaaaataac
acgaagtaagcatgtaatgcttagtaagtttgtaattcacaaacaaaact
taccatttcaacttataagcataaaaatcaacttgaaactatgcaacatg
gattggcattagcctaagcaacaacagcctttcaaattagtaaatgacat
acatagcaaatcatctcataacatcgtagcttttatacatattacttcaa
aagattcatactttcaaccaatggctaagtaaatttcaatcattaacaac
tcataccttttcatgctttcataatgtcacttactagagtatttgtcgag
ccttccccttttcatgcccgttgaaccactagaataatattggacacgtg
ggaatcttgcacattaagtgcccacatgtggtcgaaacctctactaactc
atatctcatataaatgagtttgctcacacaagcagtcaatcaggacgtag
ctacacggtgctgctcacagaagctgtcaaggaatcgcaacccatgccag
aaactcagccaccagtaagacatacaagaccagcacctgaaatacggtaa
cccctaatgacatgtcgtttgtatcctatatattcctaaggttcaaacag
gattcgaaagccactcaaacttcgttggatatttttgtagagttgtaata
ccaagattacaacataaagcatttacatcaaacataatttaatgctaatt
aaatatacaaacttacctcaaacacgtacggagaaaaatggtcaattaat
ccaatactttttcttttccccgatctaaacccgtacatttcttttgttga
tctatataatcaacttaactcacttaaaattcattctactccatttaatc
caaaaatcatttttgcaaaattacacttttgcccttaaaattttaaattt
aatacaatttagtccctagctcataaaaatacaaattcatgcaatttaat
ccatacccatcctagctgaatattaacttagtccatagaaatccctacat
ttcctttatttcataatttaaccatgaataattttttattttttaattta
atccttaattgacaatttcatcaaaatttcctttacaaaagttgtacaac
tatcaccaaaatttcattttcatccatcaagcaacaaaaaaaaaaactat
catacattcatggtcaaaccctaaacttttaacagttttgcgaattagtc
cctgggctacctagattaagctacaacgactcaaaaaacatagaaatcat
taaaaactaaacaaaaatacacttacatgcatgcaaggactatggacgaa
ccttggaaagtctttaatggcttccgtacgtgctagtttgggttgaagaa
gaaagaaagagagatgatataattatttttcttgttttattttatgatgt
tttattaatttacaaaattaaccttaagtaataacttttaaaaccattaa
aaagatgtccatctttttccactaattatattaatggtctaattaccatt
taaggttacacacattcaaattccataacaattggtacgttttactagta
gaacaaaagttttgcaccttacgggatttagtcatttttatcaaattaag
catactaacgataaaatttcttcacgaaatttttatacaatgatattatc
atgttgcacactttaaaataataataaaacaaattttacgatgtcaaatt
tgtggtcccaaaactactgtttcgatttcactaaaaacgggctgttacac
atagtttgacgaatacaattttttagttacaaaatattactcttaaattt
caagccttgatgccaccctcatttgtcatgcataataaaaaatcattata
agcctcacatagtatgtatcctttggcatagtccttgagggttcctttac
ttctttggtggtcttgggaagggaagataaatgaagttcatagaacttag
tgagttctaaagagaacattataatgtttatacgtcacacatatagaatg
taacagcctgttttctatgatatcagaattgtagttttgagaccacaaat
ctgactagtaaaatttaattctattattattttaatgtctattgaatatt
agtaaggtcatataaaaattttgttaagaaattttgacgtttgtatgttt
aattaaataaaaggactaaaccgtaaaaggtgtaaaagtagagttctata
agttaaatgtatcaattagcttttaaattttaaagtaaagggatttatat
ggtaattagaccattattattagtggacaaagatagacgtgaaattattg
ttttaattttttaagtttaataaagtaatttaataaataaataaagtaaa
ataaggtaaaaggatggtatcatcttctaagttgagaaccaccaccaaaa
ttatagaacaaaaaaaaccatttttagggttggagcattgggcaaagttg
ttttgcttgcatgtaagtgattttgatctcgtttttaaagatttttatct
ttttgaagtcgatatagcttaatcttgctagccgagggactaatttgcaa
aattgttaaaggtttagggtttttccatgagtatgtttgtatggtttttg
aagtctaatggaagaatatgaatctttgttgttaaataaacaagttttgt
aaaaggatttttgatgaaattgttatttagggacctatttataaaagtga
taaagttttatattaaattcttgaaactatgatttgtatgaattagtaga
ggtccctagtgcattcgactagcacgaatgtggatgaaatttcttaaatt
ttaaagtatgagcttaaagactaaattgtaaagaagttaaaatattaagg
gaaatgtataattttgaaaaagtatgaattgtaaagaatttttttattta
gatcaagataaacctcatacggatctagatcaaggaaaagctaaagcctc
agaatagttgatttcgattttacgtctttgtcgaggtaagttcatataat
taatgttttaatgttatattaaattatatattcatgtattgtttgtcatg
aaatcaaatgtgaatatccaacaatgttacgatgattatcgagccacatt
ttaactttagcaatatgtaggatataaatgacatgtcattagggttacca
tgttttgggtgttgatcctgaatgtcctaccaatggctaaggtctggcat
ttgttgcggatactcaatagcttgtattagcagcatcgcgtagcttacat
tctgaccgccagcttgtgttagcagacccatttcatgactcgagaaagca
acgatgtaaaggaaaaggaaaggttatatgtttagcacactttgtgtgga
gttttccgcgtatccgatgttattctaaacggttcaacgggcattaaaag
gaaagaaatggtaagtgttcaaatgacttatgttatgattctatgaaaat
gattgcaaaggaaatggtcaatgaaagtatatctatattcatggaaatga
tgatttcatgtgatgtttaattctagtgaattatgaattgatgcactaac
atgtattgtggatgatgcttaggcttgtgacaagcttgtggttggatttt
accatgtttaattttaaggatatgcattgaaatggtaagttatgttcatg
ttttccaaacttactaagcatttttatgcgtacataattttctttcccat
gttttatagatagttggaagcacgaccggtttggaagcttgtcggagatc
tatcacactatccagcaattatatcagtagtttttgatgttttagccaag
gttataatggcatgtatagggagacttatgtttaatgtttggttgaatgc
taaatgttgattttggtatgtatatatgttggttgtttggtaccatttta
gtaatggttgaattgggtcatttatgtgcttatgatgcatgagagaagtg
gtataaatggtaagtttagactgacatggaataggtcaagttatggtata
ttttgagatggttgaaatatggtcaaattatgtttatgtttatatatgtt
tgattgattgtgattgaggtgctttacatggcatattggttgtatgtcaa
tggtcattttaatgcatgttttggtaaggttttgaagccttgaagttatg
cataaattgtgtttaggtacaagcttgaaatgggtgattaaaatggcttg
atttttgccaatttcttgtccactcggcctaagacacgggcgtgtgtctc
agctgtgtgtcccctgtaggttttaaaggcatacaagtcaggcagttaca
tggcctagcacacaacctggcacacaggcaagtgaggccatttcaaaagt
tacacggcttgtgtaacgcgtaggtttgtgcaagtgtacacagtcgttat
caagtaataagtaagtatcgagttatcgtctccacaaggattgtattttt
gtaagtcacttaatttgtaaaattatattaacaatttggtaaataaaaac
acaatatagttgagaagtggtgattaaaatatattaaactaaatacaatg
atccctaatgcaaattatcctaagtatgcaaactatatgaatgaaataga
ttttagtaaaattaaacacaatttgcaacaattataacataaataaacta
ggacaattactttaattaaactcaaattattatcaacatacttaataaca
ttcagaaaaacattccatgttaactcgatctttcatgagtttggaaacca
cattaggtcctttcggaatcctttacttagtaaataagcattttactgat
ccttatttactaagggtttcttagcattcgttaaaggtaacagggaggtg
tcaggtttgaaacaatttaatggtctcaggtttgaaacaatttaatcaca
caaatctaaaaactatgcagataacagagcttggttcgagttgttatgca
acctccaatttaatcgggtcaggatctaaattgagcatgcacatttcaat
tatgtgtccattagccgtcgtctggtcaggatcgctcagctaattcaggt
gcatttcaatcacgtatgaacgaaatatagactttattttaattgaaaag
atgatcgattgaggcacaaacattataagcatgaatcaaataaatattat
ttaatcaaagcaaacatcctagcttattaagctaacattgttgcaaaaaa
gaacaaagaaaacatagcaaacatttttatactaaattaaagaaaaggaa
gattaaactaaatttagagtgcttgtcagccaagactctgactgacgagg
ctctttcgttcctttgctttgctcctttgctgatggctctccaaggtagt
cgaccaagggttctttaagaggcttaattgctaaaatctctatgacgaga
tgatgctaggcgtgagaatggaaaagactaagagaatttggagaaaagag
agaatgatgagaatgaatgaagaatgatttagggatgcttgagggatgat
gaatgaaagaatgagaggtttttatttataggtgaggatagggggatagt
ttgctaaaaatagtggatgttaacctcttcaaatatcctcaaattgtggc
cggccatgcttagtttcttttgacttttttgcttgatttttaagcaattt
tggatgccacacaactcaagactgagactcggtcaatcgtaaatcttcgg
gcaaatctctaatctctttaacatttcagggacctggtgtaattaaatca
aaaaatggtttaaatcgacagccatgtgtagctaaatattgggttgactt
ggtctcaaatttggatggttttgtaatcaagcaaagctatcagacctatc
cagaataaatcaacaagttagaggaccaaagaataaaatttatccaattt
aattaattaattaaaacccaaattattaatgaaatattttaaaatgaatt
attaaatataattttatattttattatttaatttaatcatgcatgaccca
ctttatgtcctaaaaatataatatattcaaattaatataaaataaaccat
ttattgcatgaaaactatatataataaatcataaaatcacattttaataa
tttctgtgtcttaatttcatattatcacatatttcattaatttattaaac
aattacttagttttaacaatggatttaagtaaaaaggtgataaattacat
aggaaaaatcctatatattttttcgtttacacacccccaaacttaatcat
tgctcgtcccaagtaatgtttttgcacaacaaaaggtcttgctaaggcaa
aattgataattgtgtaagcaacattaatctttatccaataatcatgcatt
aataacttcatgcttatcgatcgtctttactaacaagtaattcatatgca
aacattccttaagattatactaagcttcaaaatatgccaacatgaatcat
tgtttgcatgtatgtcccaaccatagataacatgcttcattcaacatgat
ttcctatcaattaagcaaacaatcacaagacttacttatggtcttcatat
gttaaacttaggacttcctgtccactattgtaggtgacataatcattaga
tcattaggttttttataaggttgtaatggggctcaattaaaggaagggat
tttaagagataggacatttcggttttaaaattcttaacctttaactttgt
cttggttttctcgtaatacaacctttttctttaagtgaacctttagaaca
cccccaaacttattttgaacttaagctcatacatttttcctttttgaaga
ctgagcgaacttttcttcgctttttttttaagcatgagcacatatatctt
tatgaaaattttctcaaatgttgataaccaagacaactttagttaagata
ggtgcacaaacttaggataattttaaaaagatggtaactggcttataatg
taggttcgttgcaaaaacatgcctttaagctcaaaattacagtttcaagg
gtctaatatcatagggttggcttgaaaaggatcaaacggtccaaagaaat
agttcctatatcattttagatttttatgtcccctaggatttcgcctcaag
aaagttactaagtcaattctaaagatataaaccttcatgcatgtctaaac
tctaaagaaactaggttttcaaagcaaagattactaaagctaagatcata
caagcattccattcttcatgataacatactttcacttagataaaatcatc
attcatacttgcatacaaactatctcagtaacaaaaaaaatatctctaaa
cattcattattaaaacatacttatgaaagaaataattgaagtattcttga
aaaaaatttacaagtttgagaaatttatttgccttacccccttttagaaa
gaaggaatgtcctcattgtaagaacaaagtaatgaatgaaaactgaacac
caggtagggttgtaaagaaagagaggtgagtcattaagattgcttaaata
ccaagtcttccctgataacctaatcctagacatgttcattcccattacca
catcacttagtcttattctttctaaagaagtgttaagtttgatcatgctt
gctatattttattctgcagaaattaaatcctaaatacgaaaaaaataaat
ttttaaagacctaaaaataattaaataaataacaggacaagaatccaccc
ttttatttttctgacttattccccttgtcttgtgtagctccacctctgct
tgcatcgtcagtatctttcgtccatgtctcaaagatagaatctgagaact
caggaacaaaagtattagagatattcttaaaggtatttcgaattgagtca
tctctaatttttgcatatttctggtaattttgttcttgattctgcatgaa
cttgtacatatcaatcaaaattgacaactccgatttccttgaagtacttg
cagaagtcggcatgggagttgtatattcaggttcaacaattagcttgact
agttcttcttctggctcaacctttggttcaagaatgttcggttccttatc
agattcttcctcttcagtgtctgtgattgaattagcttcagtttcagttc
catctgttgactcctctgtatccggcttagttggctcttcttgctcgcct
tgatttagttcatgcaccctttctactaatctttcaagattataatttgt
aatgcatccttgaacatatcgccccttcagacttgcttctgttttaacgg
gtctttaagcaaagttaagtgattaatgatgggaaagaagcacttcctac
cttctttttagcacaatcgtgaatctccttgaggataattttcccaacat
taatggacttttctgtcaaacttgcatataacaaaagcatccattccatc
gagatggtggaactatgtgagataggcatgaaactgtaacgaacgaaata
aaaccatacctttgctagtcgttttaagtattctctttgacaagaatggc
tcccatactttcttatattccactgggatcccagatttctcaaaacatca
agcacttgttgaaaaaaatcccaaatgatattgtcatcatagggtagtac
tcatcttcttcaacattaggtaaattaaacaaatcattgatggacttaga
agtaagaggtacctttttcttttgaacgatgacttcagtagcatattgca
tagtcaaactagttcatcatcgggaactgaacgatcatcacaaaaccgtt
accacttgagagcattgattttctttctaatcagtataggaacaaccatc
aaatcattagtctttaagtcaaaaccttttttccagcatcataggttgat
gcttaaagattgaatcaaatctctctttcacttcttctttgatcaaaatt
gggttttcaagagtagtctttgaagatctcgttcttttgcgagacattgt
atcttttcccgaaaattcggcaaagtttctacataaaagagaaaagagaa
atcgacaaagtgggtagaacttgctatggcaataaatcttgcgacggcaa
aagggaattttggcaaaaaaaggaagagaattagggtttcttttgagatt
tgaggttgagagcacaaaagggatatttagagatttttagggtgtaagca
aattgctttgagggatatgaaaaattagtagaatagggaggggtttatat
agggaaaaatttagggcaacatgtagcaaaaaggtagctacaattatggg
ttacttggttgggaagcaattgggtggtgacggcaaggcatggatttttt
ccctctttttgctgtcttaggactcaacctcagactgtatcctactaaaa
aaactgaattagtacctttgccgccaaattgactcnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccccattacattagt
tcaaggaaggctcaattttgaaagttttgaagaaatataagaaagcatgg
gatggacgattgtggatatcaaaggaatcaatccagcaatctgcatgcac
taaatattactagaggattaacatggaaaatctatcgagaagcagagaag
actaaatcccattatgaaggaaattgtcaaaaggagattatcaaatggct
ggatgctggaatcatatacccaatttcagattgttcttgggtgagtcctg
atcaatgtctacctaaaaaatggggtgtcactttggtaagcaatgttaac
aatgaactcattcctactagaactgtcacgagatggtgagtttgtatgga
ctatcctaaactcaacatagcaacaagaaatgacagttttcctctgccag
ttattgaccagatgttagatagattagtatggaaagccttctattgtttt
ctagatggttatctgggatataaccagattgccatagctcctactgatca
acagaagaccaaattcacatgtctttatggaacttttacgttccaacgaa
tgccgtttggattatgcattgcctctacaacattttagcattgcataatg
gcaatattttcagacatggtggagaaatttttagaagttttatggatgac
ttcttggtctttggtgatacttttgaagattgtttaaaaaatctagagtt
agttctttgttgatgtgaagaaaccaaccttattctcaattgggagaagt
gcctctccattgtttgtgaaggcacttttttgggacagaaaatttcacag
caaggggttgttgtcgatagagtaaaaatcaaagttattgaaaaattgcc
accaccctccacagttcaaggtattcgcagttttcttggccatgcaggat
tctatcgacggttcatcaaagatttttcaaaaatatcaaaacccctgtgt
acattgttagaacacaacagatctttcaattttgatgatcaattcttata
ggcatttgagagttgaaaaagtggctcatcacagtactagattggatttt
accttttgaacttatgtgtgatgccagtgatttttccgtaagggcagtac
ttgggcaaagaaaggacatggtatttcatgctatctactattcaagtaat
acgttgactgattcacaactaaattataccaccactgggaaggagctatt
agatgtggtatttgcctttgacaaatacagagtttatttagtaggcacca
aagttacggtttatatggaccactctgctattaaatacttggtgaccaag
aaagacgctaagcccagattgattcgacaactactgctattggaggaatt
tgatcaggaaattagaggtaggaaaggcataaaatatcaagtggctgatc
acttgtctcaaattgaagcaagaaataaaaatggtaatattcaacacatt
cagggtgatttcccagataagcaacttttaattgccatggcattactatg
gtatactgatgttgtaaattttttgtctagtggattgttgccacctaacc
tcacaaatcaaagacggaataaatttctccataatgccaagatttattat
tgggatgagccacttttattcaaacattgtgcagaccagataattcggag
gtgtgttccagatgatgagattcaaagtattttatttcttgtcattcagc
accatctagagggcactttgggggcatgataagtattgcaaaagttctcc
aatctagattttattggacgaccatgtttaaagatgcttattaatttttc
caggcttacgatcactgtcagaaaattggaaatctattgagaaggtatga
gatgcccttacagactattttagaagtggagctatttaatgtttgaggaa
ttggttttaagggaccattctcaccttcttggggaaatgcatacatactt
ttagctgttgattatgtattcaagtgggttgaggctattgctttaccaac
aaatgatgccaaattgatactgaaatttctacataaaaatatttttacta
ggtttggtacccctcgtgctctaattagtgatgaaggttcacactttgat
tgcaaactagttgctaatgctctgaacaggtatagagttaaacataaaat
tgccacggcataccatccccagacaaatgggcaggcgaaagtctctaata
gagagattaaacaaatttggaaaaggtagtcaatcccaacagaaaagatt
gctcatccatattggatgaagctttatgggcatatagcactttatccaag
acaccattgaggatgtcgctcttcaagcttgtttatgggaaaccctgtca
tttgcccgttgaacttgaacataagacatattgggcaattaagaatttga
atattgattggagtgctactagtactaatgggctattcgagttggatgag
atggaggaatttttagcactagcctatgagtatgccaagctgtacaaaga
aaagattaaacaatggcatgacaaaaaaaacttgccacgacaatttgcac
ttggacaacaagtcttgttattcaattccaggcttaaattatttcttggg
aaattgaaatctcgttggtctggcccattcgagatagtgcatgtccatcc
tcatggagctgtagaagttaaagatagcaagactggttcaattttcaaag
tcaatggccaatgattaaagcactactttggagaccttataaattgtgat
aaaaattccatctctttttgaactacttaatatttctttcctattctatt
ttattcatttcctttgcttttaatttttgtgttaatttcttcaataagtt
tatttaactattattttcttttgttacatgcacattatggcccaggtttg
tagaaatcagctcatttaacacaatagttaattttaatttcctaattttt
ttgctatttttgttttcccgatattttttcttgtgtcaggacactctcaa
attaatcttagcccccacgtcattgttatattttctctcacgttttaccc
tattcatttcacttctcttctaacttctttttcgttttatctccttaaac
cttctctacttttactccatttaaattgtaaaggtctcaccttttttttt
attttctagtcactattgtctctacaatggctcgccaagcaccatcttct
tccacctctatgcctccacaaacattttttagcaaaatcgtggaagaaaa
ttatacctagaacgtatcaaagaggtcgttttttctagaaaaaggtttcc
cttttcaagatgccccttttatgggctactctgaagcaatctcttctgta
gtgaagaaacatggatggaaaatcttctatcttcacctcgatcacgttct
caccacgatagtaaaagaattctatgctcatctctcctatcctaaaaatg
cttttatatatgtgcgcagtgtctcggtaatgtttaatgaagactccatt
aatgtacaatatgggttatctgacggccacgatgaacacacccaatttgt
caagacatgactagaaaaggactctaccattgaccgtgtatcgttgaagc
ctcattgcagagtgtagtatcatttccttaaaacttgtctcatcccttct
actctcaactcaactatttcaaaagaaagcctattattattacactcgat
tatggtgggcagaaagatcaatgttggaagcattatttttagagaagtcc
atcgctgctcttaaaagaatgtcgataccttaaattttccatcgctcatt
acgacactttgtcagtgggtgaagtttcctattcaaaaaaatgaagacat
aatcgccaataaaggagccataacaaatcaactcaccctaagattttctg
gggaggaaatgccaaggcatccgggttccacctctacatcatcaccacct
ctgaatactaatactgctccatcaacatctcatagtaacttttaacagaa
agtgattgacgcgcttgacatgtaggagcaattctaaatacttgagaaat
accaacaaaggctggccactaattttggccaagctcaagaagagatggct
ctattttaggggtatgtctgacaaagagataaggccatgaggaaatctct
tcagaagaactttacttgacccatgcctacattccttatttttcctaaag
aattgttgttggagctagatgatgatgatgacgatggcgaagagaccact
gtggagaagaataccaggaacaagaaggagaagtagagaaaactgaatat
gtccatgttgaatctgagaaggatgacgatgatgtgacttaagctactac
acctattgacaacaccactacaccaaacaatgcacctatgactgaacaag
aacgtgcagttcatcaactgattaatgatctcacaaagtcagacattgat
gatgaggaagaagtgcctattaaccagctaaaatggaagcactacaagcg
agctactggcaaatctattgaacatgatgctagtgaggtagaaaggaagc
agcgatacatatgtgctaccaggaaatccacccaacccaattagagtaac
ccaaattctttccaagcctttgttttcttatttcattttataccatatgt
ttcatgcattcatatttagttgtcattgtatttttataattttgagttgt
ttttttttttgcattttgacatgtttcattgttcatgcattgaggacaat
gcatcccttaggtttagaggtgtgttgtgttgtaaatatagaatgtcgta
gatagatgctttaatattcatgctttttttcaatcatttttccattacat
acaaatgcgaaataactatcaaactatgctaagtatattgatatcggtga
tgttcgatgaggataataactcttaaattaatgtagaaaattgtgaatgt
tggttaaacatttttagcttaggatagttgtttgaaaattgattcctaaa
agtagaataacttaagtatcaatgcaattaaatttgtagtaaggttcttt
taatgcatttagaatttcttgaacctaaatgaaattggttttgaatgata
aggaataccctagcaatagttttacactccaatgtttgaaacggttgagt
aggtcaataatgctttgtttgctccatcgtttgaacactaagcatttctt
tccttttcaatccttttcatagaatcatgatataattcatttgaaaactg
agaatttctttccttttcattcccgttgaaccatttagaataaaatcgga
tacacgggaaagctcacacaaagtgtgctaaacatataacctttcctttt
cctttacattgttgctcactcgagctatgaaatgggtctacccacacaag
ctgacagtcagaacgtaacctatgcgatactgttcacacaagctgttgag
tatccgtaacaaatgtcagaactcaaccattggtaggacatttaggacca
gcactcgaaacattgtaaccctaatgacatgtcatttgtatcctacatat
tcctaaggttcaaacaggcctcgataattttcgtaacatccttggatttc
cacatttgatttcatgacaaacaatacatggatatataattcattataac
attaaaacattaaataatcatacgaacttacctcgatgacaaagacgtaa
aatctagatcaattattccaaggctttagcttttcctcgatctagatctg
tacaaggtttatcttgatctaaataagcaaattcaatccatttaatactc
gtactattcaatttaatccaaaattcatacttttgcaaaactactctttt
ccccctaatgttttaacttctttacaatttagcctttaagctcatacttt
caaatttaagcaatttcatccacatttcatgctaactgaatgcactaggg
acctctaataattcatacaaagcatcatttcaagaatttaacacaaactt
ttatcacttttacaaataggttcctaaataacaatttcatcaaaaatccc
tttacaaaacttgcttatttaagaacaaagattcatattctttcattaaa
cttaaaaaaccatacaaacatactcatggaaaaaccctaaacaatagaaa
attgttcaaattagtccctgggctagctagattaagctacaacgacttca
aaaacataaaaatctttaaaaacgggaccaaaatcacttagatgcaagca
aaacaacttggtcgaatgctccaaccctaaaaatggtgtttttgttcttt
aattttgatggttattctcaactaagaagatgatacgatccttttacctt
attttaccttatttatttattaaattactttattaatctttaacttaaac
taattaaaacatcaatttcattcccatctttatccactaataataatggt
ctaattaccatataaatccctttactgtaaaaatttcatagctaatttat
acctttaacttatagaactctactgttgcaccttttacgatttagtcctt
tttacttaattaaacatgcaaacgttaaattttcttaacaatttttttgt
acgaccttactagtattccatagatattaaaataataacaaaattaaatt
ttactagtcgaatttatggtcccaaaaccactattctgatttcccaaaaa
ataggctgttacaactctcaccccttaaggaattttcgtcctaaaaaatc
tgaccagaaaagaggttcagatattgcactttcatagcttcttctggttc
ctaggtagcttcttctaatccgtgacattgccaaagaactttcattaaag
ctatgcttttatttctcaatactttaacttctctagctagaattctgatc
ggttcttcactatacgtcataactggctgaatctcaacttcaacaggtga
aatcacgtgtgaagaatctgatcgagaccgtcataacatagacacatgga
atatattatgaatcttttctaactccgatagaaatgctaatctataagtt
actggctcgattctctcgatgatctcatacggctttataaacctcggact
aagctttcttttacgaccaaattgaagaactttcttccaagggaatactt
tcaaaaacactttgtcaccgacttggaatttgatgtcttttcttttcaaa
atccgcataggatttctatagatccgaagttgctttcaaactgtctcgta
ttactttaaccttttcttcagtttctcgtatcaaatcaaccccagaaagc
tttttctcactgagctcagtccaataaaatggagttcgacactttcgacc
ataaaaagcctcatacaatgccattttaatgctcgattgataatttttgt
tgtatgcaaactcaattaacggtaaaaacctctcccacttaccttcgaac
tccaaaacacaacatcgaagcatatcttcgagtatctaaatcacccgatc
agattggcggttatcctaagcatgaaatgcagttctagaatgcaatcgag
taccgagagcttcatgtaatttgctccagaatcgagatgaaaatcgtgga
tctctatcagaaataataggaattggcgcaccgtgcaatttaacgatctc
aagcacatataactctgctaatctctcaagtgaaaaatctgtacgcactg
gaatgaaatgcatggacttcatcatacgatcaacaatgacccatataaca
tctttctttttcggtggcagaggtaatctcaaataaaaaatctatcataa
tacgttcttattttcactctggaatcatcactagttgtaacgaaccagaa
ggtacttgatgctcgattttaacttactaacaaactaaacatctcgatac
taactcaaaaatttcttgttccatacctggccaccaatacatttgtttca
aatcaccgtacattttattactaccaggatgaatagagaagctattacta
tgagcttcctgtcaaatctcctgaatgagatcagaatttctcggaacaca
aattatgcctttgaaatacaagctatcattggaaccaacatgaaaatcta
aatcaggtgtcgcctcaatttgtttctgtttggctaccaaaacattaaca
tttttttgagcttcacaaatctgttacaaaaatgtaggtctagctttcaa
ctcaactaaaattgaaccatcatcaatggaagtcaacttcatgttcaaag
ctcgcaaagcaaataaagattttctactcaaagtatcagccacaacatta
gcctttcccggatgatagtcaataatcaagtcatagtcttacaataactc
gagccatctacagtgtttcaaattcaaatctttctgtgacatcaaatact
tcagacttttatgatcagtgaatatatgacatatttctctgtacaaatag
tgtcgccaaatcttcaaagcaaacacaatagctgcaagctctaaatcata
catcatataattcttttcgtgtggtttcaactatctaaaagcatacgcta
tcacttttccctcttgcattagaatacaacccaaactatttaatgaagca
tcactatagatcacaaattctttaccaaactcgagctaaagtaacacagg
tgcctcggttaacaatgctttcaattgattgaagctatgctgacatttat
catctattcaaacttaacatctttttgcaacaattacgtcaatgacgtag
caaccatcgagaatttcgtgatgaatcttctgtaatttccagctaaaccc
aatatatttttgacatcaaatacatttctcggaggcttccaatctacaca
gttgaaatttgctctgatcaactctaatgccatctgttggtacaacatgt
cccaaaaatctgacttctggaagctagaactcaaatttgctaaacttggt
gaacaattattttttgctcaaagtttgcaaaacaatcctcaaatgctggg
catgccctatctcatctcgtgaataaattagaatgtcatcgatgaatacc
acaatgaagctatctaaatacacactaaaaattatgttcgtcaaatccat
aaatatcgcaagtgcagtagtcaaaccaaatggcatcactagaaactcat
aatgtccatacctggttctgaacatggttttatgtacatctgagtcttta
actcgcaactgataataaccagaacaaagatcaatatttgaaaatatcat
cgcaccttttagctagttgaataagtcatcgatacgtggaaatggatact
tattctttatcgtgactttgttgacctgtcaatagtcaatacataatcgc
atggatccgtccttttttcttaacaaataacacaggagcaccccaaggag
aaaagctgggtcgagcaaaacctctatctgtcaactcttaccattgtaca
ttcaactctttgaattctgtaggtgccattctgtaatgagttatcgatat
cggagatgttctcggcattagctcaatagcaaactcaacctttctgagtg
gtggtaatatgggtaactcctttagaaacacatttataaacttacatacc
gctagaactgattctagcttcaactcagaaactctagaatcaaatatata
agcaatatacatttcacaaccttttctaacatatttctgtgctgacatag
cgaaaataacattagacgtactatccggtctatctgattcaatttgaagc
ttttcactgttttaacattttaacacaatatgctttcatcaacaattcac
catagcatcatgcaaagttaatcggtttatacccaaaatcacatcaaact
catcaaaaggtagtaacatcaaatcaaccggaaagttgcaacctcgaatc
atcaaaggaaaatatttacaaaatttatcaactaacacatactaacctag
gggttcattactttaattagaaactcagtagacttaaaacataatttttt
atctgacactagagtcgtgcatacatatgaatgtgttgacccagattcaa
tcaaagcagtaacatcagtatcaaagataaaaactataccaatgataaca
tctggcgttgaagcttcctctcgtgcacggatcgcataagctctagccga
cgcttgtgcctcgaatctcaagtagattcatttgttccattacggctatt
gcttgcatttctagtggtctgtgtggtctacctctcgcagtagtattact
cggtcaagtagtctaaacctttgctttgtcagacctttccaagcaatctc
tgatataatgttcatacgaaccacattcaaaacatgccctgtctttcatt
ttataatcacaaacactgcccacactaactacagacgtagcctgaggttt
tgagctcgcatattgttttccctatctttacttgaataacccactgaagc
tgaagaatgacagtggtattcttttaatttctttgacagtgattgatata
attttcctactggtctctttcccagatcacgagccccataattggctttt
ctctttgctttactcaattcttcagctttatgctctttgtcaaccaaaac
aacaaattctttcaattagagaatcttgactaatagcttgatgtcttcgt
tcaacccgtcttcaaaacatgtacacatagcaacctctatcggtatacat
tctcgagcatactttctgagtcaaaaaaattctctctcgtattcagatac
tatcatccagccctattttagcttaagaaactctttacgtttcttaccaa
gaaatctctaactcatatatttctctcgaaattcagtttgaaagagttgc
caatatacccattctctcggcacaaccgaaaccaaggtgttccaccattg
ataagttgaatctttcaataaggaaacaatacatttcacacagtctgcca
gagtacatggtaattcataaaaactttgatcgtattttctaaccagaatt
cagctctctccgggtcatcttcagatgtacctctaaactcttcagcccaa
tatttacggattttatgaactggacgcttgctcactcgtactggtttgaa
gccttgaggaactatggaaccgattggggaacaggtgagggtggaagtca
ttgagccataggttcgttcgtatggactcggtaaactattcattcatcat
taggaagaaggcatccttagcctctcctctttagccctcaaatacgaacc
tactcccactcagcgctgctccgtgaatggaggcttgcgcgttactttca
gcctcatcagaatcaacttggttggatgacattatatctataggaagcca
tagttcaaatcgagttatgagttatcacactatcacaagttatataatga
catgtatttccagactcatacatgctatgttcagtctgagaaccgactaa
atcgtggcattaataccgctaagtgtaacacccctaacccatattcgtcg
ctgtaatagggttacaaagcattaccataaaaacgtaactttaaaacata
cattttaattcttaacataaacatatcataaatcattcatcaacatgcat
aacgtctcttaatcgagccctcgaggccttaaaaataccttagaaattgt
ttgaggctacattggaatcaattgaaaagttcaagaaaaagttaaaaagg
ttgaactgcaggggtcacacgactgtgtgacttatacagctgagacacac
gcccttgtaacattcaaaatagggacacacgactatgtcccagcttgtgt
ccatgcccgtgtaactctctaagttgggtcacacggccaagccatatgcc
cgtgtgccaagctgtaaacagaaaaatatataggatttttcctatgtaat
ttatcacctttttacttaaattcgttgttaaaactaaataattgtttaat
aaattaatgaaatatgtgataatatgaaattaggacatagaaattattaa
tatgattttatactttattatatagtttccatgcaataaatgacttattt
tatattaatttgaatatattatattttttaagacataaagtgggccatgc
atgattaaattaaataataaaatataaaattatatttaataattcatttt
aaaatatttcattaataatttgggttttaattaattaaataaattggata
aattttattctttggtcctctaacttgttgatttattctggataggtctg
atagctttgctggattacaaaatcgtccaaattagagaccaagtcaacca
aatattaggctacacagggctgtcgatttaaaccactctttggtttaact
acacaaggtccttgcagtgttgaagaaattagagatttgcccgaagattt
acgattgaccgagtctcagtcctgagttgtgtggcatccaaaattgctta
aaaatcaagcaaaaaaatcaagtcaaaagccactaagcatggccggccac
aatttgaggagatttgaagaggttaaaatccactatttttagcgaactac
ccgcctttcctcacctagaaataagaccctctcattccttcattcatcat
ccctcaagcatccctcaatcattcttcattcattctcatcattcatcatt
ctctcttttctccaaattctcttagccttttccattcccacacctagcat
catctcttcatagagatttttgaaattaagcctcttaaagaacccttggt
tagccaccttggagagccatcaacaaaggagcaaagcaaaggaatgaagg
agcctcgtcagtcagagtcttgggtgacagccactctgaattaggtttaa
tcttccttttctctaacttaatataaagatgtttgctatctgttatttgt
tcttgtttacaacaatgttagcttaattttatttaagttaggatgattgc
tttgattaaataatatgtatttgattcatccttataatgtttgtgcctca
atcgatcatgctttcaattaaaatcatgtctgtatttcattcatacatga
ttgaaatgcacctgaattagctgagcgatcttgactagacgatgactaat
ggacacataattgaaatgtgcatgcatcatttagatcctgacccgattaa
attgaagattgcataacaactctgaccaagctctattatctgcatagttt
ttagatttgtgtgattaaattgtttcaaacctaacacgtcgctgttacct
cacatgaatgctaagaaacccttagtacataaggattagtaaaatgcgta
tttactaagtaaaggatttcgaaagaacctaatgtggtttccaaactcat
gaaagatcgagttgccatggaatgtttttttcgaatgctattaagcatgt
tgataataaattgagtttaattaaagtaattttcctagtttatttatgtt
ataattgttgcaaattgtgtttaattttactaaaatctatttcattcata
tagtttgcatacttaggataatttgcattagggatcattacatttagttt
aatatattttaatcaccatttctcaactatattgtgttttcatttaccaa
attgttaatataattttacaaattaagtgacttagcacaaatacaatcca
tgtggagactataactcgatacttacttattacttgataacgactgtgta
cacttgcacaaacctacgcattacaagtttttggcgccgttgccggggat
tgtcaactgttgccatagtcttttttttgtgaaattatttattttcaatt
tgatttatttctaacattactaacttattcttttttaatttttgtgattt
tcttttcaggtgtttatgagcatagatcaaattatcgatttattccctat
agaccttgaaattgagcaaactttcaaacaaagaagacgtgaacgaacag
ctcaaagacaagtcgagatggaccttggaaatcagaatcaagaccaaggt
aaggaagcagatcatgtacaaaatcctatcctcactaccgatgatagaga
tcgatgcatcaaacaatatgctgtgccatttttcagtgagttaaactcag
taattaaaaggccagatattgaggcaacccagtttgaattgaaaccagtg
atgtttcaaatgctacaaacgatggaccaatttagtggtatgcctacgaa
agatccacatctccacctttgattgtttatggaggtaagtgattcattca
agacagctggtgtgactgaagacgcactgaggttgaagttgtttccatac
ttgttgcgagatcgagcacgagcatggatcaattcattgccaccaagttt
tatatctacatggcaagaattagcagagagatttttggttaagtatttcc
cacctagcaaaaaacgctaagttaaggaacgagatcacaactttccaata
attggatgacgagtctttgtatgaggcttgggagcaattcaaggagttac
tttgtaagtgtcctcatcatgggattccttatggtattcagttggagaca
ttgataaaaccaaataacaacttattgcagtaaagacccaaccaatctca
agggtttaatcagcaagctttaaaaccacctcaagctgaggcatcaaata
gcttggagaacttgttgaaagtgtatatgacaaagaatgacgctttgatc
caaagccaagtagcaacattggaaaatttggaaaaccaaatgggtcagtt
agctacgaagctacgtaatagaccacaaggaaccttgccgacctatattg
agaatctaagaaatttgggtaaagaacatatcaaggtagtggcatttcga
actggtaaaattctagaacccttattgattgatgtcgaagataagtctgt
tgagaagaatcaaccagctgttgaagttcctacaccaaaagaatcagaat
ctgcaaagtctaacaaggtaaaccctgacttaatgaatttagatatttta
gcatcttctctggatgtagatttacctactcagaaagtgatacgagtcac
aaaggcccaacccaagctcaagaacgtgataggctcaaattaccacaagg
cccaataacgaggtcaaaggcccgacaaatgcgttccaaactaaatggga
ccattcaagaatttgttagcaaggccttagatgcatacacgaaagaaaaa
gagaatcaagattcactttcttgttttcaagaaaatcaagaaaccgaatc
ttggcccaatcttgctgtttggaccgatttcaagaatcaagaaaatcaag
atttcaaatcttggaaatcttggtccaagaaactgaatcttgcggccaag
gcacattggatctccattacgagcatcaacgaaccaattttggtaggaga
tggactacaagcccaagttcttgaaggcaaggcccaataagacgattcca
agcctaaccaagaagtcaaaatcatacttagttgaaaattaggccaaatc
gttaaattggcccaatttgtaaaaaattaattcttagtttcaattttaga
ctttctaaattaattgttaggtaattatttagtccaagaggcccaattta
aggcccttgaccgaatttctctttaatatttaattaggagtttttttagt
tttagttttctaataggattaggaaaatattaaggcctataaataggcat
gaccggccacccttgtaaacacattagaaacactttgaaaatttcagatt
tgtttttgggtgaaaattctctttgagttctccaagaattttctcttgag
ttttctttagaagttgttttaacaatctttttgattgtgggagccatctt
cagccttcttcttgccattgatcttcattggaggggagattagagccgtt
tgaagggagttgtgaaatcttacgggatttcaaggcttcttaggacttta
tctttatttcttgctgttcatcttatcttttaaattcttcttgtgtcgat
ttgtattaaataacttgtttgctattcttgttgcgtttcagcctttccaa
aactccaagatctcttcatcattcaaaatcggattgccccctttgttcta
ggcagcaaagatcgtccaagatccctaaattccattgttcttgccgattt
ctccttttcaaatctggttgaattcagttgctggaattttgggggaaatt
aatttgctgtttcaatttgggcaaatcgacatctccttgggctccaagaa
ccgttttcgattcttaaatatttcttttgttcttgtcatccgtaccctat
cttttattccatcaatttgctggacttttaaaattaacttattgtttgtg
attgttcttttcagattcggcagattggggtttaattcgattaccaatcc
gtgttcttgacatccaagatttgttattcttaaggacgtttgcttcttgg
ctgttctttattgttttggatactatctattcagatctaatcgaatctaa
tcttagttttctgtttcgtttttagatccgatcgtctagagcctcgtaag
aatttcctgtgacttgacaactcgatcttggtccgagcgcaaccctctat
catttggtattagatttttggcgttttgggtgttcttggttgatttctaa
actgatctctattttttaaactacaaacagcagttttacccagaaaaagt
tttcgaaaaaaattcatttgagtgggtaaacgttgtctgattgatctaaa
attttacgtacatatttttggtactgttattgaatataaaaaaatatttc
tcgcaaaaaattcagtcaaaaaagtcaaaaaaatcgaaaaatatgaaatc
aaataaatatttaaaaaaagattcagcgggttgagtttggtgcccaaact
tagcagatcaaaaattaaatatttaaggacattccaattttaatttcgtg
atttttggagatcaggaatacctcgaacaaagttgtcaagttactccgca
gtttttcgggtttttctagtttcagtaatttttattgattcttagctgta
ggttctcatttgttttcctttattctccctttacactatctaacacctta
ttgtttcttgtgttagtaggatttttaaagtgtgcacaattcttcctcgg
tgagacacaaatcagttggtgtcacgtcagttttttggcatcctagtgca
aattaggattctttggtagttcgattcatacactttcgaattggttgata
tagactctaataaagaactcacaagactgaattctacctcattgagaatt
tgattttttctttttgagtgattaacggtgaggtttgctaacttttcttt
ttgagtgttgagtgtttattttgcaggtttttgaaaatgtctaaggttgg
tcaaggtgataatgatcataatgatttctacgacacatttacaaaattca
accaatagttagacgaacaggctgccttactcaaacctttgagtgctact
ttaaatgaggtacgattgaattaagagcctcaatatcgagatccaattaa
agaagatatggataactagtctcctgctcatcggcgcagtcctcgacgtg
tccctagaactgactctgattttcatgatcgcgggcaaccctctttggca
aaaccgaagttcacaattccccaattttgtggtaagaatgatccagaaga
ttattgtgaatgggaatctaagattgaacttatgttttgatattataaat
gtctggatgatgaaaaggtagcattagcaacgctggaattttcagattat
gcattaagttggtggactcaacttggggtaaatcgtcatcggaattatga
aggtgagatttcgaaatgggatgagttgagacagattatgcgtaaaagat
ttattccacctcactattatagagagattaaaataaagattagaagactt
gttcaaggtagtaggacggtggatgaatattttaagaagatggaaatgct
cgttcagagagctaatgtggaggaggatgaggaaacaactatggttcgat
ttattgatggtttgaacaggccggtagctaatacattgcggctacaaact
tacattgatttagaagaagcagttcacaaagccattgagatcgagcaaca
attaaaggaacaattaaaggaacaaaggtttggttcattctctacttcac
aatattaccgagttaacaattccaattctgattttaaaagttcaaaatcc
ccttttgtgactaataagtcttctttgagtaatggaagtaagcaatcaga
ttggaaaaaaggggctcctgttaaaacgcaaacaccttctaagcagccca
atttaggtgattcgagtgtgaagaggactcgtgagattgaatgctttaag
tgcaaagggcgtgatcattatagtagggaatgccctaacacgagattact
tcttctgaaagataatggtgagtacacttcaacagatccagatatgccag
aacttgtggatgacagtgataatggcgaagagttggttgaaccacaaaag
aaggagactttgctgattttcaatgccttgtagttcgccgaacccttaac
attcagatgaaagatgatgataaccaaaggaccaatattttccattctct
gtgttttattaaaggtaacttatgttcactcattattgatagtgggagtt
gctagaatgtagtgagtagctatttggtggattctttaaagttgccttgt
accaaacaccctaagccatatcacctttagtggcttaatgaatggtttga
agttaaagttacgaaatagtccttggtcacttttaagctcgggaattatg
aggataaagtatggtgtgatgtggtcccaatacatacggcacacttgctc
cttggacggccttggcaatttgatcgcgatgttacacaccaaggtaagct
taatcgatactcccttgtgtttaaaggtagaaaattcacttttcctcttt
taaatcccatcgatgtatataaagatcaattgaagatgatgaaattttgt
gagggggtaagggagaaaggacaagtgcaaaagacagagagaaaagaggc
tagtagtggcaaaagtcaaaatttaaaaagcccaaaggtgagtgaatcca
caagtggtaaaatgagcgaaaaaagtttttggcaacaaaaaaagatgtga
ggagagccttactcaattaaatagccttgtatccttgtgaggtttaggaa
aaaattattttatcttttatcttaacattaacgaaaatttgcctagtgtg
tttcagtcttttttgcagattatgagatgtttttagtgaggccctaaggt
taccacctttacgagggatggagcatcaattgacttagtaacctggagct
tcatac
back to top