AC202821

Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Sequences
The following sequences are available for this feature:

region sequence

>AC202821.1 ID=AC202821.1|Name=AC202821|organism=Gossypium hirsutum|type=region|length=88339bp
taaatagcccgatccctcgcacgcgcatacctctcagtctgatcttcgga
gacgtggcaggaaaaacgcgtatctgaggaagcgttttgcctacgtagac
agaaatcgctccctcaaggacgcgttttcctgccacgtaagcgcttcctt
ggagaagcgttttgcctgcgcgtgaatagtagcaatggctgcttttttta
ccgttggtgacccccccaacggtaaaaaaaaacttataaaccccatttca
ttttcttcacaactaaatcctttctctcaatttctctctaatattctctc
aaatttctctcaatttcctctcaaatatctatttaaaagagctttaattt
ttttaattatttttaaaaaagttttaaattttatttttttgaattttttt
taaatcgtaaaaatttgtaccaatttagcaatggccggagaattgattcg
tcttgatgacaagcacatatccgtcgaacaaatgaaaatggtaagtgtta
actttaatttttaaatattatttaagatttttttatttatgcaattttaa
ataattattattttattatttgttataaaagcctgtagatcggatattgc
aatgctacattcgtaatatgcattgtcctccatcactgttggtagagaat
tacctgcgggaggcgggtttttagcacttggcgacggtaggccagggatg
caagttggactcgaaacttatcagtgcgttgattgagaggtggagaccca
agatgcacacattccatatcactttggaagatgtcaatttgcaattggga
ttgccggtggacgggtacgcagtcaccgggtctgttcaatctggtgattg
tggagcggtatgctacaagcttttgagtgctattccgaagaatattaacg
gaggtcggatcgagatgggctggttacgagacatattcctggatccgggt
gatgattcaaccgaactagaaagaatacgatatgctcgggcatacattct
tcagataattggaggttatctgatgccgaacttgtcacggaactgatacg
atccggcccgggttaaccgagtcgtttcgcgaagttgcccaatcgtcgac
gaggagtagttggagttgtcaaaattgggtgatttaggctaagggttgcg
gaagctttgagaggggtttagatgagtggtttggtgttgataggtttggt
ttagaatagaaacaaggtaggttagaaaaaaggtaattgatggagatgga
aaatagaacttagacgtcaagaatgttcaatactaaaaagtattgcccga
atcttatattgcttaaggtgaaatttgatgaaagatagaagtggaccttg
acccgttacctatatggaggtaagaaccaaaggtataataatatggttga
acgccacaccggttcggtgataagttcaatggagttcggattgacgccac
tagcaagctagataagtcgcttcgagactcgaacgaaagaagagaggagg
taacctcacaagaacaaaagttctattaagttttaataatcaaattctgt
aaccttttacaataaacaagtaagctatttataagcctaaaatgcctatt
gatattcggcatctatgttgttcacaataacttaaatcctgttcacatag
gtatttaacatgttcacacaaaaagcattaaaattcggttcatgcttgaa
aatggtacatgaattggccgaaccatcatgatgcttcacttgatgcattc
atgcatccttagccttgaagaatctccataattccatgaatgtgcagccc
tttaatgatcttacatctcccttggctgaatgaggcattaatgtgcctaa
aatacttgaatggtcatcttgaaaatgcatgaaccatgcatgaaacgtcc
catgtattttcccccataaatatgatccatgaatattcaaatacatgaac
tttcagcaactccctcttgcgtgaacgtcccaaatgcatgtgctccttta
aatgccatccattgaacctaaattgtgcatgcacactcccatacattgca
ccaatccattcatgaacctgtagcaaataacatcaacaagttaaatgctc
tttagacacattaaattagcagcatatgaactcaataatttgcacattaa
attcgtccatacatattaacaatttcagacatatttaaaacatcataatt
aattaaatatttaatttagatataattaaaacacttaattaattatttgt
ccagattttaacaaattaattaacttaaaataaacaactaattcaactga
agacaaattaaatggtttatttcagcaaaataaatgcaagctaaagaaag
ctaaaaataggctcattgggttgaggttgagctgaattgaactcgaatga
gctgacttgagctcgagtgagctggaaacgagctaaatggagctcaatga
gaaggaattgaactaattcagctcgcatgagtttgcaagcaatgcttagg
gagctggtccaaaagtgtgcccgaggcgtggtcgtatcaggaacctcgta
cacctaggatggctgctgaaactcgttgattttcgagcaactagtgaatt
tagttgggggtctaccgttttggcaacattgtaccgggagatgtgcgggg
cgacgcgactgaataaattgaaaatcggaggttgtctttcactactgcag
tcatgggcacggtctcactttctatttttatgtcctcaagtggaccaccc
gtatacattcctattcataacgaggtaaattttatattaaattttacaat
tattatgtagatttaaaatataatcgaatgcaaaaaatttatttaattag
gtggaaccatcaggcaagttatgctcaattacctacctctcttgaagata
tacggcttctattagaccaacggtcagaagcacaagtaagtattaaataa
aatagatatttccatcatgagatagtcgattggtatttagtatttagtat
ataactaatatttccatcatggtcatatagtttcaatagacaccatacga
ggatccggcaattcgagcagtaattccggacgagtacttccaaaatccaa
acgcttggcatgtgaaagtcccattggtcaactttgcgactgtggagatg
caccagtcggacagagtattacgacaatttagattccgacaactgattcc
cgtggcacctgaggtgttagatggtcatcacaaaatcgacctacggcaat
tacatacggattgaccgagattctggtcatactacatccaaatatgggaa
tatcggtatgattatataccaactcgggaaccgatcgtcattccagagtt
agcatgcgtgccagaatacatgccatggtttaggatctatggcaagccgt
atttactgccggcagaggagagacaacgtcaattgcgtgtccaaagggaa
tgacgtgaccctttaaatccaagaagaagggacgatgatgcaagcccatc
aacgaggcctagacattcacccggcccatcatcatcaccaatacaatcac
caagcccagcaacagcaccgacacagtcacccgacccaacagttcaaccg
atgatacccacggcacagccttttcagatgattctaggtacgtatcctag
ccattttatgtatcctaacccttatatgtttcctttctctagtcctatgg
caggttggagtcactgacccagttcatctctattttcaattacgccgagt
ggaccgccgatgtataggccagtgtcgcacgagaggccgtccgggagctc
ttctttttaccaaaccttttaccaaaccccatcaccgtatgggtttcaaa
cagcttcgccgttggtgatgcaaacacctccacagttactattctatcaa
ggtggctcatcgtcccaacaccgacaaccagatcccctatcagaggaacc
agaatccccgccggagcaaccacaaccctcgccggaagctggacgaagga
ggaatccagcgcgtaaccgtcgacgaccgccatgtggcactgaattcggt
aggcacgaagattgatttttatttgtacaaacattttgaatattttgata
ttatttgatgtaataaaatagaaattcttctatattatttcatgaactaa
aatagaaatttacttatacatttttaatataatagaaattcttttaaata
aggcaatatgttgaatatttctatattatttcctttaataaaataaaacg
ttgttttgactaaagtaattgtaatttactttaatatttttaataaaata
gattttattttaaataagtcaatattctgaatatttgtaccaatttttca
ttttaaaaaatataaataatacaaagttttttacaataacgttcaactat
tgcgatttgggcatgatcaacttgtatgccttaggttcctacactatccg
cacaacttctgttgactggctgtttcttggatatcaatattgttacgtat
tctagtcgagcaaggttgaccctttggtttgcgacgcaattctctatccg
gtaacaacttaaagggagcaagcgatatagacgaccacttacgttcattt
gggaccggtgggaatacgtgtctccagacgttgtacatgttttctaattt
gtacacttcgtcgacatagctcatcggatccagatggagattctgacaag
ctacaattacatgagcgtatggataatgaagtgcatcaaacatcccacag
tcgcaagtcttattttgcaagtgtacacaatattgcccgccaataacaca
ttggtgcgatttgtcaaactctgtcatgcgaaaccataagttgtctcgat
cgtgacacactgtgtgcacggtgttcacccactccttggccttgttaatt
tcttgcactaccttactgcaccatacatggcctccctacatctggcctac
ataactcactgctcactttggaaatagcaccgccaaatgaaaatgtctct
tgtacaactgatgttatcggtagatgacgcgttccttttagaatagaatt
tatgcattcagtcaggtttgaggttatatgaccatatcgtaggccgccgt
tgtatgcttgtgcccactattcgaaaggcatgttacaaaggtagtccgcg
ccttcgccattaattgaacgcaaaattgccaacatctcatgaaaacgatc
tttatttatttcataccctgccaatataagttcacaacgaatattacata
ccactctttcaattagaataaatctaaaatgacaaatgaaattatattaa
tagagactaaatacctatgttggtcacttgtcgtcgttcattcttagatg
gatattgcctgtagtaattggaagcagcatgccttaggtaataccgatgg
tgtgtgcgctgccataagcttccctgtcgatcaattgcagctagtatgcc
agtgccccgatccgaaataacacatatatcaggttgggggcacacatgcg
tccttaatctagatagaaagaaatttcagtcatcagctgactcccccggt
gttattgaaaatgcaagaggaagaattctctcactgccatcttgtgccac
tgctaccaatagccgatgagtatatctaccaaacataaaggtatcgtcaa
tttgtaccaatggcttgtagtatggaaatgcgcctcggcattgcttaaag
gtttaaaacaggcatttgaacgcttggcatccatgtagcaatcgattgtt
gtagtacgcatgttccgtttgaaggtctgttatgcaacctgggacgtatt
tcattatatgaagcgtcccacccactatgcatattctccaacgccttctg
cttagctatccaagccttgcggtaagagggcatgtaccccatttggctac
gtatattggcaattaagaccaacactgaaggggtagtatcaagctagcta
acatagctgaatccatcttgggatgatcttgtgaaatacctataaacgga
gtacattaaataatgcaacattacatactaacaatattattcagaaaccc
taaatactgtacctgcaacacatgtatgtggacctttgtactttttaatc
tcccacaaccctgtgcttttcctcaacgaggcgtaaattttccatgaaca
tgtaccgtcttgcactgcacacttcgcctcaaacttatcagctttggact
taacgacgtggtagttaacgccgttattgatgctatgttgtttcaaagca
ccaataaaaccatccttgttggaaagctgattacgaacttcaaattcacc
caaatccagtaccgaacttatacgatcacacaaccggtgtggtagatctg
gaaactccaacgcatcatctgcagacagatcgacattatgcatatgggct
ggaggtgagtatgccctgaatcgtggatcttcttcttcatttgaaccccc
ttcaacatcttcaggttcggttggaataggcttcagtttagagaataatg
caacttctgcactattgggcccgggctctcaaggtggatccacattggag
tcatattctaacccaccatcatctgtaacgtacgaggtcccctcaccggt
ggatgtcgtagggagtacatcatcccttcttctgggcgtttcataacgtc
cccaattggatgtagattgccagcatcaaatattgacccacggaggtgca
tgtcccatccagcgacagagtgtcgtgcaggggttgtgtattccacaccg
ctaccaaatatgggctgttccgtgttttgtaacccactaaccgagtgtca
ggcaggggtcgcgtatacctcttgaacaccagtcgcaagtgtatcattta
gcgatgtaaattgtacatataactcaatatagggtgctctactagcgaga
tgagtctgcaccattgcctctaagctacaagcaccttttatgtcaaacaa
gtcatatgtcatcggatcaacagaagaacagaatcgatatgtaatagaca
gaacttttattggcgtcgttccgaatattttatgcctaattcttttacga
aattctgtcaaatctatgttctagttaaaaaccagtcgcactgtattctt
cgataaaaaacaacaccgttctcggtgtggcaaacctcaccatcatagta
aataacagtactaatacgttcactcatcttcaatttctatccttcttagc
ctctctcaatttttttgttgttgtaacttatggaatctgcgaaaaaattt
tgcatcatttatagcctcaggccaaacatgcgttactgtagcaaaagcgc
gtccacttgggagcttcttttagtacttctactgacaaagcatcctgctt
aaagcatttttgacactatttgctcagaaacgtctactcgaaattatttt
ttcaggagctactgtagcaaaactgtgtccacgtgggagcttctttcagt
acttctgctgacaaagcatcctgcttaaagcgtttttgacactatttgct
caaaaacgtctactcgaaattattttttcaggagctactgtagcaaaatc
acgtccacgtgggagcttctttcagtacttctgctaacaaagcatcctgc
ttaaagcgtttttgacactatttgctcagaaatgtctactcgaaattatt
ttttaggatctactgtagcaaaagtgcgtccacataggagcttctttaaa
ttaacaaataatttaattaagtaaccttaaaccccaaaccccaatttatt
tgagtttttacttaaaaaccctaaacattaaccctaatctaattttataa
aaatttataattaatttactcaagtaaccctaaaccctaatttatttgat
tttttcttaaaaacctttaactctaaaccctaatctaatttttttaaaaa
attaattaaattactcaagtaaccctaaaccctaatttaattgatttttc
ttaaaaaaataataaacaagaaacctaatccagttttgaaaaatttataa
ttaatttaattgacaaactataaaccctaatcccttatttatttaatttt
tttccctaaaaatctaaacttaaaaacaccaaaaccctaaccctaaccct
aaaccaataacccaaaaccctaatcgtaggagacacgggcaaaatgcgtc
cttgaggaagcgtttttgcctacttggacaagggggggggccttgaagga
atctatttttttttttctaaggcagagggatccaaaggaaggcttnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnggggc
ctcctgaatattcagcttgattcgttcgatctactaccatcactaaaaca
atcagcttacagagaaagcccaacatagtaaatcagttaaactaacaaca
attgaaaaaaacgcatatattactcgatttctaaattatcggagtgtaaa
acggggcattatgtgcaattcatgggtatcgaagtacaaacaggggcacc
tgtgtgcaattcaggggtatcgaagtacaaataggggcacgtatgtgcaa
atcaagggtaccgaagtacaaataggggcacgtatgtgcaatttaggggt
atcaaagtccaaacagaggcacgtatgtgcaattcaagggtatcgaagta
caaacaggggcacgtatgtgcaattcaagggtaccgaagtacaaataagg
gcacgtatgtgtaattcaagaaataattaactataagaatttaattacat
agctataatgtgaaaatacaagtagaaattcaattacatattgaaatact
atgaacttacctttgcaactaacagcacgtttggttcgctgtattggaat
agaggcgtaatggattagaggcgtaatggattagaggcgtaatggaatag
aggcgtaatagcaaatcaattgtttggttgaatgtaatggaatagaggcg
taatagtaatcttgtgtttggttgaatggaatagaggtgtaatagcataa
tggaaaaaactaaaatgactagaatacccttagcataaatttgtttgggt
aaatgattattgttattgttatttaaattttaataagattattaatatca
ataataaataatttaatcatatttaaacgtaattattattaaatatatta
taattaaaatatataatttaataaaattcttaatagtcaatattcttata
tgaatttactcaaatcataatatatgatactataaaaatataaaattaac
ataattattattaaatatattataattaagaatctataatttaataaaat
tcttaataattaataatcttatatgaatttactcaaatcataatatatga
tactataaaagataatttaacataattattattaaatatattttaattaa
aatatataatttaataaaattctaataatcaatattcttatatgaattta
ctaaaatcataatatatgatactataaaatataatttaaaataattaata
ttaaatatattttaattaaaatatatgatttaataaaatttaaaataatg
atctagattcaaatttaagaattatttacatgaacaaaaatataatattt
gtttctaagttaattattttaataaaataattaaatatttatataacagt
gttctcatcttttggtatttttatatgcaattttaaagattgaatccaaa
cttaaaagaatatttatttgtaagcatttcaccgatttacttcaactcaa
ttattgattaatttttaataaacataaattcaataaccattactattatc
ttctgaatattgtactgaattttagacaatttttttattttgagaaagga
gttcatcataaatgcatcaccccttgtctagttctctaaccaaagcagga
taaacagaatggaacaaaagaacagcaagtaaaaaatagctgtatctatc
gaacactgcatttcagggcttaaataaagcatatgtcccagtccatgatc
acacaattttgagacaagattggaagttcattgtagtttagataattgat
ttatacatggaattatttcaagtgttgtttacctctgatcctataggctg
atataccacagacttgctatttccaaagttgaaaactaccctcacagtcg
ttaatgtattaacaaaaaataataagacatgatgtaactatccaagatgt
gggttcgctaccgctcggctcatccaacatctcaaccacaggagcatact
gcacaagttaaaagcaggaatggtgagggatgatattgtttatatacata
tatatagagagagagagattgaagttcatggagatgaaaaaatcagagag
agacctcatcattctcttcaaagtagattccatcaactgcactttttctg
ctggaactcccatcctaaactattttcaagcagctcttttaatttccttg
tctgcaaaattcacatatattgaaactcaggattttcacttcacataatt
tacttatacctgtcgcttgcaaataaataattgcaggggactaaaagtca
tccacattctcccatcagatactagccaaatcacccaaagattttaaggg
ttttcatatacacacagttcaggcagtctttatatctaacaatcaggttt
aattagttaaagattgaagataaaaagtactatatgaataataagcctag
tctccatttgtcaccattgactccttttaagaggagcaaaaaaaaaaagg
aaagggataactatacagaagaaataggtgaagtgtaaaaaccttcctag
ttcgtaacatgttttggcaagtataaaattggtaagaattgaaacctaga
aaagccaggcttagaacacatacccatgagagaagatctccatcaaccac
tgaagcatcttgcactaacgaaaagaaatcctgtgattccaccatcaaac
tacttatcaattttggtgtaggctaatgttactaaaaaaaggttaataat
agatacagattcgttttctacaaagatatacaaaagcaatgcatcaaagc
aagccagccattactaaatacaacagcctccaagactcaacaaccaaaaa
tactaagaagggggagagcgaagaaccaccacagaggaaatgaggcagta
tcatacatctagcagcaaccacgaacaagattttgtctaaaacttctgca
taatgggtaaaaagattcctaaaaacctgattgtcaagaaggtgacatag
acctctggaagttgtaatctgaaaagattcttatcattttatgaaaataa
gtggtacaaaaggtgtttgaggaagaagtgaggtgtaagtcaattcattc
catgttttcctctcaatgaagggaacagataaatcaattgtgtgaaaaat
acttgaaaatataaactccatatactaccttctctccatatttgattcag
gaagcatataagacacaacaaacattacttcaagatgcaccaaatacagt
taacacaatctccaaactattcaaatatacaatatggttttattaacaag
atactaaaccactagaccactgcaaaagagcatgtataatatgatcttat
taaaaaagtacaacagagctacctctcattgtgaagagcaaagagaacga
atcaaataaattgacttcggaaagcagccaaccaaaatggctacattgtc
aacttataaatacagagaacaaggttcacaatgttttgcacagacaaata
gaacaatatataatatgaactcccacagagctttattccacaaataaaac
tcgcatgccaaccactaattgaatgcagtggaatctatctgttaaagaac
atggagaaaaaatccaacaataatccaaaaggctattttttagcatgacg
cctggaagggagacatttattttccgatcgaatagtcactggttgtgcta
tgctgcagaaacttgcaagaacaaccgaaacaggaaaaataaaactgaaa
gaaacaagaatattaacctcctcttgatcaaacaaaaactcctcttcatc
aagtccagctgcaggtaaatcctcatcctcatgccctcccaattcaactt
cctcgagaacatcgtttccaaaaaatgcatattgtgatgcatcaaatact
gcacctcctgcataatagaaaggttaagcacctcctgcataatagaaagg
ttaactttactgaaatgagctcttcataaagaagaaaacacatcataaga
aaaatatcatttcactaaaaatcagtagcaacacagaatcattaaaaaaa
actttctctaattcaatgggcaggaatggggtaattgagatgggcgcaag
ttaacaccctttgtgtatccaagggcctgatatttctcaaaatgtacaaa
aagcagcttctccaattcaatcataattcaaataaatcgtgcttatttcc
atcactaaaaatattcgaaaccaaagtcaattcaattgaaagtctgaaac
accagcacactgaaatcattaactggcatgatttagtagccaaattcaaa
cttataattactaatctggaaaatgtccaggccaacatgaaacaaagttg
ctacttaaaaaccaaaaattgttcacatatggaaacgacatttgacttct
aactgaatcaaacagtgttaccacaattgttttagcaacaaaagcctgcc
tttagcattgaaaacacaatacttaaggatctaatttcatttcctcctaa
cctgttatacatttgatctcagaagaacggtaactcctccaccacaaagg
tttcaaattttactctaagcttaaagccaaccaaaagagaagaaaacaaa
gctaattttatccccaaaatgcataaaccaagtaaattaaagcaaaatga
atcgaatatcaacctttatcagtatcgccgaattgcttaagatcctcaga
agcatccattttatatgcacttcaaaattaccacgcaatagggaaaccca
aaacagaaaaccctaataattaactgaacctcacaatctaattgtttctt
ttttaaaaaatctaaaatctaaactctaacaagaaaaagaattacaagaa
aaatggcgaaaaaatggtttgaaaagcaagaacccttagcaaagaaaaaa
tgtttggtagagagaagatctgtatgtatttcatggaaaggaaatagttt
tcttttttctttctttcagatcaaattttttgagataaatagagagaggg
agaggaacccttcggaagagaaaacgaaggaaatttcttgtagcgattga
gtcgaccgaaaaagagtttcagattaacatcaattggcttgagtttgaga
gcagtataaggaagcatcaattttctcacgggcgatctgagacggtggaa
atttggttcgaagaaaactgctattgatgttgggagggagagggtggggt
ggagcagcagattttggctggggagggtaaaacagagacgattagctaat
ccttacttttagaacggaatggctaatcgttgttgaagcagagaaaatga
ggaatacatccgtgttataataggcctgtaataggcaatacatcaaacca
aacacgggattaagtggggattagtggggcccacggaataggggtgtaat
ggctaattcattacaccaaaccaaacatggtgtaaagcgtagaaatatga
tccagctaatctgtgattttcgtctttccctgatttaaatccggttgaga
tttatcttgatctaaataaataattacattcaattaagtgtttaatcaat
ctcaaaattcaattcaattaataattcacatttatgcatatttacccttt
gaccctaaatattttaaattttctcgatttagtccctaagctcataaatt
gaaatttaagcattttaatcctcatctcatgctagaaaaattctctaggg
acatctactagctcatacaaatcaccatttcataaatttaacttaaactt
ttactacttttataaataagtccctaaatgaaattttcataaaaaaattc
ctttacaaaacttgtttatttaactataaggactcaaaatcttccatcaa
acataaaaaatcatgcaaaaacaaccatagcaaaatcctaactctttaac
aattttggaaattagtccctgggctacctagattaagctataatgatctt
gaaaacataaaaatcattaaaaacgggactttgaatcataccatgcaaag
acttgaacttgccaaaatttcaaagcttgaatatagcttcttctttccct
atttttggtggataaatcttttagaaagatgataccacacttttgtttgt
ttaattttaagttgattgattaacttacatttttaaccttagttatttac
tttaatattcacttaaaccatgtccaatattgtccactaaccttatgaat
gatattattaccatttaagtccactcacatttaaattttataacaatttg
atacctttagttactagaactcaacttttgcatcttttataatttagtcc
tttttacgtaattaagcatgcgaacgtcaacacttcttaacgaaatttta
atacgatcccactagcatcccatagacattaaaataataaaaaaataata
atttaatcatcgaatttgtggtcccaaaatcactattccgatttaaataa
aaatagactgttacaactatcatcatcaacttcctactcctttcaaaacc
ttcaagtgctcctcctagagacagtctttctaataaccaacctcaagaat
acgaatttgaaaggcttttttcaaacctcaatcaagccattttcaagaga
gaacccagtatatatattgtccttttaatttctgattttgtatttcaaat
tttccccaaaaaattacaaaaatggcttttcttatgggctgctttttttg
gtgatctagaaacatgaaatgtttagcagagggaaatggatggtgaggga
gagggagagggtcggattctgttttggcaaagcaaacacatgggttgcat
tttttctttatttttctttcttcttcttcttctactgcaagttaatggag
gatggtatagagaccgtcgtttccacatgggatgccaacatggcaagtta
accacctcagctatttgttacgtctgtaacgatagtgaccaatttgtcat
ttttcaaaatttgagtgactgaattgaaatcaaaatgactgctttgtcag
ctacatcaaaattgagtgactgttggtgtaatttgcccttattttattaa
agtttgtaattaaaattgaatttttttttgaagattactacacaattttg
attttttttctacccattttacatgatttgtttatttgattttaataatt
agaaattaaattaaattataaaatattgaaaataaaaaatacttaaaatt
ttattttataaaaaattaaggtctcgtttggtttgataaaatattttttt
tattttcattttaaaaaatggtttttaattttaatcgaaaaatatgtggt
caaacttctatacttggaaatacgtggggggatgtcttagaaattggtga
attgggtggggataataattgcttcgttagtggtcagacttctactcttg
ggaagttaagggttaattcaaatgcttttgatgccaacaatgagatcgta
ctgttggactcttttaacccaagttctcaagatgagattttggacggaaa
aatctcttctttagcagccgaagacgtttgtattatgggcctttgcttga
tggtgaagttagatctcccattcgggctagagaagacttggaggtggatc
ggtcttcacttcactcctaacaatgcggatgggagcatcatgtgtaatgt
tcttattcctaacaattttattgagacgaaggatcattgtgagattgaag
aacagaggtccgatgaagtcattccttcaaaagttagaagagtgaggact
cttttcgagattgaggagaaaagtatttctcgggttaagaaaaattggag
aggtaggaaatgcaacaacaaaatcccaaaaccatgttctcctatgagtc
agctttcagattcggaattttaaaatcgaaaaaagaagctatggaatgag
gcttcggacgctttggaattgggtaagaagttgggtttacgtgttatcgg
taatgaaaatgaggtgataaaagaattgattcaggattcttcttcgataa
gttcgaactctactattattagacgtatttaatacttgttggtgaacgta
agattttgggtcattcaacatcttcctagagaatgaaacaaaattgctga
ctgtttagccaaaatggctttggaaacaaaccaaggattgaagatatttg
aggagatttcaagggaggtgttagcaatttttcctattgcccattcgagt
gacagtcttgcacagaggaacattatgtaattagttttatttgtttattc
tacttactaaaacaaaaagaattgattcaaattgaagaaaaactaggctc
gagcttaaaaagttagtctggataccttacatggatctaacctatcccga
tccatgagcatctctatatataacatcctaaataatttaacttgtgaaaa
catgtattgcaaaaaccaactttttaatgcggtgaaaaatcctaaaattt
aatccacaaaaaagaaaaatcaaaaccaataactatttaaatccgtaaat
aaaatatcaagtctattgatatgatttaggcctagtttaggaatgtttct
caaaagctaaaatcttcggcttatgaaaaaagtgcttctgtgccaatttt
tagtttgggagaagcactttttctcttaaaaaacagcttgattaagaata
aatttatcccaaaaaataaaaaacacttttgagaaacactactaaattaa
cctttatttttgagagtcgactaccctgttatctcttctagtgtataaca
tacgttttggttggtctaattaattagacctcaaatccaagttgatgcaa
attgtatttaattaaattagttggtaataccatgaattgaagccaaagca
ttacattaatttccttgtaatgctacattattttatgtagtccttatcat
ggctcaaactattaggggaaaaagcagaagattcagggggtggtctttct
ttatatatatttagatagctttcaatgtcttttttaggtagtcaacatgg
aatttacattttctttttgtttccgtttcatattcatcatttcatttgat
atgtaatataaataatatatatttctttcgcttcaaatacaaccatcaat
cttacacgaaaaaaattattaggtaagctcttttttattacatcaaccat
gttttataaataaaataagaagtacaaaatattgcagcaaccaatatttt
tataatcgaactaatagttaaattgatcaaattatcaattttttatatga
ccagttagttcaatttgataaaagaattattaaaaataaaaagatttaat
taaataaaataaaaacagtgcagggccttgctcaatggtgtaatggtagt
gcatgtcaattattcaattgttcccatttaacttttatttaattgaaata
attgcaattttgtcccatttcaaaagttcaaaatttaatttaagtccttt
agctttgaccctaaattttaaaattgtatctcaatcgttctcacataaat
cctagtttcacccttatttattaatttacacatcaattaattcaacctca
tttttcaaactaatgtactgacgaatccaatcccaacctgcaactatctg
aggtttctttgtttttttcccgagtatgttgtcctgttgtctcttttagt
ctaaagcatgtgttttgattggtgtaattagttaaacatcaaaattgtat
ttaattaagttagttggtttaggtaatatcatgaattaaccccagcatta
cattaatttcctcgtcatgctacattattttatttaggtttttttttttt
tttggaaaagcacttacctaattcattatttcatatatatatatagcact
tgtcaaggactttctttataaattattgaaagctctttttcttggaatct
accttatttacattccatttcatttggtagaaatatatattttttctaac
tttaaatacaaccatcaattctatgcaataagaattattagataagctga
caagaatattcaaaagttgattttcataatgtagaattggttagctggta
ttttgaaaaccaattattctgtcttttgacatgagctctccgtctgttgc
ttttgtactttttttttcttatttttgtcattttcttagaatcattcagt
tgagagatatagaggacgaactagcaacttttgaatctagtggatgagga
agaggatgcgttctgtgaggacgccttagtggtagataatgagtacaagt
attgtctggtaggactttgcttaacagatagcacagttcacttcctttca
ttaagaaataccatggccgaactatggcacccacttggaggcatctttat
ttcagatcttggagagagaagatgcctattacgtttctttcatgatattg
atattaatagagtactagtgggtaccccttagttttttaacaaccatttg
ttaatcctgcataagattcaacctggtgaagatcctattttggtgccact
atcaacctctgaattttggattcaaatccatgatttacccacagggatga
tgactgaagtaatggccaagaaatttggaaattttctgtggcaatttgtg
gaatatgatgcctctatcccgacaatagggattcagaaattcatgtgcat
tagagtccgcctgaatgtgactatgtcattgaaacgaaaaaagaaaatct
tgattgggaaggaacgagtggtttatgcatggttctaatatgagaagttg
agtttattttgtttcatttactgtaggcttgggcatgaggaaagcttttt
cccgttaagaacaaaaattgatccctcaagaattatttttggctaggata
tttcgctcagggcggtagcaaaatgtcggaattcctcgataactaagtgg
ctacgggaagctgatggctcgaccagtaaacagttggaaaaagaaagtgg
atctactgggaataattttgggatggagagagttactgggcatgattgga
ggagggatgttgagaaatcttatactaatcttaattttatgcctcttgga
tatggaaaggaggcctgtttcaagggatatgctaatatccataatatgaa
aaatagaaggattttaggggaagtttctaaaaatgggcctatgaaactaa
ttttggtttctgaaaataaaccccttgaaaccgtagaaagaaagaaacgg
aagcgaatggtgggtggtggaaatgtcagatctgtaaaagttatggagga
aaacacccaagatcaatcagctagctctgaagggcggagcagccgaatgc
aatgaggttcattaattggaatatttatggattagggagaccacgaatgg
ttaattggcttcgaaaaaaattgagatccttaaatccccaagttttgttt
attatagaaataaaagtttgttaaaaaaagatagaagtgattcaatcgaa
atgcgattttagtagtggtattgatgttgatgcaataggtactaaaggcg
gtttatccttgtgttggaaagacaatactgcgattagtctgagaagttat
tcccattttcatattgatgtggatgttcatgatcctgagaaggacaagaa
ctagagactcacagggttttatgggaacctggatgaacgacagaaaagta
cgtcttgggagttacttcggcggttgaatcatgggcaataaagaccttgg
ctggtggttggagatttcaataagatcacaagcttattcggaaaaaaaag
gtgggagacttagatcggagcgtcaaatggcgacatttagtaacgtcttg
gaggaatgtggtttgactgatcttggtttttatggtagatggtacacata
agagcaaggaaaattttgtactactaatattcgggaaagatttgatcggg
cttttgcgaatttagaatgatggaatcctttcttaaaatacatagttgaa
cacctaagccattctattgtggattcttatggaaagcatgtacatactag
acattgcccaagtaagttgtttcgatttgaggctacttggtgtcttgatt
cgtcttttgaggaggaaatacaaaatcatttggctacctccaatactaac
attcctgaaaagctggttaaattggggaaaaaaacttcaatactaggccc
gtatgaaatctcatgaacacaagaaaaataaggagttggaaagttgccta
cttgaactttttaactttgatccgacggatgataatctggctgggataac
aaatgtttagatgggtttaaactaggaagtagataaagagaaaatttact
ggcaacaacgtgctcaaattaattggctaaaaaatggggaccgaaacata
agtttcttccacaaggtcattactagtcaccgttctcgatatgagcaaag
cgtaggatggttggtaggaggaaaaaaatgggcttttaccaattatattg
atcgatttaggaaaaggattgaggggtggagtatctgttatctctctatg
ggtggtaaagaggtttttcttaaatctgttctacaagaaatcccaatcta
tgcaatgtagtgtttttctttaccaaaaattttatgccaaaatactaaat
ctgctaggggtgttcattggagcacttggagttcattatataagcccaaa
agtgaggttggcatgggtttcaaagacttatttatgtttaataaagcttt
gttggctaagcaagcatggaggttgttttctcaaccgaattgtttgttag
ccaaagtttttaagagtcgttattatcctttatgtaattttatgtcggta
gaagtaagctctaacccttcaccacctggcgaagtatatgtagtacctga
aatctaattgagaatgggctaatttgtcgtatcgggagtggagaagctgt
gaacatttggaacgatccttggctatcgagtcttgggaatactagagtgt
tagttaattctattaatccttattggataactgtaagttagttgattgat
aaagaaacaattacctggaagaaggctaaaattttagacatatttggcac
caatcaagctgagcgtatcttcaagatccctctctcttgtatacgattaa
atgacatgttgggctggaggcatgaggcaaccggggaatacgcagtaaaa
agtgggtaaaaagtcctaatttcagaacatctacattctactaatcagat
tcctactgctacaccccacatttacaaagaattttacaactctctatgga
aattacaactaccagaaaaaataaatatacatgtgtgaagactgtttaat
aattttttgcctcatttcatcaatttagccaagtgtagattgaccggaga
tgttttgtgtccactgtgcaacaacccattggaggatgctaatcatctga
gttagacttgtcaagtacttcagcaattgtggaaacacttacaaattttg
agtaaccaaagggtggattcctcaaattataaagattggttagcacaaat
gtttattgtaaagaataaaagacagcgaatgctaatggctatatcttact
aggctctttggtttagaagaaacaagttggtttatgaaggacagaaaggt
tctgtcaagatattttgggatttatataggggtacatgcaggagctaaat
cagacttagaatccttttcattttatgaaacctatgatgaaggaactatg
gcgacctccaaatactgatgttattaaactaaactttggtgcttctttta
atacagatacatacacttcaattgcagcagttctggcttgaaataacaaa
ggtcagattatggggtcctgtgcttacccttatgatggagtccaagatgc
ttttgtggcagaagctagggcttgcgagagagtcttactctttgcagctg
aaatgggtttccttaagatttctgtagaatgagactccttgacaatcatc
agaaagatcaaataaaaaaaagaagacaaatcgatcctccgaccggtgat
tctaagtatctacgacttatgaagaaggttcgaggagatatcttaccatt
tcatttcaagagaagtaaataaggctgcccatatgttggctaagaaggga
catcggtatcaagcaccatgtttttgggttgaaaaagccctagatccagt
tgagaagatgacaattgtggactggaacaactggatttgccaatattcga
taatattaaggtttttttttcagaagcttgagaatggaaaaggttcactc
tgaatctccacggtcttgtttctctcaagcttttgcctcttctactatgg
ttgatggttttttagctttgtttgaagaggttttggctggtatttctctg
gtttctctctatggtagtttaggggaaggctctattttggttcgtttata
gttttttactgtgggttttgttttaggcattttaatatctgtttgttatt
tagttgtgtgtggctgtttgcttttcatctttaagtggctttagtgtgct
gtttgatttgcttgtaacgtcttttcatctgttttgtaacatctttcagg
gtgttagtctttattgagcccctaaaacatttaatgaatatcagctttac
atttaaaaaaaaaagaattattagataagcttcttatgacataagttacg
atcccatttaatcattaaatgtcatataagattatttttacatgttatta
ttgaatagaaattttcaaaaaaacaaattattcaaaaaatttatttctcc
ttcttttgtgtctagatagccatcaaagttttttatttttcatcattttt
cctttattcttgaaaaaactttcaatttgcactaggttccaattattttt
caaagagataatttggtttactataaaatagtttcattctaacaaaggct
agaacaaaatcaaagaaaacaaattaaatccaaagtaaaacaagtagcaa
agtaatgagagataacacacaatatttattaacgcaattcgaattcatta
agtctaccttgtaatgcctcgtttagagaatgcttttattgaacaattca
tcctatacaactattggctaaagcccaaactaccctttacacacaagaat
atttgaaaccccaaattcgaactcaaattattacaaaccactctctcaaa
taccttattttaccatcaataaaataatcaaaagaatatctaaaagagcg
ttacaaaataactacaagaaaatacagcaaagtgatagtactagaaagaa
catatgttttctctctacttattggttaatttgtcccaatttagttatct
ttattttagcattttcagttcagtaaattgaattttataacccaatggat
cctagcctatttatccttaattttgtcatgttttggcactgatgtcactg
catgagtatttccagattgggcccaaaattgttgccgcacctaatagttg
tccggataagaacaaaaatgtgtaagctgtccagtctggtacaactaact
tgtatgtacagaggcaacatgattctgatgaaaggacaccttcgctattt
ggataaatattaatattcacgtgaaaaggaaaaaaaagtttttttgaggg
ggagtattatcttctgcaatctatcttttaaagcttttggctatggtgac
ttaagcctcctacgggtgaaaagacatgaaagggatgtagaccagctcct
gacgaggagccctgagtgcgacacaagagggagttaagagatcaagtcga
gattttctaggaatagtactctccacttgtttcatttatatttattttct
atttcatgtttgtacagaagttttaacaccccaaagtcggcctagacatt
atgatcggatctggcgatgtcacatggaaaaagatttgaagacaagattg
tcgagtttaaaaatcgttacagtaagttagcttttatttaattcgaaaaa
aaaaactagttgatttgctttaaaacttgtctattagcgaaagcttttgt
aaccaattaatttagggaaaatcgtttctatttacgaaaaaccttagttt
ttagaaaaaatcgtgttttatggagttgcagttttaaaaaaatccataaa
aatagtataaagtcctaaaattaaagccaaccagtccatagtccaaaaga
tacttcaaaaaccccaaataagtaataaattctaggcattaacgaaaaac
agtctaaaatttacgtatgccaccatcgagtcctccattgtatcaacccg
tcaagtttggggattacatgtacaaattaaatagagaagggtgagtttac
gcaaactcagtgtgtaatccccaaagaaaacatgcatacaaataataaac
ataatttagttagatacagtttggggcccgtgtccatcacagaattagtt
tgacccttagcccattcagatacaatctcagaaatacattagggccttgg
cccatatcagatacagaatacagatacaataaatcagaatcctacctacg
agcttctacacaccatctccgttcaacctaacacactgtgtggggattaa
atcaacccacccatccctacacaccatgatgtatcgaaatacgacacata
atcaaaaggttgcagctaagctgccagataataggcttaatagccattca
aacacttcctccaaatatcatcaacccaccccgatacaatccaacataca
aatatgtcatgccattatgcaattaataatacatacattcagatatcata
agtcatgctcggtatagaaattagacagacagatcacacatataggggtc
taagtaaagcttaccgaccctacagtaggtccacagtcgacttgggctac
ccgtgcaaccttacataacttttcagaaaaataggctcacacgcctatgt
ggcccactcggcccaaatcggccttggccatgtaatccatttttaatgta
accggtgctagttaattattcatatatgttttcactattaatttatatgt
tccttcaaagctgtctacttgagttactgttactaaattatttatatctt
gagctacagaattatgaattaagatccgcttgatttctttgaaactagat
tcaaatacctttctaccataaaatttttggttgaaggacccattttgggt
accccagatcatatttgaacgagagggatgtcactcaatctcctggtgaa
aggtgtgagttcttttaccagtgaatcggggaaaaccgtacctaggataa
ggccacacaactatgtccccctgaaaccctaggataggatgtttctcata
caaccaagaacccttcacacagtcgaccacatgagtggaccacacggcca
tgtgccctagaaaccctagagtagttcatgaacaatacggcctgaaccct
tccactcggctgtatctcccctatagcttaattttgcaattttcatatga
ccacaatctgttacatggtcatgtaccgcctccacacggtccagggattc
ccacatggttcggtcagacgaccgtatgccccctactttacaaattttac
tgttttgcctagaattttatgatttgttcaaattatttcctgagtggttc
ccgaactatttttagtgttttattttattcaattaagcccctaataatat
gattaacgttagaaccattagctaatttactgaattaatactatacatat
atctgcatgaattgtgaaaaatacatacgtttattgtatttgtatttgtg
attgtgattgtacatgcaagcatgccttatgttaccgttaaattgaacac
ttaataagcatgacttttgctattgaattgatctattataaatatattat
ttgctattgtactaaactgttataagcatattgattactactgtattgtt
ctgttaaaagcataaataaatgctaccgtattaattcattttgagcttgc
catattgcattgcatggggtgggacgatatgaaaggaggacttactggca
gtttatctgtaaacactggtgggttatccacaaaatttttggcaattttt
atctgcaaacatgcggtacattcacaacctactagcagcgtattaactta
caaacattgatggttcatccacaaactttactggcagctttaatctccaa
acccgttgtgtattcacaactactgacaacgtattaacctacaacattgg
tggtttatccacaagcaggagtgtccaaaaaataagagttcggaactctt
attgtggagtgtagcggtggagtaggacctttcttcttactgttaaattg
aacttgcattgcattcataagcatttgtacaaatttgtgaatactgagat
attacagtgaagaattgatttgaaataccaatattctaatttgctatcca
attgtgatggttttatgagttaaaaatttctaccatttgtctactgtttg
cactagtttacttgtgaatgaactcacactgagctttataactcactcct
ctttttatttccatctttacaaataacccactagattaagaagtggactc
ggtattcagggggcttagttcgaatctgtttttataaaatattttagatt
atttattatttgatagtttattatttaaagactatattattttattttga
gctatggcatgggactttaggtttcagttttatgtagcatgcatggcatt
taggttgtttatttcaaatttgactttaaaatgttgaaatatagatttta
attaatcatccatgaagcatagattttattaaggcacaacatactgcctt
atagctcgatctctgtcatcagcaataaggattggattacgaacattagc
ggctccattcctttgaacatcattttgattttcaaggtccattttttgta
gcttgactttgggctaatctttctcgtcttctttgttgaaatgtctaatc
gattttagggtttacaaaaagtagatcaatgattcaatctatgctcataa
actcctgaaaataaatcacaaaaaataaagaattaattaaataaaaataa
aaataaataaaccaaattgtaagaaataatttgacaaataatgattaaat
taacagttttcggtaatggcgccaaaaacttgtaacacgtagtttgtgta
agtatacacagttgttatcaagtaataagtaagtaaaagggttatcgtct
ccatagggactgtacatgttaatcaaattattgcaaaattgaatattaca
agttggtaagaaaacacaatagttttgatgtgatggataaaattaatgtt
aactaaatgcaaatgaattaatcgaaatgcaataaatgaaatgagatggt
ttaacaacaatttcacaagttaaataactataacatgaataagttagaat
aattacacatttgactcaattcattttcatcatgattaataaagttctgg
aaaatattcctatggcaactcgatttttcatgagcttggaatctaatata
atttcttttaaaatcttatacttagaaaaacatgtatatttctatgtcca
tatttaactaaggattccttagaatttatgtgaagtaacaagaatgggtt
aggtttgaaacaatttaatcatataaacctaaaagctatacaaggcatta
gagctatttcgagttattacaaacctttaattaaatctggttaggatcta
aatcaagcatgcaccttctagttattgtgcccattaattgccatctggtt
aggatcgataaactaattctaatgcatccaaacatattttagtgcatgaa
atacataaatgattttaattggacgaatgaacgactaaaacacagaatat
cataaacatgaatcaaacgaaccctatcaaattaatgtaatcattccagc
taaaacaaaattaagctatcattttaatggaaaaacattaaaaaaatttg
cgaatatgttaaataactaagaacaaaataaagataaggaagaagaaaat
aatttcggcaatcctctaaaaatcgatcgcagtggctttctccaatcctt
gtgtttgctcttttgcaaaatgctcctcaaggtgggcgaccaatagtgga
tttcctcaagggaaatgctagctaaagctaatggggagaggggatgctta
tgcgtggaagagagaaaaggaatgaacaagagaagaatgaagaatggatg
aatgaatgaatgaatgatggatggatggatgaaggatatgggaatgaaag
gtggtatatatagtagaagggtgacatgagagttagttaaaaatagcttg
agggatcccttgaaatgctccctctcttggctggccatgaattatggata
gtggctattttttccttgattttcttgcttgattctagcttgatttgtgc
taggggttggacgacaatcaaggtggaagttgggggcagatttatgattt
aatacatttgcagggacttccaaatgattcatccgagctaattttgggct
gctcatatgcctttgccaaatttaggccattctccctcttgttggatggt
ttttgacacccaattcattgcagactcaatctttttaaacaaccatcttc
gaagttgggttgcatggaattcttaggtccattttaatgagcttgtcatc
cacatgatatacaatttaacttgtgttcatgtgtgatattatttagctcc
catgctttataaattcaatggtctatctgcaacattttgagtaaaaatta
acatccaacataaaataataaaattaagcaaaattaatacttatttgtat
aaaattgcaagcttcacttaatttatgtctaatgtcttaatatgaatgaa
aatcacccaactagatatcaaatactcgggattaacataaattctaagta
aagaggtgatattaacagctatgaaatatctatataaattagagtttaca
ggagtaaatcattagttcttctataccctatattacggtaaaaatttaca
acaagttaccaatcagtgtaggttgatggcataccggtgtaagtgcttcc
gcctaggacaccgaatctccagagttgaacttgaactcattgactgaatg
ttgtatctgggtctcatggttcgggttaccgagataccccgactaataga
cagaatggccgccaaagttgaaatcggtgcctaaaactgaagaatgtctt
ctcattgatgattccgagacattataatgtgagattcataacaaagcagt
gaacccaccgcacaaccatgtcaaggacatttttcttctgctacgattcc
cgcattaacagtaacattggtcgaagatggaccagctccatcaacctcga
caaactcgacatgtaactcgagtatagtatttccacttgagcaatgcaaa
tctaggaccgcctttagctctggcttgcctttcacataaaataactcata
cttaaaagggtttagtgatgctagatatctacatgtcaagctcaaaattc
ttctccggcttgaactcataactttcctcctaattcttgactatagctca
tgcaattgaatggtacgactgaaatccaagttcacagactgggctcttcc
aaatacgaccctgacgtccatattgtaaatttgactgtcataataaatta
tggatttcactcgtcgactcatttcaatttaaaacaaattaaatatttag
aaaaaaaatctacagatggttttcaaagaaatggtaacgacacttgcatc
taacacttcaaaaatgaacaaacttgtttgtgtcacaatattgaatactt
ttgtaatttaataggaaaaaagaacgagagagggaaggcatacttgaaaa
agcatttcaatagatgcattttcattgaagtcacaataatgaaagggtct
tctatgcttgaaaatgtatctgggattcccaggggtagggaatcttagta
ggctttgaagggtggtggacagaaaactcatcttattggattgagcttta
aagccctatggtagggaaaatgtgataaagtgtttccattgcatnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaagctt
accccataatactttcgaaaagtaacttaggaactttacgtctcgatcaa
agaaaatggtgtgaggtataccatgtaacctctttgaggaacaagtcaac
cacatgtgcagcatcatccgttgtgtgataagcgatgaagtgaactatag
ttttgaaagttgaaaagccatagccaataatgagaagcagttgacaaagc
cacttttgtatgcatgtgagtgattttgatcctgttttttaatgattgtt
atgtttttgttatcgttttagtttaatctactaacctaggggtcaatttg
taaaattattaaaattatagggacttaccattaatgaattgggtatgcct
ttgaacttatttgatgggttagtaaggttggtagttatatataagtattt
tgtttagtaatttttggtaattttaaggtttagggacttatttataaaaa
tagtaaaagttcatgtagattttatgaaatgacaaaaaatatgggctgtt
tagaaacccttagaaatttggctagcgtggttagtggctaaaaatggtaa
atttgcaagtttcgagtttaaggactaaattgcataaaaggtaaaatgtt
ggggtaattttgtaaaatgatgatgaaagggcttaattgtatgaaaatgt
ttatttaagtgctcgaatgttttaattgaatgaaaattgttatctagttc
aagaaaagaaccaatcgaatttaaatcgaggaaaaactaaagtttcaaac
tagttgttgattctgtttttgcaatcattttagtcgaggtaagttcgtat
aagtattaaacttattaattgatgttttgaatgtaatgttaataaatatt
atgctatgtataatttagattgttagttatacgattttttgatattggat
caaattatgatgttaattaaattggatgttatatttgaaaatgtatattt
catggaagcatatttggaatagcataatgtaatgtaaataaaagaattgg
atacaatggtcctgtttgaaccttgtgaatacttaggatacgaatgacat
gtcattaggggttatacggttttcggtgttggtcttggatgtcctatcga
tggctgaggtcctgcatttgttgtgggttttccataactttgtgtgagca
gcatcgtgtagcttaatatcatgacccacagctcgtgtgagcagacccat
ttcacagcttgtgtgagtatatacggttacatgttacagtcacagctcat
gtgagcatttcccgagtatccgataatattccatttggttcgacaactga
ttaaagtttaatctaaatatgtatgtatatgaaatggtctatgttattaa
aatatgaaatagaaaatgttgatttatgtacttgaaatgaaaagggtatt
atttaaatacatgatggatgaaatatatattggatgcatattgtgatatg
ttccatgagttggctggaatttatatgctcattcatatacctactaactt
tgtgaagtggtgttatgcttggttgttttaaacacaatatgttaatttgg
aaagtttaagtttcctttatacgagctcacaaagcactagttgcttatgt
agttttttttctttattttgtagatcgtcggaaagctcgacccgttggaa
tctcgtcggagcacaatcacactatccgttttacattttggtagattttg
gttattttttataatggttataaatggcatgtaaaaggtttagaatgcta
tcttggcaacttggtttttttttgaatttgtgccaagcttatttgtgttt
aaatgtccttagttgtttgtttgtaaatggtggcataaatatgtgttggg
aacttatgcatgcccttttgaaagtaggtaacttatggtagaatggaacg
ttattgaattggttattttatttggtgtatgtttagtatgtgatcttgta
atattgaatatgatttgttttggtgtatgaattgtggtgccaaatgatga
catattggttaggcacataggatgaatgatttgacatgtttcatgtgtgt
ttgaatatgttttagtcatatgaatgtgtttggaaatggtttggtttggt
gcccaagtaattgaggttgaattcacttgcattaggagtctcttggaaag
cacacaacctgggacacaggctgtcacatggctgtgtgtcatttaaattt
taagtgcaggatgaaccacatgatcacagagagttacactgcctacgaca
tgaccttgtgtcctatactttgaattgtacacggttggccacacgaccat
gttttcaagccactatgtcacacggtcgtgtgacatctatttccaaaatt
tttcaaatttttcaaatttttttgttttgtttcaaaatagtctttcaatg
ttcccaaactatttttatggcctagtaggcttggtttaatgctcgtaagt
gtatttatgctataaataaaatgtgttgttgaatgttagtatttaatttg
aataattgttgctgtttgaagtgaaatgtttctaattgtattgtaatact
ccgtaaccctaatcttgaaacaagacgggttaggggtgtcatgtttgaaa
acctgtcaattacaaaaaagatattatctcgacctgtttagttcatggta
aaccaagtataaaatctgtggataaatctacccaaggtgaagaaggaacc
gataaaagagtataaagtccatgaggcattacctttgattttgcttgttt
acaagaaatacatttagaacttactttttccacatccttcttcatatgcg
gcaaaaaaaagtgttcttgtaaaatatccaagcttttgatgacaccaaag
tgtcccattaatcctccattatgtgcctcacgaatcaacaattcttacat
ggaacattgagacacacataacctgtttaattgaaacaagaaaccatcta
caacataaaatttgtcaatggcaccattctaacaagtactataaatagat
gaaaaatcagaatcattcaaataaaaatccttaatatgttcaaaccccaa
gactttagcattcaatgtagttattagagaatatcaacgagataaagcat
taacaactacattatccttaccatgtttgtacttaataacatatatggaa
atgtttcaataaactctacccaataagtgagtcgtttgctcgacttacca
tgtccctttaaccatttaagagattcatgatcaatatgtatgacaaacac
tctaggcagcaagtagtgttgccatacttgaagagctcgaaccaaagcaa
acaattccttgtcataagtggagtagttcagttgtgcgccattcaattta
tcactaaaatatgcaatagttctcttgtcttgcattaagaccgcaccaat
tcttatacctgaagtgtcacattcaagttcaaaggtgttagaaaaatcag
gtaatttaagaactggagatgaacataacttatcttttaaggcttggaaa
accttttcttgggtttcaccccacttgaaacccacaaatttcttgattat
ttcagttaatagggcaataatagggggggaatctttcacaaacctactaa
accatggtaaggtctcaccttaattaaaaacttaggtataggccattctt
taatggctttaaccttgtcttcattaacatggactccttatttatctgct
gtaattcggtttagtagattaaactagtttttgcactttaggagcttgaa
cataagcattttagttaagttttaattacatttttgtaagttaagttaag
ttcaataaagtgtgtaatttgagtcttttattgaccttagagaccgaata
aggcctaatggtgagctaatatactttttgagtgtgtaggagaccattag
aaggtgtgttaactcgatactagtccctatgttacaacacggagcatttg
atgtcacaacataggaagtagaaaagaagagttccaagaccgcctttaat
atcacgacacaacctaaggatgttgtgacatacccttgaagacgccctga
tgataaacatactgccctcgatgtcggacacaagacctggtgtgtcgcga
catcacctctgtacgggaaacaattatgagtcaagggcgttttggtctgc
atgatcaaatgttaagcacgaggacaacaactgacctagggttaaggaca
acagccaccctaaaatctataaataggctcatttaacatatgttagagac
aactttcgtattgtataatttcctctttctatctagtatttagttttttt
ttctttttttaggttttagattttattttagttcttgctattttctttta
tagggagatcaaatttgtgaaatagcatcaaattctgtgaggattctacg
cttaaattctaatacaaatatattctcttgaattgttcttcatgtttatt
ctttctaataagtttatattgtttattagatcaatgaggaactaatcctc
ctatgggagagtagcaagtggaggtatgattaattaattatttttagggg
tttcttagcagatcaactattcaggagaggaagaacctaaaccttaggcc
tacaaccctaggaagttgttaagatgggaattaacccaaattttctacgg
cctatccgtgaacaccttatctctgaaccgatctgaactgtgaggtcgag
agataaatagttcttgctgattgattactttagtgaagatcgaaagatct
tgctggggtattgactagttgattgaacaagaaaacccaaaacgatagtt
ggttatgactaccgaagagagctaatcactcatgatcatatttgatacat
tttactctttcatttctcgtgtttttgttatttctttactttcttattat
cttgagtatagtttaccaaaaacccttcttttgattctttgtaatataat
ccaattaaagtactaattagatccattcatgcttaggttagaattaaatt
agtgctcgcctcccttgggtatgatcctcggagtactaacatatttcgtt
gtaactatattacaacctaacccatatacttgcggataccgtcttttata
tcttttgtgtaggatttctactctgaatgttggtatgttcggaggcaatc
acctgtgcgcttacaatataacctagaaagattaacttatcacaaaaaaa
tacacttatcaaggttagcatataagtgtttgttccttaaaatatctaag
accgctttaacatgaccaacatgtaaattcaaagacttatattaaattag
tatatcattgaaataaaacaattacaaacttacccaaataaggtctcaaa
acatggtttattaagcgcatgaaagtactagacgcattagtcaaaccaaa
aggcatgactagccattcatataaactaaacttagttttaaaagtcattt
tccagtcatcccctctttcatttgaatttgatggtagccactttttaaat
caatatttgtaaagatacaagaccataaagttaatcaaatatatcatcaa
gccttggaataggattccaatacttaatagtaatttggttaattggttga
caatcaacacacatttatacgtaccttctttctttagcacaaaattacta
gcatcgcacaaggacttaaactttcacgaatgtgaccgtactccaaaagt
ttatcaacttgcttttgcaactccttcatctcatcgggattgcttcgaca
agttgcttgatttggagttgttgacctaattcaatttgatccttaatacc
cctcaaaggtggcaatcccttaggtgcctcataaaaaatatcttcacatt
cttgcaaaagagacataaaaacagtaggcaaagaatcgttaaggttagtc
aaagataaacaattttgcttaaatcgaacaagggtgcaaggttgttttgt
gagtaaggcttgtctcatatctttttcactcgcataaaaattgtgaacca
ctctttttttgtcacaagagaatgcactctccattgggccatcattaatt
tggttgtttttactagaggcttttttctctcatccttttctgaattttgt
gtcttactttccataacgccattacaaaatttcatcatattgatatgatc
gttgtgaacatctttcagattcaaaggggccaaagtgtacttcttcccat
ggaaaacaagggaataccgattcaatttaccatggtgaataacattacaa
tcgtactgccatggtctaccaagtaacaagtgggcggcatgcatgggaat
gacatcacaccaaacataattaatgtaattcccaggtttaaaagtgatca
aggactattttaccacacgtacctccaaaccttcgttaagccattgaaga
tgatatagattagggtgtttgctacatggaaaatcaaaagagtccacaag
gtaactgctcacaatgttagcacaacttccactatcagtgataagtgaac
aaagtttacctttaatcaaacacctcaaatggaatatattagtcctttga
aggtcatgatcatcccccaattggatgttgagggtgcgcctcacaactag
acaatgaaaatcgtctccatctattggtggttccaccaactcttcttcac
cataaaactcacctctatcatcgacatcatcaattaatgtaggcatatcc
agatctgttttgtccaaatcacaggtatgctgaccatcttctttgataaa
caaaagtctcattttagcacaatcacgactatagtgcttacaccctttac
acttaaaacattcaatttcacgagctctttgttgttttggtaaagaatta
gtaaaagtgggctacttagaagaagattttgtaggagccctagttttcca
ctcaaaagatttagtctcatcacgttttggtagcaacttattagtggcat
aaggaggttttgaattcttgaaggtagaattaaaactcgtatctctataa
tattgtgatgcaccaattggatgagattgacgttgttgaaattattgctc
aaccttaactgccttatgtatcgcctccttaagatcaatgtaggtttgaa
aattaaaagtattggttatcgaaatgttcaagccatttacaaaccatacc
atgatagtctcttcatcttcttgtacatttgctctttgcatgagcatttc
catctctataaagtactcatcaccggatcgattattttaaacaagacatt
gaagttttcgtttaatatccttataatagtgaaaagggacaaaacatttt
ctcatgatctgtttcaattgttcccacgaatcaacatctcgttcatgatt
catttagcggttcaacacaagttgagtccaccaactcaatgcataatccc
aaaattccaatgtagctaatggaactttctcctcctctggacatctataa
taatgaaacatgatctcaaatttatcctctcaatcacaatatgcatctag
atcactcttctctcaaaatggtggaatgttgaactttggtctagctgcag
aaggttggccacgatcatgagtacccaaagtttcattagtgtgacgatat
cctcgtctaccagtattagaacgagtgtaaggctattaattgtccccatc
atcatcactaccacgagctcgagattatcggttcaaaaaagtctccaaac
aagaaataactgaagttagcatttgaattggattgggaagctgattaatg
atctctttttgttccattcgaaacatagccaaattagcctcaaatgtatc
acgtacctcgtgcaattgttgatgttgataatttgtcatccccacaatat
tctcaaatttcatatcatgttgtttgtcatcagatggtatctcatcatga
tttttacggctatgagtgtcatgagtcattatggaattactgagaaaaaa
atttaacactcacaagaaaaaaatataaagtaaactcaccgttaactttc
aaaaagaaaaaaaaaacttaatgaggcaagatatcaatcttgcaagtttt
aaagtcattttaacaacaaccgtttcagatttatttagatcgtgcactaa
caaaagtaatcctaggcactaggagtccaaggaagggctagacaccaatg
aagcttgttgcacagatgaaaaaatgtgcaactttgtaaatccaattaac
acaagaaacaaggaagtgttggaaattataaaggaacaataaaagcaaaa
acaaatgaaattatattgttaagagttaaagaaatcgcataaaacctgaa
aaccgaaaaaattatggagaaacttgacaaacttcgttcgaagtgttcct
gatttccaaaaataaaaaaatttaaaatagagcctccttaaataatgtaa
atctgatttggaaaatttcagcaacaaaattaaacccacaaaatttttta
tttttctttatttttcgtctttttctatatttttccattttttcgaccac
ttttttttgtgggagctatttttcaatatttgaagagtgtgccaagaatc
aacatataaaatgtgccaagaatcaacatataaaattttagatcatttga
aaaatgtttacccactgaaaaatattttttctgaaaactttcaaaataaa
aaaaattattttgattttgtttactggaaatcagttgataagaacacaaa
gaacacataaactcctaagaaactgacacataaacaaatgaaattctatt
gttaagagtcaaagaaatcgcataaaacctgaaaaccaaaaaaattacgg
agaaacttgacaaactttgttcgaagtgttcctgatttccaaaaataaaa
aaatttaaaatagagcctcattaaataaggtaaatctgatttggaaaatt
tcagcaacaaaattcaacccacaaaattttttatttttctttatttttcg
tatttttctatatttttccattttttcgatcacttttttttgtgggaaat
atttttcaatattcgaagagagtgccaagaatcaacatataaaattttag
atcatttgaaaaatgtttacccactgaaaaatatttttttctgaaaactt
tcgaagtaaaaaaaaattattttgattctgtttactggaaatcagttgat
aagaacacaaagaacacataaactccgaagaaactgacacataaacaaat
gaaattctattgttaagagtcaaagaaatcgcataaaacctaaaaaccga
gaaaattaaggagaaacttgacaaacttcgttcgaagtgttcctgatttc
caaaaataaaaaaatttaaaatagagcctcattaaataatgtaaatctga
tttggaaaatttcagcaacaaaattcaacccacaaaattttttatttttc
tttatttttcgtatttttctatatttttccattttttcgatcactttttt
ttgtgggaaatatttttcaatatttgaagagagtgccaagaattaacata
taaaattttagatcatttgaaaaatgtttacccactgaaaaatatttttt
tctaaaaactttctaagtaaaaaaatttattttgattctgtttactggaa
atcagctgataagaacacaaagaacacataaactcctaagaaactgatac
gaaatgatatagatagtgaattaggatcgaaaagttttcaagttgcaggt
ttaacttaagacgctagaccgagttgaatggaaaattgtagccttaatac
ctaaacataaacaacaacgttattagaagaaaaacaatgaaaacgataaa
aaaatgtttgaaataaagagaaggaaaaagaaaaagattcgatttggaga
aatactcttagtttgattaactttgatgttcttagactaaagaaaatacg
aaccaaatggattttcggattcttgaacctagaaaataagaacttgaagt
gattagattcaagaaaacaaataaataaaataaacaagtaaaactaaaga
agaaatgaaaaatatgatgggtggacaaaattaaagatggaagatagagt
atagataattgaatagatgccctaagaagcttttgggacgagagatccaa
caactcccttcaatcgactctaatctccccttcaagaaagatctcttgga
aagtcgaagcttgatgatgatccccaacaatctaagaagattgtgttgaa
caacttctaaaacagacaagaaacaagtcttgcaaaaagaaactcaaaga
gtattttttttattaatcaaaagctgacaatgtgtcgtaaagatggtgga
tatcactcctttttatactacaaggaggttggataaaagagaaacaaatc
actaaaattgtggaagacaacttgacttgactaagattattaattgggcc
actaacagattgggccaaactaaaaatgaaaaataaactaagtcataaaa
ggatccaaatggaatctagttgaaacttcaagatgggcttatggacgtac
ccatgggctgattttgcatgttggatccgctcgttgcaagattggactca
tttaagctcgtcaatgtgatccatttcgttccaactccaaaatgtggttt
cttagaccaatattcaaaatcttgttttcttttaactcttggatcttcat
atatgatggaattggaccaagaaagtgaatattgatatccttttttcctt
tgaataagcttgtaggttcttcgttacaaactcttggactactacattca
atctgcacttgatttgcttagctttcaatcttgtaatagggccttgaggt
agcgtttgcccatcatgcccatgctcccttgattgggtcttgatgcttgc
atcataaacctaaaatagcaaaactcaaaacccgaatacaaagctctctt
aaaaaatctccccaaaactcttcatcaaatctcacatgagagatattcaa
tcaaatctttaaaagagggttataaggaccctttaaataggctaatatta
aagccctaatatgattaaaatatttttagattaatcagatttcaactagt
agaagataacagagtttaactgggagaaaagacataatttatgtgggaac
acgtcgccacgtcgtgatgtcatttatcgccttgttgtgacattgtccat
tgcgtcgttctgatgtcccgaagctccttgtcatgacgttgggcctattt
tgagtcttcttcagttgctcgttgatcgtctttctaagtgcctacaaaga
gtccgataaatgcgaggcaccctacagtacgggcatcattgaacgccatt
ttggggcttaaaaaatatgctttgttgtgcaagcatgtatgtcttaagac
atcagacccttaaagtagtatttgggcaatctttcttttttgtcacaaga
cataagtgtcatgtatcgagacttggaggtagaagaccaaaaattcaagt
ctaaaatgctcaatccccccaaaccttacctaatcatactaggggtgagc
aaaactcgattcgattcgaaaaaatcgaaaaaaatttgaatttcgagtta
aatgaatcgagttatttgagttaatcgagttattcgaatcaactcgaatt
tttttttcgaatttcgagtttgaatcaagttgagttttcgaattcgaata
actcaaataattcgaataattcgaatattaaactataatattttacattt
ttaccctaaactcccaaacttttttacttttccctcaaaacttttactcc
ttcccacttttcccccaaaacttttactcctctcccctcccaactcccca
atctacccaaaatccatttcccaccaaaattttactctcccatttacttt
ttctcaaaattttactccaaaaaaccctcaaaacattttattttccccca
taatttttatttcctcccacttttccccaaaacttttattcccttcccat
cccacctcccatctaccccaaaccctcccccctccaaaattttttttaat
attttccctccaaaattttactccccctatttactttccctcaaactttt
attccccaaaactttttattttccccctaaacttttacttctcacccttt
actctcaaataaaaaatcaaaattatccaaaaaaaaatcactaaacataa
atagtaataattttatttatatctactatttatattattaaattaaattt
cacattttatattatttatattattgaattgtttagtcatattgaatatt
tatattaaaattgaattattaattatgccataaaatgttcgtgttaaaat
tttatattggtatcaatttcacattttatttttaaaataacttttattaa
aaaatcatatttttacatttaatatagtatttaattccaaaatacatagt
gacaagaatctaaagataattgaaataactaagcaagcaaagaagctaat
caatatataaaaaaattaataaataaattatgaggtgatgaaagttaata
aaaaaattgattaagttggacaacttttattacgatgggtgacaatagtt
acaaggactcaaaattattttttaaaatttaactcgaacaaatatattcg
attcgattcgattcgaattccatctcactcgactcgattcgagaaaactt
caaataaagttaggatgataaaatgagattcgaaaactcgattaactcga
aaattttttattcgattcgatttgattcgatcggatgctcacccctaaat
cataccattatgtctcaactcaatttaaaacattttaaaagctcattgaa
gcataaattaaagtctcaaatatgtttaaaacaatttataaatcaaaggc
tacataaaatatctaaacaacttcaataacacttaatatcgaaaaattta
ttattagcccaagcctttatgtgcataccaaaatacaattaatgaagtta
atatttattggtgtttggatgaatctgtgtaaaatattttctgttgtttg
acagatttcttaaaaatattttataaaagttgttttcaatgaaacataca
tttgatattttcttatcttttcattatttaattaagtttattttatatct
ataaatttatattttacatttgttttgcatatattaaaaatattttgtta
aattcaagtccattacaacgttattttttagttacatgactaccaagtga
ggtttttttttatttaaaaatgtgacatcaacaaaactgacaaaaaattt
aacaatgttagcaattggacttgattttcaaatcctaaaagtaaagagac
taaattcttgaaaataaaagtacagagactaaattgcaaatttgtgaaga
gtacatagacttataacatattttaacctttatactacaaaacatttatt
attaaaatattaatattgaatattttcaataatatgtgaagaatattatt
taaaattattatttttaaaatttattagtaaaataaaattaaaatatttt
tttaataaattatattaataatttattatatgtgtaaatatacataatta
aatatgtatgtttaataatattagaaaatataatattttaagttaatttt
taataatttttaatattttttaaaataaaaataaaatttattatcaatat
aataatattaagtttgatttaagttaatttttatataaaaataaaattac
ctatagaggaacgttgaccaaactgttttatgtgagacaaacacaggaaa
atgcaggaaacattttccgtaaaaccttttacatgtaaacaaatgaaccg
ctaatctcttcggtgatgcaaccttctaaaggtatgggcttagacttctc
agaagagtcttccagctacctatttaaagcgttaagcttgaagttacttc
gacaacaaatgtgacatcttgtaactcgaatccggtgaccgtgtctggta
tcccaatgttacaaatagccaaccatattttaaaggaaatgttgtgctaa
tttgattaagttatctttgttattttcccttgtattttcacactttactg
atagccattctttttgagagattgaacctttgtatgtgagattttgggtg
agtggttgtaacaagataggactagctattggggttgcaattacttcttt
atgtaagggtagattgggttttatccaatagatggttggatcaattgtgg
aatgaaactattcatagagtgaggctctgtagtgtaggattgtttccaaa
ctatgttaacaaatgactgtgtgcaaatatctcttttctttctctgtttt
tcatttctatttcattgattgatcaaagctgtgattgaacacgtatttgg
acagtcttgttaaacttacagcaaactattgtgtttttcaagttgtgttg
agctagctgagggaccaattgaacaaatataattagggctcaaataattt
gtaattatattctgattcttcttctattaattataacattatttagtcat
agagtcaatccactaaaagcaacttataattttgctcgtttaataatttg
taacaaatataattagggctcaacttatagttcttctattaattataaaa
aatataattagggctcaaataatttataactcttccttaatatatagcat
tgtagaagcaacttatagttttgctcatctaatgaccttatcatgagtgt
taccgttctaggatatctttaataaaactctttgggttaaagttgttcac
ttaatatgatcctatttatcttatggtaaccattgcatctttctctgtaa
acaagtctattactaacaaataataataaaatcattgtttttggacgaat
gactcgtggtcacgtttctttttcatcaatgtacaatgttagttaaagga
taccatttactctttattgagctataattccgctattgcaagtaaattta
tgccatacataaattgtatacccaatataccaacttttgactctattatc
gattcaacacagacttttaatatatcaaaatatatgagctgcattcacat
agttacatactctggaataaggcaagtcacaccatgaatgtcataagtga
ataaatctaaaaatggatttaaaattaattcaacttggttcatgtctgat
gtattattaatccagataatcatatctgtgtgtctatctttttagaagtc
atccgctcgataactaagataagttatctctcaaattagacttgatagac
aacataatagtccattgaatcaatttgcttaattttgattctttgggaca
tggaccatttaaattacctactaatgtaaattgtcttctcgcatcatgac
tctaccacatgatgcaacttgatcattgctaaacattaggtaatcagtga
gccaatatttgcttatacattttgcttttcatgcaaaaaccattaaagac
aaacatacaaaagatgtaacactctacactcaattcgatcgttggatcca
aatgtgtgatgtcacattacgttattgaagcaactcagacttactcaata
catttccactaaagttaatacgtaattaacactcatatcaattcaaccat
caatcataaatatatacatacattaataatgctaaagattcttaattaac
aagtcataggattatgcaaggttgaattcgatgttaggattcaaattcaa
actcaatattcaaaatccaatagcatgtctcaagataaaaagactatttc
tcgagatagatttccctttgattagcatttttgtaacacccctcacccgt
ctctgttactagattagggttacgagatgctatcacacaaaacaaaacaa
aatcatgctatatcaattccaatttcattaaacgataatcattcatcaat
catttaatcaaatacggaatcatacatttccaagctttccatttaatatc
aagaacattcaaaaatcatcaatagtaattttaacaaattttaacaattt
taaaaatagaaatacgagttagctggacttagttgcaatgatttcaaaaa
cataaaatttactaaaaaatgattgaaaaaaatacttaccatgcaatagt
attgagcttggtcgaatctttggttctcaaacaatggtgatttcggtgga
acaaaagaaacattgaagaagatgttatctttttttttatgtttttaagt
aatgtttaatatttaattgcttaacatatattttattttatctaaaataa
tgccataaaccgtcgaacaacatttaaaaagggtatatttatcttttaaa
tccttaaacccattttaatcatacattttagctaataaaataaatagtac
ttaactttttcgtctattacgatttagtctttttttcttaattaattaaa
aattcatcataattaccagaccaaacttcaattcacctatataatagctc
tgtaaatattcaataataatattttgaagctcggtctatctgtaacaccc
caaaatttctaatttcgttattgtgaaaatatgaaacaaatatatgttag
ctttaatggttatgtgttctgggagtgtttgggaggtcccaagttcaagc
cttcgcttgggaaaactttggtattttgaatgaattaggccttacacttg
tttagtaggcttttacttgattgttgggtaaattacattagaatgggcct
gctagtctggtggttaaatggtgtgttattacggtgaaggtcttgtattc
gaatcccgatgcaggtaagggtattattttttgctcagatttcgggatag
agttgtgtaatagggggattctgagtagtggatgtgtagtgggaattagg
ggagaagattaagggattttgggggttatcgggcttttattttaattttt
tcccctaaccaaattttgactctcttttccaaaaaaaaagtatgccgtct
attcttctccctctcctcttgccgatattctctgagtttttccatctttc
tcttcgttttcttcgtcttgatttttccccaatctatttattttccttcg
ttttcgaacgcggttagtgctcgcttagtttcggtaagtgtttctcttca
tttctatcatgaatctcttaaagactgaagtggtaatattttttctctgt
gatttgggcatagggggaggcccagattggtgaattcagtgttttcgtct
tactaatagttaaacgaagggttatcgttgatggtaagttgggtttctgt
tcattcttggttgtcaattcgcttgtaaatccattaaattgatgttgagt
atcttgattataggctttggagtgctcagggactattttagcatcaaaca
aaacgaggtgtgtacttgaaacgaaaaaaaatggattcggcgaaaagcca
aaattgattgttgtttggacagcagcaataggctaactttgaaaaatcgc
cataaattgtgaaaatagaattagaggatgaaaaaaatatggaattaaag
cttattaagtctagtttcttatagaagaaacggtaaaagtaatggaattg
taaacagtgaggtataataaactttgtgagacaaggtcagattgaattcg
ggttcccctgttctaactttggaaaatcatcaaaaattggagaaaaataa
ttaggggttaaaatttacatttttaaattagtaatgagtctattttaaaa
tataaacaaattgaaacatcatccaatttttttactaagagataattaat
ttttagcaaagaaggaacgaaagctatcaaacagcagacagaggtaagtt
tgaagattttactgtactttattggctgaaccaaaaaatttgaaaatttt
atagtagaaagatatttaagtctagtttcaaaaacattaagcaaatctta
attcggaattctgtagctgaagatataaataatttagtaatagtgactca
agtagacaagtttgaaggaacatataagtaaatagtgaaaacatatatga
ataattaactagcaggggttacattaaaaatggataacgtgaccaaggcc
aatttgggccgagtaggccatatgggcgtatgatcccatttttttgaaaa
gttctgtaaggttgcacgggtcgcccaagttgactgtggacctactgtag
ggtcggtaagctttacttagacccctatatttgtgatctgtctatctgat
ttttataccgagcatgacttatgatatctgaatgtatgtactattaattg
cataatggcatgacatattttgtatgttgcattgcattgaggtgggttgg
tgatatttggaggaagtgtctgaaaggttattaagcctgttatctagcag
ctcagctgcaaccttctgattatgtgccgcatttcggtacatcatggtgt
gtagggatgggtgggttgatttaatccccacatggtgtgtagcgttggac
ggagatggtgtgtagaggctggtaggtaggattctaatttactgtatctg
cattctgtatccaaggccctaatgtatttctgaaactgtatctagatggg
ctaaggcccaaactgattctgtgataggcacaagccccagactgtatcta
actgaattttgttaattatctgtatgcatgttttctgtggggattacaca
ctgagtttgcaaaaactcaccctttctctgtttaatctgtacaggtaatc
cccagatttgatgggtcgatgcagccgaggactcgatggtggccacacgt
aaattttagactgttttccgttaatgcctaaaatttattacttatttgac
tatggactggttagctttaaatttggtactttatactgtttttatgggtt
ttttaaaactgtaactccataaaatacggttttttttctaaaaactaagg
tttttcgtaaatagattcgatttttcctaaattaattggttacaaaagct
tttgctaagagacaagttttaaagcaaatcaactagtttttttaattaaa
taaaagctaacttactataacggtttttaaactcgacaatcttgtcttca
aatccctttccatgtaacatcgccaaattcagccataacgtctaggctgg
gtttggggtgttacatttagtggtatcagagccaagttgcaaaactcggc
tgtggatttgggttttaaaacttggttttaaagagatgaattttaaatgg
tttgaaatatttttgactgagtatgtgctacactgaatctccgacgccga
ttctgtaagtgctctaaaaactctgataagtttttgataatatgagtagc
atattctgaaactactataggtagtactctgtactaagaacactgtggat
agtgtatactaaaaatagtagcgaaactgaaaactgtaataagattgcga
ttcgtgataataaactctaaacttctaatattgttttgcataaaatatct
actaatagataccgaaactataaatgattcataaaactgttaacacagat
aagctacgaattctatgatgagtgcatgaggtattcgcagatggggtatt
agaggctgaggttgaggccgtagtgcggctcgagctgagttctcgtcgtt
aagtagcatgccaaatctggatacgagtgagacaccggtttcacgtgcta
cagagaccgggtctcatgatcgtatggccgaggacgacaccttgtcccag
gctatgctgaggatattagagttgggcctaacactggatctgggagccga
tggtcggttacagaatgactcaggtccaatgaggatgagctattcagggg
tgtcactggagccacccctagcgtggccgagtactagatggaagccacag
aaagaatcattgacgatctgaactttacccctgaatagaaattgaaagga
gctgtttccttacttcgcgatgaagcataccaatggtggctgaccgttaa
ggagggcactcagcccgaacgactgacttgggatttatataagtctactt
tttaaggtaaatatgtgggggcaagctacattaacgctagaagatgtgag
tttctaaatctcacacaaggggatcgttcagtggctgagtatgaggccga
gtttctgagattgagttgctatgggtgaggcacagtggcgactgattatg
agcattgtgttctcttcgaggatggacttagagacagtttgagagttctg
atagctccgcagagggagcgtgacttttaagtactggtaaagaaggcgaa
gatcgctgaggaggtgaagtgcgttgagcgctaaaaccaggataaggaga
taggcaagaataagagggattcagagccctcgagttctatgatgaggcct
aagaaaaatgtcagatctggtgggcttattaaagttcgggcccctattgc
acctactaggatcaaaatttgtgggcattgtggaagacgccatccgggcg
aatgttggaggacgattagggcttgtttaagatgtaggtctactgagcac
cgtgttcgagagtgtctgttgagggccgatcatgtacaacctgcgggttc
tggtactgcacagctaccagagctagttcagccgccgcctaggggctgtg
gtcaggataggggtggtaatggtatgggtcgggtgtagagagcaccgagc
agaggtgctggacaggctgaggctagacagtcgaccctagtttatgctgc
tcgtcgtcaagaagatagagatgctccggacgttataatgggtacgtttc
ttacttttgatgtgccttacactgcgttgatagatataggatctacgtat
tcctatgttgcctgttctgtttccaaaaacctaaggattcttgttgagag
tacttctagtgaggtgactgtgttgagcccgctggggaaatctgttagag
ttagcaaactattaaaggttcaagagacggtatttctggccgatttgatg
gagcttctatttggggagttcaatatgatattggggatggactggttggt
caagcatcgtgttagtttggactatatgactaagagggtcgtattgaaaa
ctgaagggggtaatgaagtagttgtgattgaggagcattggaattaattg
gctaacgtgatctctacactggtagctgagaaactggttcgcaagggatg
tgaggcatatttggcctacataagtgttttcacttctagggactactgtt
aaggactttagaactataagggattttctgaacgtcttttactaaggggc
taccgggtttacctttgaatcagaaagtggagtttgggattgagcttctc
cctggtacagctctggtgtctatcgctccctatcgaatgacaccgaaaga
gcttacggagctcaaggcttaaattcaagagttattggatcgtgggttca
tccaccctagtgtgtctccgtggggagcatcggtactatttgttaagaaa
aaggatggatccatgaggatgtgtatcgactaccgaaagctaaataagtt
gactattaaggacaagtatccatttctgaggattgatgatttgtttgact
agttttgaggggcgtctgtattctccaaaattgacttgcgttctgggtat
catcagttgagggttaaggaggctgatgtgcataagacggcatttaggac
tcgttatggtcactacaagttttgagtggtgccatttggactaactaatg
caccgacaacttttatggatctggtgaacctagtgtttcagccctacctg
gatcggcttgtagtggtgttcatcgatgacatattggtttattcgaggac
tgaggatgagcatgatgagcaccttaggattgttctttagattttgaggc
tgtattggactgaaagcagcctaagaatatgtctaagattcgtaattttt
tggggctggtaggttattaccgacggtttgtggaaggatttttgctgatt
gcagcacccttgactaagatattacgtaaaggtgtaccatttgactgaac
taatgcgcagcaagaggctcctgttttggtaaaacctgaacttagaattg
agttcatggtttatagtgatgcatcacatgtcggtttgggatgtgtgttg
gtgcaagtgttggaacgccggcacccctacggcgcagcgaaaaaataaaa
cattcggcgatcctaactatggatccatgtgtgaggaatgaatcggggtg
aaataaaggtttcgaaattaccgaatctttattctgagtagacagcaatg
cctcagcaacgagtaatttgatctactatcgaaccaagccgcaatctatc
gtgactcaggcctctacgtaatccacccagttgacaatgaatggaaggat
ttcccaaaactattttggaaaagactttgctttgacggctactagaccct
aagcaacgaaaaagggatttttatatctatttttagggtttctagaaatt
aaataaatataacaatgtttttataccgaaaactacaattacattaatta
taataatgattttggtaaactatatatttatttgaatttatatactaacc
aaattcatgttctcattatgcatacaacaaccttgtacataaagtgttcg
atattcgattacccaattaaattaattctataattaatttaattcaagcg
acaaccaaacataataccaactatgttctattccattcatttcaactata
gggtgtgaccctgtaggttcttgtaacgttagcagtaatactagaatgat
tccaatgttacaaacaatgagtggtacctagcaatgcatcattggtacct
aagtcacaagaaatcatgattcgacgtaacctttttatgattaacctttc
atgcaataatccttaagtcctttatctctggattggatacaagtcatgaa
atagtcacacttgcatagtccattccatgttccttaatatcttaagtaga
ctatgatatacaaataagtatgacatttcatatcagcttatttgagtatg
gccatgcatttctagtctcactcaatcaagtggcctaagatattactccc
attatgtaggaaagacttatcctatatcgatcaaccatatccctctacat
agatcgtggtatatccaacatcagcctttatagaacaaccagttatggtg
tatgtttgactgtatcaaaatatacaactcacgatgttggaattctgatg
atctcaagtctgaggatcatatacatattaatcattatgagtaatgtcat
gacaattacataataatccaacaaacatacttataacggatcagtccaat
atgttgttctctaacacacatattcatgcatcgattttgacattccatat
caataacaactctttatcatcaatcaactacatgttagtcttaatgcatt
attgttgtcctatccaacaataatacttgactaaggaccttttaagaata
atcatattattctcaggacattattataaaacagtttattgatacacaca
gaaaagaaactgaaataataatggtaacgccttatattaataaatatgat
aaatcaagtatgttattgcaaccatctcatgattgatcttagggcatact
ctaacaatctcccactagcactaagaccaatcagttatatatctaatacc
aagcgacttagtgtgacgatcatacttctgttgtctcagaggcttggtta
ggggatcagcaatgttatcatctgtaggtactctgcatatctctacatcc
cctcgatcgataatctctcgaataagatggtagatcctaagtttatgttt
ggatcactggtgagatctaggttctttagcttgtgcaatggctccattat
tttcacatcagagttctatagcatctgatatgctaggcacaacccctagt
tcagtaatgaacttcttgatccaaatcgcttcctttgctacctcactggc
tgtaatatactcaatagaatcggctaatgtactttgctttgaactcttcc
acctcacagcaccactattaaggcaaaaaacaaaacttgattgtgatcga
gaatcgtccttgtcggtttggaagctagcatcagtgtaaccttttacact
taactcttcctcaccaccatatattaggaacgtatccttagttcttctta
agtacttaaggatattcttgactgtggtccagtgaccttcacttggatct
acttggtaccggctcgtcatacttaaggcatatgagacatctggacgggt
acataacatggcatacatgataggtccaatagcggaagcatatggaattt
tactcatgcgttctctctcttgtggagttgaatgacacatttccttcaag
agtgaaataccatgtctcataggtaggaatcctttcttagattcttccat
actgaaccttttcagtactttatctatgtatgtactttggcttagaccta
gtagtcgtcttgatttatctctatagatcttcactcctaagatgtaagta
gcttcgcccaagtccttcatagaaaaacaacttcctaaccaagtcttaat
agactgcaatgtaggtatgtcatttcctatgataagtatgtcatccacat
acagtatcaagaatgttatagtgctcccactaactttcttgtaaacacat
gactcatcttcatttttgataaaaccaaactctttaattgcatcattaat
acgaagattccaacttcgagaagcttgctttaatccataaatggatcttt
gtagcttacatacctttctagcatcttttagattgacaaaaccttcaggt
tgtgtcatgtacacatcctcttcaagtttcccgttaaggaaagctgtttt
gacgtccatttactagatttcatagtcatgaaatatagctatagcgagca
agatcctgatggatttaaacatagctacaagagaaaagttttcatcatag
tcaacactatgaacttggcgaaaacctttagcgactaatcgccccttgta
tgtttgtacattaccatccatatcgattttcgttttgaaaacccacttgc
accctatgggtttaaccccttcgggtgggtcaaccaaagtccatacttag
ttttcatacatggaatccatctcagatctcatggccttaagccatttctt
agagtctgggctcgtcactgcttcttgataagtcctaggctcatcttgat
ctataagaagaacatcaccatgtgttgtaatgagaaatccatatctctca
ggtgcttggagttctcttaaagatctacgcagtggttgtgtttctacagt
agttacttgttcctcaattccttgtgaaacttactgttgttctatctctg
gttcagtggtattttgtgattctcgaatttcttcaagttcaatctttttc
ccatttccttttctagaaacaaattctttctccaggaagacactagttcg
agcaacaagtattttgttctcagtgggattaaagaaataatatcctttgg
tttctttcggataccccacaaaaaaacacatttttttagatttaggttca
agcttagtagacgtctgatgtttaacataagcttcgcaaccccaaatttt
cataaaagacatactgggacatttcccagtccacatctcatatggcgtct
tttgaaccgatttagatggaacacgatttagtgtgaaagcatctatctca
agtgcatgtccccaaaaggaagtcggtagattagcatgactcatcatgga
tcgaaccatgtctaacaaagttcatttttttctctcagaaactccattcc
attgaggagtaccaggaggagtaagttgtgagacaatcccacattgcttc
aaaagaacatcaaactctaagctcaaatactccccacctcgatcagatcg
aagtgtcttgatagttttgcctggttgattttgtacttcatttttgaatt
ccttgaactttacaagggactcaaacttatggcgcatgagatagacatac
ccatatctactgaaatcatcagtgaaagtaatgaagtagtggaatcctcc
tctagcctgtgtatttattggcccacatacatcagaatgtattaggccca
atagatcactagctcattcacttttaccagtaaaatgagatttagtcatt
tttctcaataagcaagattcacatacttcaaattgttcaaaaataaatga
atccaagagaccatctttatggagcttggatatacgttcctcacttatgt
ggcccaaacgccaatgccataaataagtttgatttgagtcacttattttt
gatcttttagtatttatattgtaaatgggattcatttgatctaaaatata
gaggtcattaaccaattgtgccgaaccatagaaaacattattgagataaa
aggaacaacaattatttttaataattatctcaaaaccaattttgtctaaa
caagaaattaaaataatgtttttagtcaaactgggcacataataacaatc
ctctaaacataaaccaagtccactaggcaaagataaattatatgttccca
cagctaatgcagcaatttttgctccatttccaactcgtaggtccacatct
cctctagccaaagtcctactcctttgtagtcctggtacagaagtacaaat
gtgagaaccacaaccagtatctaatacccatgaagtagtagttgataaat
taatatcaataacataaatacttgaagcagacgctccccttattttggcc
ttcttgacttcctcaagatagatagggcagttccgcttccaatgtccagt
cacaccacaatgaaaatagtttccttccttagccaccccacctttaggtt
tcaatgcagcctttacttttccaggcttgggcctacctttgcccttgggc
tttgtctgaactttggcctttccctggtccttgttattactgaccatcag
taaaggcttgggtctaacctttttcatgttgccttcattagttcgtaaca
tactgagcaactgtggcagagtcttgtcaatttcattcatattgaaattg
aggacaaactggctgtagctatccggcaacgattgtagaataacatcagt
ggccaactcttggctcaatggaaacccaagcttacacaggctttcaatat
agccaatcaacttaaggacatgacgtcctactgggcttctttcagccagc
ttacattggaatagggccctagagatattgaacctctcttaccgtgcttg
cccctgatacagttctttcaggtgctcaatcatttcataagcaaccatgt
cctcatgttgcttctgaagctcaggattcatagtggcaagcataaaacat
ccaacgtctaccatgtcatcgagatgcttcttgtaagcatctctatcagc
cctcgaggcattagtgggtggttcgttaggaaccggttgttcaatgacat
ataatttttgttcttgtttgaggacaatcctcaagttatgaaaccagtta
agaaaattcaaaccattcaatgtttccttctcaaggaccgatcgcaatga
gagtgtattagtgtttgcagccataatgtatctacaacaataaaatatgc
gtgtgtaaatttaccaaatttatatcaatcattaaaaggactttattaaa
tgatgatcccactattttattacaaaattaataaccctcatatattagtt
tcggaaagactttctcgaaaagtatttcaagtgggttaaggatccatatt
tcacctcctcttaagtcagctttggctttactctcaagattattgttatc
taggtaagcaacacttgctaattacatcatatgtaactcctaaagtttgg
tgaacaactcttgttctaatcatcttatgatttatccaaattacttgcct
ctaggtttctaatcctattagaataacctagttaagtcattcaccaattt
taaccagcgaatatcacttgtttattctttgcgtttaaccaagataaata
ctagtacttcactttagcagattctacacagtattgatttaggccttaac
aagggtaaaattgaaagcctatattgacttaatattttaatagagggatt
ttgttaaggttgttccatctcaccaattatggtttaccttagtccattta
gctatttaattgatctcatcaattaatgtggttcattattatcaaatttt
aacatatttaaaatttggcatgccttaaacatccatagcatctcatacat
gaataaataaagcaataaataaaggcaatagttatagcccataaactaag
gtggtgcaacccaagccaataggagaaccaaaaggaaacctaaaggtgta
agccgtttcacaagctatcggtccacactagttggcccatcttccttctc
gtctagcccacagcaactcttgcaaattacaatatgaagaaactcgtttt
acatacgagggagtaagatgagaagagaaatacaagagaatagtagtaag
gcacgacacgcaggccgtatttataaaattacaaccttttatcaaatggg
tcatcgggctataactatgcatttcaaacaccgtgcatgtcaaagatagc
ctacataattcaacgtcttgttaaggtgaattataaaatatcctttcaat
gtcttgttttcaggagtttagtccttgaggtttcatgccggaacaaccct
tgttccactaaccagttaactcttactagaaactgtaagcaccaccgtcg
caccattacagatctgttaacacttaacagtaataacataaaaccgaata
ggtcataacaccatgattaacatttaatccattgtcaaaaggaacggtta
tctggttactcttaaacgatttaaacagttagaaacataataaaaattga
agcatgcatctcatacaattgcatcacccaagtatttaaacccgagtaca
tatcacacaagtggctccgataccactgttggaatgccggcacccctacg
gtgcagcgaaaaaataaaacattcggtgaccctaaccatggatccatgtg
tgaggaacgaatcagggtgaaataaaggtttcaaaattaccaaatcttta
ttctgagtagacagcatcgcctcagcaacgagtaatctgatctactatcg
aaccgagccgtaatctatcgtgacttcggcctctatgtaatccacccagt
tgacaatggacggaaggaatccccaaaaccattttggaaaagactttgct
ttgacggctgctagaccccaagcaaagaaaaattaggatttttatatcta
ttttaagggtttctagaaattaaataaatataacaatgattttaaaccga
aaattataattacattaattataataatggtttcgataaactatatattt
atttgaatttatatactaaccaaattcatgttctcattatgcgtacaaca
accttgtacataatgtgttcgatattcgattacccaattaaattaattct
ataattaatttaattcaagcgacaaccaaacacaataccaactatgttct
cttccgttcatttcaactatagggtgtgaccctgtaggttcttgtaacgt
tagcagtaatactagaacgattccaatgttacaaataatgagtggcagct
aacaatgcatcattgctacctaagtcacaagaaatcatgattcgacataa
catttttatgattaacctttcatgcaataatccttaagtcctttatctct
ggattagacacaagtcatggaatagtcacacttgcatagtccattccatg
ttccttgatatcttaagtagactatgatatacaaataagtatgacatctc
atatcagcttatttgagcatggccatgcatttctagtctcactcaatcaa
gtggcctaagatattactctcattatgtaggagggacttatcctatatcg
atcaaccatatccctctacatagattgtggtatatccaacatcagccttt
atagaacaaccagttacgatgtacgtttgactgtatcaaaatatacaact
cacgatgttgggattatgatgatctcaagtctgaggatcatatacatatt
aatcactatgagtaatgttgtgacaattacataataatccaacaaacata
ctcataatgggtcagtccaatatgttgttctctaacacacatattcatgc
atcgattttgacattccatatcaatgacaactctatatcatcaatcaact
acatgttagtcttaatgcattattgttgtcctatccaacaataatacttg
actaaggaccttttaagaataattatattattcttaggacattattataa
aatagtttatttatacacccagaaaagaaactgaaataataatggtaacg
ccttatattaataaacatgataaatcaagtatgttattacaaccatctca
tggttgatctttgggcatactctaacaacaggatggtaaggtggttgtat
atgtgtcccgttagcttgagacacacaaggcgaactatctgacgcacggt
ttggagttggccgctgtagtctttgcattaaaaatctataggcatttttt
gtatggtgagaagtgtattatctacactgatcataagagcctcaagtatc
tcctcactcagaaggagttaaatcttaggcagcgtagatgggttaagcta
cttaaggattatgattgtaccattgagttcctcccggcaaggccaatatg
gtggccgatgcgtttagccgtagggttatgaccgatctgagagcgatgtt
cgctcgacttagcctatttgaagatagaagtctgttggtagaacttcagg
tcaaaccgacatggattgaacagattcgaggtaaacagttgggggataag
tctctcaggttacattttcgtcaggttgagaatggtgacactactgattt
tgggataaacagtgatggggtactttgttttcgcagtcaaatttgtgtac
cgaatgatgaggatttaaggtagtcgattctgagaaaggcgtatggtaat
ccctatactatgcatcccaacaggaacaagatgtaccgaggtcttcagaa
attatactagtggccagggttgaagtgtgaggttaccgacttcgtttctc
gctgtttgccttgtcagcaggttaaggctgaacatcagttaccttcaggt
ttgctgcaaccagttaagataccgttatggaaacgagagcaagtaacgat
ggacttcgttagtgggttgcctctaacgcccactaagaaggattctgtct
aggtcatcatggatagattgaccaagcctgctcacttcatcccagtaagg
atagacttttctcttcagaaattagctaagctctacatatcaaaaatagt
gagactacatagggtacttgtctcgatcatttcagatcgggattctcatt
tcacatctcggttctagaagaagcttcatgaggctctaggttcaagatta
gacttcagtactgctttccatcctcagacagatgtcagtcggagacgatg
attcagatactggaggacatgttgcggagctgtgttattgatttccaagg
cagttgggaggagtactggccgttaaaagagtttgcctacaataataact
tccagtctagcatccagatggtaccttatgaggcactatacggccgtaag
tgtcgcagtcctttatgttggactgaattaggtgagcgacgtgttctggg
tcctgagttggtctttaagacaaatgataaggttagattgattcaggatt
ttttgaaagcggcttctgataggcagaagtcgtatgcggatttgaagatg
tttttttctagaaactaaggtttttcgtaaatagaaatgattttccctaa
attaattggttatgaaagcttcctctaagagacaaattttaaagcaaatc
aactagtttttttaaattaaataaaagctaacttcctgtaatggttttta
aactcgacaatcttgtcttcaaatccctttccatgtaatatcaccagatt
cgaccataacgtctaggccgggtttggggtgttacactatcaaaacgagg
tttcgatatcttattttccaaaatcacttgactttcggtgcgcgccactt
gtacattgaccaactgaccaattaataaaatctattaaatcacgattcac
tattatactatatataactcataaatattaattaaaaatatctacaaact
ctttcgtcaaaattgtggtcccaaaatcactgtttctaacaccactaaaa
aatgacccattacgtttttgcttcaatgttgatatgtctgaagacatttg
ggtacaagtatcgatactaagttattcatgtctcgaaactggtctcaaga
tacacttttcctgttttcttaatttagctccgatgtttggatgtctcgag
acttggaacaggaaaaaattattttagcttcgatgtacccatgtctcgag
acaatagtcacattgtctcaagacttcatccattttgtctcgagactggt
ttggctaggatcgagacccaatccactaaaatataccaatggtaaaaatt
gttcttgaggtctcgagacatgttcttactgtgtcgacactccaaggtaa
aatggtttaaattaagcatttcaattgcattcaaatcttaaccaaaactt
gtctaacttacctaaactttacaccaaactcaaatacaacaatttcactt
gaaaacgtattcaaacacctcacaaacatagtattcaatgcttcaccacc
tagcagagtaaatttcatgaacaaacaattatggtcatacataatattca
actaatcaaacattgaaattaagcttataaaacattataggcttaaaatt
ttccaaaacaaaccaaacatatgtccaaccataagactcgaactaggtac
atgccattaatcataaatttatatgcaaaaagagtacacatttgatttaa
gttgagctgagctactgaccttggatacttgtagttttgatctagtaaaa
acctacccgagacgtgcacaaggaaacaaacataaccataggttgagagt
attgaatacttagtggtgctaacaaaatttgaaaacaaacataaagcaat
aagtaaacaaacttattaataatatatgtacataaatgtttagacaggtt
caacattaggcatatcacatacaagcataataccaattcatatccaaaac
ttattatcatcacttccattattcattcaaaaatcacatttttgaattat
catagtataaatatagatatctcatcaatataatcatttaaaatcatttt
caataaaaatattaatccctattaaccgaatatagactcaaaggtcaagt
atacaagacccatccaacacaccaatgactcataagagcatatccatcca
atacaccagtgtctttaaagagcaaggaccgtaagaattaaatcatatcc
ctccaacaaaacagtggctcataagagtgtatccatccaacataccaatg
gcttaaaagagcaaggctcgaagccaaaaatcctcgtcaaatctccacaa
ctcactgcacatactctagaccctaattggcatgtcaactataactgaca
tcatttaataggatgttatccaatcataaaacattataagttttaccaaa
tactatatcatttcattatgttataatattatattcaaatcattaagtca
tagagatattcatgtttctcatcacaacaactcgataagtaattttatga
tgcaacgttaaacgtgttcaactcatcaaattttaataacctatttcaca
atattaagccaacctcaaatcatcatatcaaaataacataacatatttta
caatcataaaactcatgtcatatatataccacatgaaccattatagctta
accatatatcatagctaatatataccatatttaaaccaccaacacttaga
gcataatttatacttttaattattataaatattacaatttcttaaaccta
attacttaacaagcttatgtaaggaaaaaaaattatattagcacaaatcg
aatatgttgcctgttgcccgtatttgcctttgtccctcaacgttctggct
ccatcttaaaccatgttcgataattcatttacaaaatagtattagtttca
caaccaattaaaaaataactcaaaaccaagtataattgcatgctttaaaa
ataagtcaaattttaatttttatattcgaagtacttgtgtctcattattt
actcgattgaatcaaaacctgaatttacatttattctctagggacctcat
actttcaatccatagcataattttccaacatctttctttctttacaattt
ggtccttaataatctaaacataacaattaaagtttaaacttaatcaaact
ttattctaacatcacccagttcaatttctaacatatatcagctaagctta
gaacatctaatatccataattaatttttctatctaattttcttaatatta
aacaattatatccacataaaaatttcaacaattcctcaatccaacgagtg
ggttcaactagagttgtccatgggctgggccctaacaaaattttaggccc
gattgataggcctaggtttggcctgacccaaaaaatgggtctaaattttt
acccaagcctaacccagataaaaacgctaaaactcggacctgatccggcc
taaccgtattaatttttttaacttaattttttatataatttttaaaaaaa
tataatacaccaagtacactaaaaatattaaaaaaatgtttcctaaaaaa
tgaaaataaattaaaaagtctttatacttaaataatactaagataagtgc
aacttaacaagcaaatgtctctaaaatagtagcaaaattaacaataaaac
aagtgttatacaatatcaaaacattaacaacaaaatagtagaaacataat
agtgaaatggtagcaaaacaatgacaaaaagtgggaaaatagtaaggttt
ttttattacaaatttgagccggacccaagccaaaaactttacccgaggct
caacccattttctaaatgggcctttttttcccaagcccattttttggccc
tatatttttatccaatccctcccattttcgagtgactcagcccatgaaca
actctaggatgaacttattaatgatcattaattaaaaattcaacaaaatt
taagaaaaaaatagctttcttacctactaaaattgctcacaacaagaggg
tggaaatcgcttagaaattctccattcttccttaagcaaacggtggggaa
gaagatggtaaaaaatgaattctctctcccacttgctcttgtttatacat
atataaatataattaatatataaattaaactaataaaccaaaacctagtg
ttctagattcaatgatgttaacatagtggaaaggaatttattagattatc
cattgccactaacattaacatagcatggtctaattgcatttagacccttg
gtttacttgctacctacaaacttgttcaaattccaattcaattttcacta
gttgtggtctttatgtaattcaatccttgtacttctaggaaatttccact
aacattaacttaacctttgagaatgctttttcatgtctaagaatcagttg
tttgtgcttgtacttctagtaaatttgtagtagaacaattttagttagca
gtagatagtaagctagtgaatgaggtattgtgagtatttgtcaagcttgt
ttgaggagtgcatcattcatcatgtcaacttgatggatactcaacccacc
tttcttcttaagctaacacagttgattccagatacttatgtggagttttt
tgcaagtagtgtcctgattcgaccaagggtcttgccagtgttgagttggg
taccttagtgcaagatagagaatatattagtgttgctgccaatttggatt
gtattaaaactagtttaccactaagtgataatagtttggatttctagttg
gcaagtttttattgtatgcgttccaaggtggtctagaaaaactattggaa
ctatgacactaagaatgaattgcagagaagaaacaaaagttttagcaaca
aagttatctactaaaatttttatatattgcagtctcacctttattaaaca
atgaaacatgagtatttataacaagaaaagctcctaactacaaaaggaac
taagaaagattttatgctaataaataacaaatatattatgctaataaatt
ctaaatattcttaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnagtaatattatgagttgtattcaattgttgttagt
ttaaatgatttactatgttcttactatgctctataagcttatttgttttt
gtgattttttgtagatcgttgttgctgacatttggacgaatcgaactttc
aactcacactatccatcgatgttggtagttcttctgtctcttaaggtagt
gacatgtatatgtggctatatagggattgttttggtacaatatgacaata
tactaaactaaattgttaggtactttatcaagattgtaaataggtatctt
tttggtaaaatttgaatggtatgaaagtgaacacttgtgggttgttttgg
cttatgattgaattaagttgctatgctaggaatggatcaatgttaacatg
ttttagttgttgatgttggatatatttgcagtgtctatgaagggcacatt
ggttggttgtttttaggacattaaaatggtatgctaaggttgggttactt
atggtctcaattatggtatgttttaagatgacatggaactagatgtgtat
gttttaaatatggtaatgcatatgtttagatatgtttgaatggttgcttt
tgaggtgacttatatggcatattggttgaatggatttagtattttgaatt
agccatttcatgcatgttatggtaaggttttgaagctttgaagttgtgta
caaaatgttgttaggtgcatgtttagattggtgatggaaatggcctgatt
ttggccaatttcatgtccacacggcctgagacacgggggtgtgactcagc
cgtgtgtgacacacgaccatgctacacggtcgtgtgtcccctttaggttt
taaggtttacaagtcagacaattacacgacctagcacacagtttggcaca
tgggtgtgtgtggccatttcgagagtttcacggctaggcacacaggcgtg
tggcttggccatgtgacccaacttcaaaagttacacgagcatagacaagg
gctgggacacggccttgtgcccctattttgattgttacacggcctgagac
acgggcgtgtgtctcagcagtgtgagccacatggcctggccacatgaccg
tgtgacccctatagttaaatttttctaactttttcgtaaatgtttcgaaa
gttttctatttagtctcgaattgtttctatcatgtttttagggcctcgaa
gacttgattaagagacgatatgcatgtaaatgaatgacttatgttatttt
tatgagaatgtgtgagatgtatgtttattcggtaatgctccgttaggggt
gttacaatagtggcggtagagtctatttctgagcagtgattttaggccca
acaagttgtgggtgtgcaagagtagttgaggccttacgcggacataagag
aagtgggcatttgtagtggaatagtcataaagatggacattatttctgtt
tcccttttagagcttggagtcagctaattaagcttnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaccgagaaagaac
aatagatctggctctcctcagggtgctgactcacacttttcctctctccc
cctgcgggaacgctggcacttagcctccttaaaatcattaaaccccatcc
ccatattcttaggcctcatctttgcctcaataggtgcaacaattccttgc
tcattcttcccaagaccacctcctttataccccattttctcaagcaactt
catcccaatacccttagtatgcttctcgaaagacccaacatcaccattac
cacctccagcctcccttctgcctcctaagcttttcttctccattttcaac
ctcgccctctctttctctctcctttgtgccccttcctttatcttcctccc
aaaggcagtaggcaaaaaactagtatcaccatcctcatcagcaacaatat
taccatcacttttgggcaagctatcatttccaccaaaccctaaacctacg
ccagaccccaatccaggcctgctatcattcccattatcatccggaacact
attatcgttctctaccttagaattattatcgatttcttgggtaggcatta
cagtacctgtagaaacaaagttgacaggcttcgtcaagtcggctttcttc
ccaaattctttccttctcttcctcgatgaagaagaaccaccgtcttcaga
gtcggtatcagatgcaaaaacaccataaataacatcatcttttgtctgag
tccgtttttctttgcgctttttgtagtagaattcgccgtctatccattgt
gcgtcttcaaaatcgttctccatcccaaacctttccatctcttgatattc
atccattttcttctccgctttttatcaaaatctgaagcaaaaagagcaaa
caatcagaatttacaaacggaaaaaagaaaaagcacaaacggggagatca
ataaaagtttgagtaggaagacgaaatgtaaagtaagattaatagtagca
aaaatacctggaaatctcggccagaggaaaatttacaaagagggtgggaa
tcagatttatacgaatttgaagaacaggggaaattagaaatcagaaagga
gtcggggggaacggagtaaattagggatttagggtttaggttgcacttaa
cgagtccgggtaaggatccggaacctaaaaatggtttgattttatacttg
ggctaaccttctatttctccaaagggtgggcccaattatttgattaaata
tatgaagtagtgcaatttatgtttaaataaccagtttatgtttccggctt
taattgcaattcacacaattttatacctcttttacaacgtatattcatta
taccattgaaaatttgaaatgataggccttacttagtaagaaacgagatc
tacactctgtttaaatgtaaaatcaatatgattttcacgttggatctttg
tgatgtgaatcatgttgaatatgttttttttttctttacttaagagaatg
agtggatgtagtcaaatcatgtttgttaatttttttcttaggtactaaaa
gagtcggagcaagatttcttagcttaattgcaatcaaccattaggttatg
gttaatcaagttcttttgttgttcaatagggctctgtgtgttaatgttag
ttctagcatatattttttatgaggtagcaaatgtcaatatatatatatat
atatatattttatatttatgtttgctatcatgttagccaaaatgggtggg
attgtttaaattatatctagttggtttctcagttcattacttaacatttt
aagttacattattggtgttagggctcaacatgaagttgtgattatctcca
tactcattagaggcactaaaacctaaaaattattcgtcttcttgcttgat
ctctttgtcaaaattgatgtgggtaacactggtaacatgagaaaattaat
cttctttcaccagtaaaactgcatgtaattcaccaaggtctataaagtgt
gaataatagaataattgatagtagaattagtgttttcattgttctaaata
ttagactgaatcaatgacattggctcaaaggctgtgaaagatctagttgg
aatgtgataagtagtgcaatctttgtataaattgaaatgaaacaaatgga
gtttgatgagaggatgggaatggtagtagctctttaggattgagaagtca
tattcatgaccatgagtttcttcttaagcttggtgttctagtagttctta
atatcatatttagtccgtcctagtaactaagcaaccattattggccataa
atcacgtggcatcaaactattaagagcctatattttatccatatttgcga
attatttaagtatagttaggaaaaaaatcatatttacgtaatgatttatt
cggttttctaactttataaaagaaagtcattgagtcgtcatttatttaat
ttttcatctcttttaactcttaaactgcatttttttgtcaaaataccttg
aaatggttggaaaagtaaacattttttaactttgttaacatggtattcca
tgtgtatacgtaagcaattaattaatttcttaaaatatctaaaaattata
gaatattaaataaactttacactttttaaaatttttgataatttttaagt
ttttagatttttttataggtaaacaactaattaatttttcaaaattttta
aaaattatagaatattattataatttttagtattaaataaattttacact
ttttaaaattttgataatttttaagtttttagatttttttaaaattaatt
aattattgatgtgacatacatgtggatatcatgtgtgtaagattaataaa
tattacatttcctattcattttggagtgatttgataaaaacacaaattca
attattaaaagaaataaaaatttaaataaaaaactaaactaatttttttt
tacaaaattaaaggactaaataaatcattaagcctttttaaaaccacaga
aaaaatcatgatgtacgactataaattttgtgtgctactgtaaaagggga
taaaatgttgtttgtggtgtagtggtaagataaaattaatactacttgct
tttttcttgttttctcctttcaaagcatgtcttttcctttcttctataaa
ctttcaaatagtcctattctaggttaaattagccaaatataccaataaag
tttgttaattagtcatataggctgattttttttttaaatttagggaaata
ggtcatttttagagagagtgtgtaaaattgtgtctaattgggcacgcttt
ttgcacgggtggtaggaaagcggacccaactggatgtactttcacacact
ctctccctagccattgatttttttagggttttttacagttagagttggtt
tttagggtttgtgtatttagtatttttattgtttagggtttaagggtgac
accgtaaaagtttataggtagatttaaagggtcgaggatgcaataatgca
tctcagaacacataaattttatatgtcatgtcaggataggaccattacct
ctgtaactcatcttatggaagtcaagttatggggtgacagtgcttgatac
gatcacagttcgaagtctaagtaaaggtcccagttggcggtcgttataca
atcatgggtttgagtataactgggggccagttgacgatcgttatgcggtc
acgagtttaaactttttcgatactcggaaataatgccttaaatatactat
acataagactgaggccataatcataggaaaaatgaaaggctttccgatgt
aatcaacgtaatttttttctctatttctaagcagtcggtatctttaaact
ttcattcttatccaaaggctgacaccgaggtggacacaaggggaatctta
ggaggagagtggatgtttcggcagagtagaggtcaaactcgggtcgacat
agcaatgtttgtagttattagagaattgtttaataacgacaaccattttt
gccccgaaaagagcaccgcctaggagtcctcttgcgtccatgatggtgtt
ggccttcaaataagaatgaaggctaaagatatcggttgtgtggaaatgga
gaaaaatattacaccgattatagcagaaagccccataatttttccttgtg
attatgccctcaaacttttgtatagtatttataaggcaacatctctgagc
atccaaaaagtttgagctcgtgaccgcacaatcaccttcaattagctccc
cacttatactcgaatccatgacctcataacgaccatcgatcgagaccttt
acatagactcccatccgtgatcatataatgcaccatcaccttgaaacttg
acttttataggataggtttttgaggtaatgtcccatctcggtattatata
tggaatgtgtgtttcttggagcgatatcacatcaccgatgactcaagaat
accttaaacatgaataaatattattgacgaaaaatatgaacattgaagcg
agaagaaaactgagagagagaaatatcgtaaagtggaaggatgatggtta
agagagatgatgggtttagggatgatggagtatagagggacaaccccctc
ttttataggcactaaagaggggtgagattgaaaaggaaaaaataatttat
ggttgaaaatacgtcgtagaagagacattttcattgaacttctaaaagag
gtgccttaaatcttaccagggattcctaagctcagggtatattggtaggc
tttgatgggtggtggacaaaaaatgcatccaactgggtgagctttcttgc
tgacatgtcagggaaagcgtgcttatttggccacactttctcacattttc
cctaacatgttagcaataaagctcaccgacgattattaatgggttctnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnatt
ccaaaaggaagaaggaaaagttggagattgagcttcaccatcagaaacca
acatttggcttattatggagcaattgttagtggtgcttgggccagaatga
ggaagagaactcatcttgggaaattgaccttggagtcccttgcaaatagt
tttagggatttgcagaaaaattatactgatgattacaaaattgtgtaact
tgtcctgcattgcatgtttcattagctttgcctctgtttataagaatgtt
tcagggttgggatcctcttgtgaatccatcttacaggatggaggtgatat
cagcatggaaggatttatgcaaatagatggtagttatgacatttgggagg
atgcagcaacaccttattgtcagttgatctcggaagttgtttttaccagc
tgtgaggatatctggcataaacacatgggagcctaggaaccctgaaccaa
tgcttggttttttggaatcatgggaaaagttacttccgtcacctattctt
cagatcatattggatactgtggtaatgccgaaattgtcaagagcagttga
ctcatggaatccccgtaaggaaactgttccaatccatgtctgggttcatc
catggttgccaatgttggggccgaagttggagggcttgtatcaaaccata
cgtatgaagttgagtaatgttcttgatgcttggcacccaagtgatccatc
tgcttatgctatactatcaccttggaagactgtttttgattcagtgagtt
gggaacaacttatgcgccaatatatagtccccaagttgcagattgctctg
caggagttccaaataaaccctgcagatcagaagcttgatcagttttattg
ggttatgtcttgggcctctgcaattcccattcatctcatggttgatttga
tggagaaatttttctttgtaaagtggctgcaggttttgtatcattggttg
tgttcaaaacccgactttgaggagataaaaaattggtacatgggttggaa
gggacttctgccacaggagcttttggctaatgaaagcatccgcaatcaac
ttaactgtggtcttgagatgatggttcaggctgctgaccatgtaccagta
gtgcagcctggtttgagggagaatgttacgtatcttaaggtgcgtgagca
gaggcagtttgaggctcagcagagagcagccgcacatgcacaacagccag
ctgcagcccagatggatggtgttcctgagatgagtttgaaggaggtagtt
gaggcctatgcacagcagcatgagttactattcaagcccaagcctggcag
gatgcataatggtcaacagatatatggcttcggtaacataagtgtaatag
ttgattcacttaaccagaaaatttttgcccaaaaggataatggctggtcc
ctggtctcacttgatgatttgttgaaaatgcactataattctcttgcgag
gagacgttgagttttaggtagttcactaggaaagatgctgcagagagaag
tgtttttgagttttaagctgtcctttgaaaggaggttggtggtttttctg
gttatagaggtcaaatgtattatgcatgaaatgttttgagtacacaagag
tttagttcccttttgttttttcagttataggaattgagaatttctggaaa
agctcaattcagagcgttacatgggtgtcttctgatcttgtaaatatgtt
attcagcagtactgtcagtgaatagggtttctctattttgaaggaggctt
gccaggttctctccttttattacgtatcaatgacctcaactctaccctgt
atgttggcttttctgggaattaaccactggggatccaatgatccgtctgg
catgtccagattcgtaggaaccaggtttgaccactagcaatgtaggcatt
accattcatctggtaaataataatgttttgcccgattgtaatctgacatt
attctcaatcaactttgatgtgttgggatggtttgacatgatgatggcaa
tgaaaaagcttcttgattgttgaatgtcaaagatccatataaacatattt
tttttatttttattagcaattaatgcataaggattggcgttgtgttcttt
gacatgttcatcttgaagctaatattgtgcaggttgaattggcttgcttt
gaatggtcatcgtagaattaatctgatcaatttctaaccacaaaccagac
atgttagcacaaaacttgataaccggtaaatagaatgtcaatagtttaat
acttgctgcaacaaaagcaagataagggaaaatgaagcagaccaattata
cgaataagatagagttacatcctggatttgagtttgtctccccttataac
cgggttttctttagctaaactttgacgaccggccttcttgaaatcgtagt
tgcaggaatgttccaaggggtagcggtcgaactgacagaaaactctgcca
caccgacatgtaaaccccatcaagccaagcttcctgttgcagctttcaca
cctgttgttgatttttgagggactagaaattaaggttgcagaaacaaccg
aatctgaagggcctggtgcagcagctgaactagtaggatcattcattttg
gccgatttggagagctctaatttgtagcacttggaacattctgatctaat
ctttgctttcttgatcttatcttggttactgctagaaaattctgagagga
ctttgaacttttttcagcttattttcgtttgcttgaatggagttgctatc
tttgaaatgttaaaaagagtgtcgaaagagagagagagagagagtctaga
aggcttcgagtctagaaacccccgtgaagctatcggtggattattgtaga
acagaattactatgaagttttggtagtcgaaattttttggccgaactttt
tcctgtttgttgactattaagcttttaaagtactttgtttatcatcaaaa
ctacagaaaaaaatgatccaaaaccaggtatttgtgtccagatatataat
acataaaaaatttggtccaacttagagattcttaatcagtttgttggaca
cttgggctcttgtcacagcaagtttaggatttttggtcccttacctgagg
ttctacagtgactcttgacaaggaaaagtaatttgaagttacaaattttc
cctctgtatatatatacagtcattttttatcatgtgtatgttgaagcgtt
acaaaatcaatgtttgactagcatggcttccattttcttcttcctcgctg
cgtgttttagtttctccagcgccacgagtccgacttgcctaactctctcc
ctggataaacctatgctgaagaattaacaaaagaagaaaaggtcaaatgg
tgtttgaaattgaacgaaatttgcatgagaaatgaaaccagaaagagact
gttgaaaaccaacgaagtcggcatacatgtaaaagaaaatctgtatatat
aaacaaatatgtccttttttttcttcttctttgtattattattttcaaca
tcaatcactgtgacatgaggaataaatatctatgatattttctttgttaa
tgacatagacatcaaggtgatcttaagtataaaacaactaaagctttgca
ctcaatatcatgtattatcttttactgttgatggtaaattaaaaaaaaaa
acctatgcatatgctcaccgtttactgatgtcctcccatgtaagactttc
cttatccaaaccatgataaagccgtataatctccctttctcgttctccga
gcgttatattgatcagtctgttcacttcatcctgtaaatgtaatgcaaca
tcgaaatccacatgcacaacaaagaaacagttaaagtaaaagcttagcag
tagcagattttacatattattatatcataaaatcagtctccgatttccct
ctttatctaaaatagcaagcactatgagcctctcttctgactgtatctaa
aatatttaccttgagtgcccactcatctactccatgccatggattgtttt
ctacatggttatctgcaatgtactgaaaagatgaaaggaaaattgttagt
agtcgataacaggaaagaggaacaagggggattgaaattctatagagttg
gttcatataaaacatgaacttacactatggtgagtctctccgggaagacc
attcaaagacgggaatgcatccctgtcaagggagaagaccttactgactg
cctgcatttagtgaaaataaagcatgagcatggaaagtgcaattgcaata
tatagttcctagaaagtaagttccgaaaaaatcatacctctgtggcattc
ctaactttcttctgagacatgtttagactctcagcaatcctctgaaagta
taaaagaatcaaatacttaaatgatggttcgttgagagaataagatactt
ggctacttgcataaagtaaagactggacatggaaattagacatttttatt
tattttgaaataaaatgatgcagttcaaatcaagctaaaagtaatggaag
ccacttacatcaatagtcggtgttattcctttctcctccagcctatattt
tgcatttcggattaatcccaatctttcatgcaaatatgtaggcaatctta
atgttcttgagttctcaaccagtgctctagaaacaccctgagatgaagta
tgaactatgttagattttgtacgatcataataagataattacaaagctac
agaagcattaggttgtacaatcataatcgcacatcacaattgacaatctc
aggcaccatgctcttgcatcaacgataatattaatttagaaacttttatt
tggttcagagcgagtaataacgtgcacaatgtttctcaacaaaattagat
gactattacctgacgtatccaccagtacacataagttgaaattttatatc
cctttgaagaatcaaatttttcgataccacgcaatagtccgatcaaacca
ccctacacataaaacaaccaagttcataaaagtccatagtttgatatagc
tagtgtcagcagattgatttatcatgcgtctatggcaattgatgtagtag
attacctgaataagatcagacatttcagcacccatgttatcatatctttg
agctatcgacataaccaagcgaacgttgctcattgccaatttttctcttg
ccaaagaacattcgattgaccttgaccgtaactcagcacgagaaactttc
aaggaagttgcaagctgttcatcagatggctcacatcccagtctctcctt
caatctagatttccaggaaaacagtaagaaaaaagtttcaagaatttaat
ggttttgaattagaatgattcatctaatacaacatcataaatcattacct
taatctgtgctcctccaaggaaagtccagctttgattttccttgacaagc
gcacaacttccgcatggctaagcaaatcttcactcactacacccttcaca
taacccttcaagcgattttgaagcagctctggcccgatcaatgatcttag
ctgcttagcgttaggttgtatcattgatttattttggctcagaatcttcc
tcttagtactgaatcttcgttgccgagcagacaccccagaacatgtaaca
ggtaccttgttgtgagtttttcgacttggtgattcagtgaacatcgtcct
ctcaaaagaaagtgtccattgcttttccagcatagacttctgaagcaaaa
gaagagcctctacagagtagtcaagatcatagctttcttgttctaagtca
ttggttccatggatccaaggctctactgttgaaatactggatgcagtatc
cacatgctctttaaaagctttaattgactgcgtgtgccgattggatgatg
gaagattttggctacaattagatgatctttttgcaaccattaaagtcttt
gtggaaggagtttgataatatgaagatccataatcaccagcatacgacag
cttatctacggtttccgaataagaaaaggaagagctcaagagtctctttc
cggtgctaagtccaatcacagcagcagtggccatcatacagattcttctc
actttgatacaattaccatcacacaatttagcacgcttgtcaaaattaaa
acaattcaaccgttatatcccgtaggcgactaagctaaacaaaaatattc
tcctcttgtactctaaatctcctgtatgacactgctacaaagagggtaaa
agaagctaggattatttatttcatatacataaactatatggcaatgagaa
actaaactaaaatagatagataaataaatgaaacaagtaaaggaatgaaa
aaggttggtttttcccaatcagtaacacaaggttttatctaattcaagta
aatcccggaaagatgtagctcatgatggtttgaccaaaatctttttaaaa
aaaacccctaattgtatgagaatcctacaaccatgtgaacacaacaacaa
atggtttgatatttgaagtattttaacgcattaaatgactgatacttcaa
gatctgaaactagttataaataacaaagaatctggaaatttggaacacaa
aaactaattcattcttctatgctcaatcttcctctaaaacttatattttt
aagcttgtaaaccacctaatcttaagaaatatcttctaacttggatgtct
ccacaacaaagaaaattaatttttaagcagaacccaagttttattgttat
tattaaattgaattatgatcacaaagttcagtcatttatgcaaacacata
gcaaacttatagctgtaaatggaacaaatttctatctctttcacctaaat
tatgtacttttcacttgtttatgaacaaaaacaacaacccatatccacgt
aagagaaggggagaaaacgaacatgaacatcttatcaaaacaaacttgat
agaaagatcaaggtctgtaaaaggcaatgaccaaaagcttaccttaaaaa
attgccagctacaacaagaaggaaatgaaagaaacaagaagaagaaagaa
agacgtgtgttccaaagtgtaaagtagaacagttagcaaaggaagaggaa
agagtttggaaccggtattccggagtttgttttagaaactagaagctttt
ttagatttaataatttgtaaaaatatatatatagtgattatgttgggatt
taattttatgataaaattgaagaagaaagggtgcaaaatggacataaagg
atatagagaagatagattccattggctacactagatattgggtccatgtt
tgagtggtgcatagctttccatttcgcttctctgtttttattttttgggg
atttttttctcggtttaatctgtttcatatatttgaggatgggttgggtt
tgggcaccactaacaaattaactaataacaaatgtgagcaaatatcgatg
aatgatgggcccacttccacgtcatcccccaacaaacagtgtgcctcact
cccgttacttcgtttttcttttcttttatatttttatctaaactaatatt
tagtattgcgggcaaattacatataaaagttttttttaaaaaatatttat
cgatataggcctggtaaataatcatttatcgaaatagcccaattcctcga
aagcgcattcatgtcagtgcgatgttaggagacgnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgaaggtttttttttc
tcaggattttttttttaggggtttatgagtttttttttcaagttcataga
acagatatcgtggtttggtagaagtctcaagttgagtttcagtattgtaa
taaatcagagtcacttcttttctctattcgacttctcttacaaaataata
cttgatcttgaaatgcttcatctttccatgaaagattgggttcttcgcaa
ttgctatggcgaactagttgtcggacaaaatttgggttgcttcaacctac
ataagatttaagtcaaacaaaagttttctcaaccaaattgcttggttgag
tgttgctattgtcgctacatactctgcttcaactgtggatcacgcaatta
tcgattgcttcttcaaactccaagaaagtatgttattgtcattgtaccct
acaagcttcaatgagtctagcccaatcattttcagtataccctacaagct
tcaatgggtctgccattggaattttttccattgtgaaccaaacattaaaa
tcggttgttcctttgacgtattttagcaccttctttgcagctttgaaaaa
agaagtatcgcagcaatgcataaattttgacaacaagccaactacgaaca
taatatcaagttatgccgttgttaagtacaacaaacaaccaacaagactt
tgatagttcttctcatcaaccttttgaaattttccactgctgttcagttt
ttctctaagtgcaacaggtgtgttttacacttttccatgcaaaacctctt
taaaatcttcaatgcgaagctctgttaacttatgaaaattcctacctgaa
cttgttgcactttcattccaaggaaatagctcatttccccaaggtctaac
atttcgaatatcttctccatttgcaacttaaactcctttactaagtcatt
gttggtcccaatcacaagccatttgtctacatataatgagacaatcaacg
aagtgacttcactagtcttctttacatatagagtctgcttgctagggctc
ttttcaaatccaaaactcgcgacgtgctcatctatcctcccatactaagc
tcgttgagcctgtttcaagccttatagggctttcttaatcatatatacct
tctcttcttttttgctaacaacaaacccaagaagttgatttagggaaggt
tgatttgacaactatctgatgaattttccaacccatttgtgctgccaagg
ccaataatagtctgatcatgtccagccttgctactggtgcaaaagtctcc
tagtaattaattccatattgttgattgcagccttttacaacaaacctcgc
cttcagcttgttaagtgaaccatcaacattgagtttggttttgaataccc
acttgacaccaattacctttttgtacgatgatttatcaacaagctcccat
gtttggttcttgtgaatcatactcatctcctctcgcatggcttctttcta
gccttttatagtttcggcttcttcaaagctcgcaggttcaagtagtgcta
catcaacttgttgatagatatcatcaatggatcacgtgccccttagtgga
gtgtcattgagtttggatgcaattagctcattgccagactatgaccctag
ctcgccactatcagcatgattttgcaaacccagttcacgtgccccttagt
ggagtgtcattgagtttggatgcaattagctcattgccagactatgaccc
tagctcgccacatcttttgtttagctttagtagcatcctagttccaagtt
ttacctttgttgaatacaacatccctactcgctaaaagtttcttggagga
agaatcataaattctataacccttcctattgctgctatacccgagaaaga
tacctggctgcgacctattttctaacttgctccatttcacttgtggcata
tgagcaaaacaaacacaaccaaaaaaattatgtgagaaataaaaggttta
tttccaaaccatgctttgaatagaatctttccttctacagccttggttgg
tagtctgttcagcacataaactcatgtgttcactgcgttagcctaaaact
cctttggtaacttgctttcaaatagcagacatctcaccatatccattact
attctattcttcctctcgtacactctattctactgtggtacgtaaatgtt
ggtgaactggtgatggatcctagctacatcacaatagttttggaatttat
ctgaggtgtactcaatttcattatcaaacctaacctttttcaacttgcaa
ttggtctggttttcaacctgtactttaaacttccaaaacacttcatctac
aacaaatttttgtttcaaaaaataaacccagcaatacctggtacagtcat
cgatgaacaagaaaaaaatatctacacatattcaataagggtgttttcat
gggtatgcacacatcaaagttaatcaactgcaacctttcatgggctcgcc
aagccttgttcgctggaaatggtaaccttgcttgtttcccaagttggcat
acctcgtagatgctctatgctcctcaaagttgattgtttctttgaccaaa
cctgcctcatacattcgactaagggacttatagttcgcatgtccaagcct
tttgtgccaaagtttcacgacatttacagaactagaataggctttagggt
tcgctagattcctgtctaacataaagcttctatttttcattaagactgtt
ataactttctgttccaataattaaaatataatgcaaccataattattaaa
gacaatattgtaatttttctcaagcagttgaccaatgctgaggagatttt
gatctatcgcaagtactaaaaagacatctaagattactttagtacttgat
ggcaaattgatcaccagtttgcctttacccttaacttctaggagttcgtt
gttaccaatcctcaccttaatattgcagcttctgtcaaccttcttgaaga
tgctttcatgtgaggttatatggttaatgcatccactatcgttcaaccaa
ccttttgtgactctgtttttcgatgtaaaacatgttgctgcgaatacctg
cttctcctgaataagaactaccacaaattcatgagcttgcacatgatgtt
gataggttcttcttttgttctttcatactttctctatgtgacccaactgc
ttgcatgatctacattttatatctggtctaaaccagcaatatttttcaag
gtgagtggttttcttacagtgcaaaaatggtgaatatttcttctttccag
cattttgcttccccctcatgtcttctctatcaaacctttcttacacttgt
attttgggggttcgcactatcaatgctcagagctcgcaatacattttctg
catgctcctttcgtcttgatgtttttcttttctcttaagcaaatagggca
tttatcaattctggaagggagatcgttgataggtcccttcagtcttaaag
tgaggaaattttaaattcataccgctcagaaagctttgtcatgactttct
caacaaccctgttatctgcaaattgttccctaaacaacctgatgttatta
actaccaccatgatcctgtccgcgtaccgtttcactatttcagcctcctt
cattttcaaattcttaaaattttttacgagattaatgagtcgttgtttgg
tcttctacgagccttgaaactctttttttagcttatctcaagctttttta
gggtcttgtaggccataatatgtgagaatataacatttgagacaccattc
tgtatataggatatctccttatatcttttagctcgttcgtcactgtggtg
cttgatttaagtaactttagcattgtccctcaatggtgcgtgctcaacgc
ctgtatttacaacctctcacaagtcataagcttgtaggtaagtcttcatc
tttacaacccaaatatgatagttttcaccattgtaaacaactagtgaatg
tggagaaaagctcgatgaggccttgtaaaacacagaaaggataaaaatgg
cctttaagaaggtagctctgataccaattattgaaattacgatactaaga
aagaaaaaattatagagaagaaataaaagttttagcaacaaagttgtcta
ctaaaatttttatttattgcactctcacgtttattaaacaatgaaacaag
agtatttataacaagaaaagctcctaactatataaggaaataacaaagac
cgtatgctaagaaataacaaatatattatgctaataaaattttaaatatt
ttaaaaaaacataatcataaattgtatgcaagctcttcaaatctagttca
tatttttagttcgccaaagtaatgagcttgccaatttttgtgagtccgcc
aatattatagagttcaccaatattggatgattcgccaatatgggagagtt
cgccaagttcagtcctccatatgtattcgtcttgtgttgtgagttcgcca
ctctaaaagagttcgccaagtgtgcacactgcatgaatggtcatcacgta
ataaaaatgttttttactaataaaatgatcaagctgacacccgagatatt
ttccaatccaattaatgcaacgaacttaaaggatattgataatccacttc
ttgtgattaggtttcctagattttttgaaaaggatatatgatatggcata
gttgattgttgacctcgagaatttacactacgtatttagaatgtctttca
atgctctagctaaccagataatggcattgaagaagaagtacgagtcatca
gcaaacataagacgatttaatggtaaacagtctttgttcagaaggagtaa
aacttttgaaaagtgatcagcctaaataaccatcaaggatagaaaatttt
tgatataatagaaaaaaggtatatgggtaacgggtcaccccggtgtagtc
ttttatgctgggaaaaagctatttttggatcattttttagaagtacttga
taagatattgtactcacattgaagtattagttgccaccgatgagcattga
accccatgtgtgccagaatgtttggcaaaaagtctaactaactcgatcat
aagcttcacacatgtctattttgaatgcaactaagatgcccttgccttgt
tgtctgctccaaatggtatgaattaattcactaataagaagaatgttatc
catgatattctaatcctagataaaagcattttagtgcaaagaaataacct
caatcatgattggtttgaaacagttaacaatacttttgagtatatcttgt
atatggcattacaaagactgataattcgatatacattgaggcttcattgt
tattgaccttttggaatgagagctattaatttttttgttgaatgatttga
gaagaaatcctaaattaaggaatctgaggcatgcttgaattgtaaggcga
cccacaatatttagcattgttggtaggaaaagccaagctttccatctatt
ccaagtgctttggatgggtgaacgtggaatgcaataatcatgttttcatc
ttttataaaaagggcttcaagctgcgcttggagtgcagttgaaaggaatg
gagttcattagataaagaaagacaaggatggtaagagatactaaaaacat
acctaactgtcatgccatgtattgctttatggtcatctatccattgttct
tgctcattaaagagccccaggatacggttagtagatcaacgcttggcagc
tactgcatagaagaaatttgtatttcgatctccgtttagtatccaattag
tcatttctttctacgcctaatgaatatgttcttgctcctcgaggttaagg
agttttgctcgaagttgtgtttctctttgacattgaagcaaagtgttggg
ttatcttggtattgtcataatttttttaagttgttctcgttgtgtactat
ggtttccaaagatcattttgtttcaaaagtagggatgtgactgagtgatc
tttaatttttgcattaagccggatgttagggacccggttatgtgagaatt
gcaagcttattgaataatgtggctacattgcttgtgggtatctcgcatta
tttcaaatttgtataggcattggccaattggtgttttaaagtcaaaaaaa
aaaaatcacggggccatgatttgaaagcatggtaggtagatttaagaaag
caaagttcttaaactattctagaccttcatgattaacaagtttgtggtca
atttattctcaaatcgttttattgccatcataattattgatccatatgaa
gtgtggacattttcagggatctccattaattttcattcacctaagtgagt
tttaagtatagtcgtttcaagagtatccatttttgaaaaatgattttggc
tatgaagtacaagtctggattaaaatttctcaataataaccatgcatcca
gttgaggaataacgaaagcacatcgaaaaattgacttccaaacatttgca
tgttgtggtaacgacggatgcccatagattaatggcaacaaaagcctatg
aattgagtttacaacataaacaaagatcctagagttctcccaatatgtca
tttaagattttttttcttttcatatatagttatagatatgattttttaaa
aaaaaattgggttggtaggtcttgaagcccgtgagactgataggtaggtt
ttgtaaggcttttaagtaggcaacaacaacaccaaagaggctcataccat
attcaaacaaaattatattatggtacatccacaatctaggtgtaaaaaat
atataacaaatatatttataaaaaatgaatttttttcatatatagttata
gaaaagtttttttttttgtaattttttcaatcgatttgattaatgttcaa
caggcaatactagggcaaattacatataaaagcccattttattaaaaatt
tatcgaaataggtccggtaaataattatttactgaaatgaccctatttcc
acatcagcgcgtccacgtcagcgcgatgtcaggggacgtagtaggaaaac
gagtccctgaggaagcgttttgcctgcgagctcggggttgactccctcat
gtattagtggggtatgcaattaccaagttttaacctttgcccaatgttgg
taaaggagcttgcctcaagggtcattgaggaggaggttgatgttgagcgg
cggttcggtttgagataggagcctcggaagcaggccttc
back to top