AC202823

Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Sequences
The following sequences are available for this feature:

region sequence

>AC202823.1 ID=AC202823.1|Name=AC202823|organism=Gossypium hirsutum|type=region|length=59772bp
tataattcttatgtatcagcttgattcgtagagtatgtaagcacatagag
gcataccacccaccaaaaggaaaaaaaatcacttttcataactccaggga
tcgaatgcgaaacctcaactcttcggagatcctttcccatttccttccac
aacgtaagggatactctctttttcttttttaaacgagttgttggacacct
acccatctctttctttatacacatacgtctggattcatttatttttacat
atttatatttttaaaattaaatattatagattcaaatattttaattatca
tttataatagattcaattttagggttcgtttgtctacatgtaaaaggttt
tatggaaaatattttctgtatttttctgtgtttgtttcacagaaaacagc
ttggtcaacagaaaatgacttacaggtcaacgaaaaataagcctttttcc
ttataaaatgacttacccttttgaaaagcgtaagtcattttccagaaaag
ggctcctcaatagataattttacttttatataaaaattaacttaaatcaa
atttaatattattatattgataataaatttatttttatttttaaaaatat
ttaaaatattaatataagatattatatttttaatattattaaacatacgt
atttaattatttatatttagtcatataataaattattaatataattaata
taatttattatttttaataaattatttaatatttaaattttattttaata
gtaaattttaaaaataatatttttaaataatatttttcacatattattga
aaatatcaatattaatattttaatactaattatttattacaattataaat
atattaataataaatgttttgtagtataaatgttaaaaatatgtcataag
tctatatattcttcacaaatttgcaatttagtttctgtacttttattttt
aagaatttagtccctctactttccagatttgaaaatcaagtccaattgca
gacattgttgatttttttttgtcaattttgttaatgtcacatttttaaat
aaaaaaatattcaattagtagtcatgtaactaaaaaataatcgttgtaat
gaacctaaatttaacaaaatatttttaatatatgtaaaaacaatgtaaaa
tataaaattatagatatcaattaaactcaattaaacaatgaaaaaataaa
aaaaatctcaaatgtatgtttgtttaattgaaaacgacttttatgaaata
tttttaaagaacctgccaaataaaagaaaatattttacacagattcatcc
aaacatcagaaaatattagcttttctagaaaagtaagtcattttccagaa
atcattttccggaagctattttcagtgaaacaaacggagccttagtattt
actttattttttaatcaaaaatatatttactaaatattggtattcaacaa
ataattcaattaattatatagataataaattttaaaaagattagagtttt
atagaaattttgaatgtctaatcccataacataaatctaacatttatcgt
aaatattttatgatttttagttctttaatattttctgtcaactgattaca
gtagagtgtatatatatatatatagatatatataaccatcgtaaatttaa
gaccccgttctcctttgcgttttagaaggacttttgcaataaaaaggtca
ttttctctttaaaaggaatgaagaacggcctccatttcagaaaaatttca
ccatctaaaaaagtccttctctgcaaatgaagaagttaaaaaatttaact
tttcttcagccaaaagtgcttttggctgataattgacctttttaacctgt
cttctcccccaaaaaacgttcttttctctgttggttctttggagctctat
acccattttttttcacattttcgctttcaaagctctttcctgttctttgt
tccttttctgcaggtgagtttgttttcttcatcttcttcttcttctcttt
aattattcattatgctttgtttttagttgctttttatttcctcttccgca
agtaagtaactcttccaacagaaaaaaagaagaagggagaattctggctt
ttgtcctattttgctttactgctttgctctgctttgtgcctctcctgctt
tgctctgctttgctttagtgattgctagatccccaggagtgtttagagtt
aaacctgcaagaccaaactatttttgttgatgaaaatagaagaaatataa
actaaatatttgaatattatgggtacccagttcctcctacattcttcaaa
gtgagtgccatttgatattttagatactttgcatgattttttttagcaca
attagacaagaccctttttttttttgttttaaatgttgctgtaatacgtt
tccatggaataatatgttgaaaatccatcatcaccaataataaagcaaaa
aattattaggattcttccatggaagcttatctttcaaaccaaatggtcta
accctcaccaaccaaattacaatagaagtttggttccaattcttgtagcc
tatttttggtaacttatattgagcaaacaacttcaagcttgcatagtata
atacataataaaagtaacatccaaccgccgtttcctttacaggaagtatg
tattggctgctaattggcattgaaataccnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnaccttgaacgtttctagagat
tcgtctatattgatgggtgtacctcccagacaatatgatttatatttttc
tggtgtatttactaacaacaagatgtgcttatgggttgggtcgggttagg
ctcatgcaaggtatctagaccaatttttcaagcccgtacctaggcttggc
ttgaaaaatgggcttacttttttgctcaagcctaaaccaatttaagaaaa
gtaactcgagcccgacctaacctacacatatttgattttttagattaatt
tttatttaaaactatttttttaaatgtaatgcactaaaaaatgctaaaat
aaaaattttctaacacaataaaaataaatttaaaagcatttatatttaaa
aaacacaaataaatataatacatattttattgtcttaaatataattttta
aaattttatattttgggttgggttatttagttgggcaaggttttactttt
aagttttgggtaatgggtttaattgttattgggctagtgatttaatataa
atataaatatataattattatttaacatatataattaatataatattttt
ttataacataatatattcgggtcaagtcaagtcgtgctaagcccaggcaa
aaaaaatcttacccaaggctcatcccatatagaaaatgagccataaattt
tacccaagcctattttttgagcctcatatttggtctaaaccttctcattt
ttagggtgggtcttcaggcctgagtgggtggcttaacccatgagtaggta
tattaacaatctcgtatttttcacacaagaatcaaattatgcatcgtcat
accatgcatcaacatcttccctaggaatattttttgcactacctctatct
gcagaagcctattacaagtcactgccatcaacaacactattgtatccagg
attacctataattccaacattctatgcacaatcgggttgttcgacaccat
atatttctccgtcaatagtgtcacaaataccactagaataaatgaaatga
gatttataactgttagtggagaaggtagcaagagattggagaaaatttaa
aagactaatgtattgagaaatattaacccggggtctagactaaattgtaa
ggtttaccaatgtgttggggtcaaagtgaaaaactaaaagtataaaagga
gtaaattgaattagtggtgaaaatgtgaggacatggagagcaattttatt
aagatcaaatggataagtatgatggataattttttttagttgtaataata
ttttattttcatcatcattactatttttattatattaaattgaattattt
tattttagtttattaaaatattaaagatattttaaaagaaggataaatag
agttctccaacttcttccttgttcatgttacactattgaagaggaagata
acttttctttcttttacaatttggtccacaatctctattaaaggcctttc
caagctcaaaaccatcaaattttcatataaaccttagctaaatcaagtta
cctacaacctagcaagcttagttttcaagttggtattggagagtacatgt
ttgaagagagagaaaatctaaataatgcgataaactaaagttttaaggta
agatcttcatgatttagtaacagttgcatgtctactttgattatttgagc
atgaaagtgttttggattaagaatattaatatcatatattttatgataat
gatatgaaataaagagaaatataaagaagctacaagaagtttagacaagg
gaaagcaagtagacaaagcttgaaggaagtataatttagccaaatttata
agtactttagaattcttcttacttaattaggtttttgaaattttatgcta
ataaaagtgttatttcattaacttcagtatttgtgtaacttaatagacat
gtgaatatttcaggaagtagtaaattgaatgcggttattgtctatgtaaa
ttatttgtgtgagaaaaggannnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnttaattctatgaatcagcttgattcgttgg
cttggatagctaagcaaaaggcgttggagaatatgcatagggagtgggat
gcctcatataatgaaatatgacagtggtgtcaggtgctagagagatacgt
cccaggtgccatcacagaccttgaaacggaacatgcgtactacaacaaca
gattgctatgtggatgccaagttttcaaacacctgttttagacctttaag
caataccgagacgcatttccatactgcaagccgttggtacaaattgacgg
tacctttatgttcggtaggtatactcatcggctattgcttgcagtggcac
aggatggcggtgggagaattcttccaattgcatttgcaataacaccgggg
gagtcgtctaatgactgagatttctttctctctaggttaaggaggcatgt
gtgcccccaacctgatatctgtgttatttctgatcggggcgccggtatac
cagctgcatttgatcgacagggaagcttatggcaacgcacgcaccataga
tattgcctaagacacgttgcttcaaactactacaggcaatatccatctaa
gagcgaacgacgacaagtgaccaacatgggtatttagtctatatctgtgt
tatttcgtttgtcaatttgaattagttttattggtagaagtggtataaat
tattcgctatgatcttatattggcagggtatgaaataaataaagatcgtt
tccacgagatgttggaaattttacgttcaattaacggagaaggggcggac
tacctttgtaacatacgtttcgaacagtgggccccaagcatatgacggcg
gcatacgatatgggccatatgacgtcgaacccggcagaatgcataaattc
tgtttttaaaaggaatgcgccatctaccgataacatcggttgtgcgagag
acatatttttcatttggcggcgctattttccaaagcgagcagcaagttat
gcaagccagatgcaaggaggacatgtatgctgcagtaaggtagttcaaga
aattaacaaggccaaggtgagggcaaacaccatgcacatagtgtgtcacg
atcgaggtaatttatggttttgcgtgacagagtttgacagaccgcaccaa
ggtgttgttggcgggcaatatcgtgtacacttgcgaaataggacttgtga
ctgtgggatgtttgatgcacttcgttatccatgcgcgcatgttattgcag
cttgtcagaatctccgtctggatccgatgagttatgtggacgaagtgtac
aaattagaaaacatgtacaacgtttggagacacgttttcccaccagtccc
agataagcgtaagtggtcgcccgtatctcttgctccttttaagctattac
cggatagagaattacgtcgcaaaccaaaaggtcaaccttgctcgactaga
atacgtaacagtatggatatccgagaaatagccagtcaaacgaagttgtg
ctgatggtgtaggaatccaggccatacaagtcgatcatgccctaatcgca
aagttgaatgtaattgtaaaaaaattaagtttgtgaaattattaattgat
aaattgtattaatgtttagtaaaaattgtcaaattatataaaattattaa
ttgttagtaccagtcaaaatttttttccaaatctaacattatgtgaatgt
aaaattattaattgataaattgtattaataattagtaaaattatcaaatt
atataaaattattaattgttagtaccaggaaaaaatatttttccaaatcc
aacattatgtgaaagtaaaattattaatttcgtttagggtttttaattta
attaggttagggtttttaagttaagggttagggtttttaagttaagggtt
tagtgtttttaagttaagggggttagggtttttaagttaagggttagggt
ttttaagtaccaggttaggatttttaattttagggtttagagtttttaat
taaattaggttagtgtttttaagttaagggttagggttttaatttaatta
ggttagggtttttaagttaattaggttagggtttttaatttaattaggtt
agggtttttaagttaagggttagagtttttaatttaattaggttaggctt
tttaattaaattaggttagagtttttaatttaattaggttcaggttttta
agttaagggttagggtttttaatttaattaggttagggtttttaatttaa
ttaggttcgggtttttaatttaattatgttcgggtttttaagttaagggt
tagggtttttaatttaattaggttagggtttttaagttaaggggttgact
ttaatgcgacaactaactggcagcaaaaagagcaaagtgatgcagatgcc
tctgcttcattattttctgcccatgaaaaagagatcagcagcacaaggga
aaataatgttgccaagattaaagttgtggtatgtcaatgcttcatttctc
tatgctttctcatcctctatgaaataaggacatctttctgtcttcctaag
gttaaaaacctatacatttgtcagttttaaaccggctttgtgcttgatta
tttttttgggggcctgcagttaatgcctttaccttggctttttaaatttc
ctggaaaaccttaatttttgtcttactgggggggaaaaggggaccgaaaa
aaaacctttaaaccaaaagggaatttccccgaagaggaggaggaaaaata
aaaccggtaaggaaaaaaggcttaataccgtccctaaaacccaaacaaaa
aggggttgttcaaaatcccacaaaaattcttttcgccccccctaaaaagg
gttccgaaaaaaaaaaaatttaaaaaaaacttctccccctcnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaatgtgata
tggtttatattatggaatgatatatattaatgacattataaggttgaaat
ggtacagaaacagtaacagtgcccgcgtgaacttagtaaacgattagaat
acaaatgttatgacattagggttcaaatggaaaaggaaatggttcaattg
aaaaaggaaaatgagtgtttgatcagggattaatacaatggcttgagatc
caacatttgtgtggattctctaaagttaatgttatcagcattgacataat
ctttaatgatcacctttaataagcacttacatggtatgtccctacgatca
acaggaagtgaacaaagactctaagtgttgttgttgagaagagcctataa
ctcactttgcacaacatccttctagcaattattactcattttttcatgga
tgtcaacaaaagtaacattagataaatatgttgtcatgcttagataagcc
ttgggtttaaaaaaattagctttactacgtgtaaccatagcgtgaaagta
aagggtaacaggaggttgaggttgtggctgtctggcacctcagtactagg
tgatctaaatgtataatcatcatagagaggattcacaaaactaggtgagc
tagatgtacatacattatttaaagagttgactcgataagctaacaaggaa
gtggttgaaacaacatgtggttgattagtgttagacagatagactagtga
caacactaacaacttagaactggattgtcaagaagacatggatggaacat
attttgatctgttggtttagagcagaaacacgatttcatgaaatgttaca
tgacgagagatatatactattatttcattattttcgacaacgatgccctt
tgtgtaatggtgagtacctaaaaatgtgcatggggttggccgaaactgta
gcttgtttatattgtaggatctaagaatgggaaagcacaaacatctaaaa
attctaataaatgaataatttggttgtacatgaaatagcttttcataagg
tgagatgttgcttaaaggaagagaaggcaacctgtttatcaaatacacta
cattgctgaaagtatcattctagtatgttaagggcatgtaaacatgagca
agcatggaaagactagtttcaactatcttcctgtgtttatgttccaacaa
tccatttttctcaaaagtatatggacatgtaaaatgatgcatgatccctt
gttatggcaaatacaacttcaatgcttgaaattcttctccccatctattt
gtaatgctttaagtttgcagccaagaaccctttcagcttgcttatgaaat
tgagggaagacactgaaaacctctgactttctttacaagaaatataccca
agtatatcttgtacacgcatttgtgaaagcaacataataacgaaaaccat
tggaaaagactggagctggtccccaaacatcagcaaccattagttaaaga
ggtgtagtgtacgcagacaaagacttatgaatgacaacttatgctctttc
cctaagtgaaaagaagcacaattaagggactctatttaaactaaatggtt
tattacaatggtgtagggcctttttaagtgtgacattatagggatgtcct
aatctaaaatgtcatatacttaaaggaacaactgtattaacagtaaaaca
cagagctgagccagaaggaaaagtaatcttgtgggagccatttaagttca
aattgtaaagcctattatgcattgatccttgaagaagtatctccctggtt
ttcagatcacgaacttgacactatgtaggaagaaactcaaacatcaccta
attgtctttggtaaacttggacacatataagagatttttggttatactaa
gtataaataacaaagattgcatgtttaatggtcatgaaagagtaagcaaa
gatgactaaccagtagacataataaggagggcagtaccattaccaacata
tactttacctggatcattgtagggattactttcacctattgaagcagttg
aatgagtgagatgatatgttgcttcagagtcaagataccaagcattgtca
ctaactgtttcaggtgttgcaagatatacttgaggatatagggctgctaa
aataagtgcacttccatgttctggaaaactaacattaaatggattagttc
caggtaggaactgggagcaggtggaaaaaaccaacttgtttgtgaacttg
aaacaacaagaggcatcatgggcatatatgatgataccccatggtgctat
gggaggtccctgtaccaaacgtgcagactttcgcttgtggaggggatctg
tatcctacgctttttgtaggaggtatctatccgaatagtgatattcatca
acannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnntgggctccgcataattaaaccttgattcgttgacttgtacacatttg
taaatatttattcatatatgattaaaataaaggatttgtattatattgta
cattaaccttttaacataccatttttgaaaatatattttggttttaacta
tacatcaaaattattttcttgattcaaaggttttttttttttttttgaat
aaaagcaatcttcgaagtttgagattttcgagggaaactgagccctaacg
tattgggttctgattttctttgttaatcttaaataaccaagaatattctt
tattcaaaatgcatgagcataaaaattattttttgggaactgaacttgtt
gtgtcctaacgcattaggtgtgacatgttactttctcaaaataaagattc
tcacataaaataaaagtgatattcaaagttcggggattatgaggaattgt
accctaacgtattgggactcgatttctttacatgacttgaacaatttatt
atccttttgcaaatatcatttgagttgattttaatatctttttagccctc
gacattaagacattaaataatcaaattggtaccgattttgggcgtcacga
gggtgctaacccttcctcgtgcgtaactgactcccgaacctattttctca
aatttcgtagaccaaaatatgttttaaggtgagctgatcacacctcaaca
aaggatcggtggcgactccaatttttatttttaaagtcgacaactaaatt
tttgtttttcaaaaaacgatttcgacaaataacaatttctaattatcatt
atcaaattataaaaaatatatattttatgcaaaaggttaaaaatctttat
ttatacaaaaaaaataaataatttttatttacacaaaatatataatgttt
aaagaaaacttctttaaataatagaaagataattgttataaacctacagt
agaattcatgtcgtaaaattccaccaaataaagaaagtgggaattatatt
aaaaaaaaagaaactaaaaatcaaattaacaaatctaaaagacgtccaac
gggtgcatgcattatcacttttatgcatattttgttttacattctttcac
acgattaattatgatcatcaatctaataaatttaattaatttatcatgaa
ttattaaattcaattaatcaatttataagtttatgatgttccaaatccat
agtaaaattaccttattaaattgatatgtttaattccactaattgaagat
tattttcatttaataaaaggattagtatttggtacattagcaatgtttta
ttccatatgcagccttaaaaaaagtcatttgtctctcttttttaaaatat
ttattttttaatattttactatactttctatacgacacttgtcatctctt
tgactctgcttgtagagtctaaaaacttcactggcagtgtactcaatatt
attaataattttttttcacgtgaaatttaaatattttaattaaaattatt
tttatttaataaattataattaataggcttgtttatatgaaatagctata
gttttacttaaaattttaggcaatatattattataaagaatgtagtcata
aatatggttgttgatattataagtgaaaagttgttatagagggttaaaat
taaatataaataatcatttctactaaaaacttaattgttatgataaaatg
atgttattgcgagtggttgttataaatttgttataataaaatgatgttat
tgcgagtggttgttataaagagggatcatttcaaacaaaaattttaggtt
aaattatataattggtatcgtattttttcattttgaacaatttttttttt
atgatcttttaactttccttttttttcattttattttgtttctccctcta
ttttcctacattctccatttcttttaatgtattaggaagtcgaactgaca
gtgaagaaagaaacagtaagtcaaactaatagtgaagaaagaagtaggaa
gttgaaagtcatcattacctataaccaaaactcataaactcatatcattt
gctaactatcaaaacccttcaccaccaaccatcatcttcatttcatccac
caacactttcaccactaccatgatctcgttcatgataaaccaaacaatat
catccctcaccaaataaacccacgttcaaatcaaagaatctaggtaaaca
acaattaataagccccaaaaaatcacaaagagccaaaaattagacttgca
acaaagaaaaagtgtaaagaaaagagagagaaatggaaaaaaaaagaagg
gttagattcgggtcaaggggttcgaggtattccgacaatttgtcgatcct
aacagttggaagaatgtattgttgaggaggagcacatattagaaaatcga
gtcaatctaatggccgatgatggagattcgatctggggtaatccaaaagt
tagggattttttgagatgtttttaaaaaattatgttagtggtgaagatgt
tagtggatgaaatgaagataatgggtggtggtgaagggttttgatagtta
gcaactgatatgagtttatgagttttggttataggtaatgatgactttca
acttcctgcttctttcttcactattagtttgacttnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnctaaacgctatgata
gatactgggagatacaatcagtagttgcaaaatgaatgcgatccctgcag
aaaaatgggaattaatgagaaaacctataataataaaaggtatagatggt
aataaaactattattaattataaagcaaaaaatatactaatctacataaa
caatgttagatttgtaattcctaaaattgtatgttttcctagtatgcaaa
cagatatattattaggaaataattttatacttagacatttaccttttact
attgacaaaaatagtatttggttatcaaaagaaaaagattttataaaaat
acctattgaaaataataataaagtcgtgtgtaatgcaaaatttacaccta
ttaaattaaataattattcctaacaattgctgattttttaagcaggtctt
atggatagaggtaaaaaacctctacatcaagcaatagttggtgaatggac
aactgttcacaaaaaacccatcaaagggaaagcagaatcaacatctaaaa
aaggatttgtacctgcacaacaaacaccattttatcctaaccaaggatat
tatgtgtcttatccaatggtaaactaaccacttggattaaatgttttaaa
ttacccaatggtaaatcaaccaatgggaaatactttttcattgaacccaa
acacggtgagtcaattacaatggtcccaaaatccgaattcagtatcacaa
acaagttatgctgaagtcattaagggagcagagaatttgttgaatcaaca
acaaattcaagaattaaaagatctttcaaaaattaaagatttttataatc
ctggtttatcaccagaaatttatgattttataaatgaaatatggaaaacc
catgtttcacaacaaagagccaatttccgtagagctcttaccagattttc
attatttttagttgaaaaaacaactaatgagaatgaagctgaagatttat
tactaaaatctattttatatagagaatgggatgaattccagttaggaaac
atattacgcatatagactctagaaatgaaaataacatttcatctctgagt
aagggtattaatagtcttgttgatatgacttctttttattttggtaaatt
atatagtaaggtcagttctgtagaagaaaaaataaaataatttaggtaat
ataaaagatttagacttaaaccatgagtctaaagaaatattaactaatat
taataataaattagatcaagtttttaataataatatagagtccgatgtag
atttaggtcctttatattatggtaatggtcaagatcatatttatgtttta
tccgatgaagaaaacacttcatctgatgagtcgtcatccatgataacaaa
ttacaaaaaacataaaaaacgtaaaaaagttgataaacaaaaagaatatg
atttccaatcctataaaacacttatagaacattggaaagaaaaatttact
actactaatgatcaacttgaaagagttgaatatttaaaactaatagaaga
actttatgaaaaacataaagatcttttcagtatgtttaattatcattata
tgttaaaatatgatgatacaagtagtggttcgaataattctgaaaacaca
gaattatttaaaaatcaatctggtgaagaaaaaacttcaacagatcagga
aataaaaaatagaaatttatctgatgaagaaaaaacttcaacagatcagg
atgaagacataaaagtctcaacctatatttctgatgaagaaaccacttca
tgtaaatgttttatttgtgatgaagaaaccacttcatctgaagaagaaaa
tattgatatttcagaacccatggatactgaaacaacagatccacctgaaa
aaaggaaaatagagtcagatagtcaaacaaatgattatctaataaatttt
gataaagatcaaaatacaaacagtattttgattaataaattaaaaaattt
aaatattaattctgaaaaaacagaagaaatatataataaagatttattag
gtcttaatgatttattaggaaggtttactttaaaacctaatactcatcat
agacataaaaagaaaaattataatctacaagtcaaaagaaaactagaaaa
taaaaaattttctggtcataacaaaagtcagttttctagaagaaaaactt
ctaatgaacttaaaaatactaaaatagatcatatagtcaaaaacttttct
aacaaaagaaaaagaatttatagtcttgaaaaacaagagtcaaaaatcag
tcataaaaaggaaacaaatccttataaaacagaatttgataaaaatgaaa
atatatttttattagaaaattctagaaacactagaattaaaaatttgaaa
actattattcaagcaatgaaaattgggaaaaatgatattattacattttc
aaattttcaacctagaaaataattaaaacatatattgaggttggttttcc
atttagaagatataacaaaatattcttttacatacctttaaatagannnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaatc
tagagattcgtcttgcaaggacacgcaactgttgaattaacaagaaggat
ttgggagggcgggtggataaatgaatattggttttacgaagcaataccat
gaatatgaaactatagcttttcagagcatttaatggattagaagctaaca
caaggaaaggatccatgaattgttccatgcaaagcatgcatgtattacgt
aaaggttctacacatgaatagtgtttagttaggatgaatattcgcatgaa
atgtacttagcggtgataagtatccgcatgtgaactatctatggttatga
tttgatattgcttgtgatttgtaattggatagagttaatattcgtataaa
aaatgaaactaatggtggcatgtacttagaagcggacagtatctggcaag
gaacaataattgatttgtgatatgaatctgccaacggattgtatgcaatt
ataatgttgcaaccgcgtgtaagctatttggtaatatcaaatgttttaat
tgtttagcttaattttatttccttgaaactttgttcgaaagggtatcgtt
tatcgttggaactcactaagttcatttcaaacttacctagtttcctctac
catttcaggttttgtaaagcactatggaccttgtaaaaggagtcagccaa
attgcggactcgatagtaagtcattcattgtatagtttgtaaaatgtata
tatcgaggtggcctgtagttttagtctcttttgttttgtataaagtgaat
ttgggatattcctcgtacaatattttgtataaactgaatgatggcatttc
tctaaagatttaacttttatgttatatgcgttttggcatactcttatttt
tccctttagaattttccttaaaaactataattcgccaaatggtattttca
gactagtttactaattcgtattgaatggtgtaactaccgaaacctttgtt
tttgactttatgtaatgatttttgttttccggtaacaccatcgtttgtcg
ggtggatgaccgaatttgggatgttacaaggaggaggagcccaatcccga
agccatgaccgcatgtcatgcgtgcgcgtaaaaaataattttataaaaca
attttaaaagtgtggtgttaactgcaagtgggcagtgtcagttgtaatat
ttatagtgtcaatgaaacactagaatattccaaggattgaacccaaagga
ttgtcggtaaacgtttttatcaagttaattacaggttaaacaattactaa
tctaatcgattcaaaacttattagtgcaaattccaaaataaattatttat
aaactaaatttaaattatcaattaaattaactaatctcattttctttcct
attactttagaaaatgtaaatgataaaacaatggtcgattgatttgttaa
tcgctagctaagctaataaacctatatggattatattgtttgtcactctt
agctaagaatctcatctcgatatcatcttagactaaaagataccacctag
gttctcctctcagtctcacctaggcatatagatctcctttcggtctcaca
attcagtacaattatactgaactatctaatgataaactcttctctcggtc
ttgtttatctagattttccattagagacgtcaattctagcatattaagta
tgtcgatataatttgaacaatcaattaatcaagcataaatataaacttaa
gctacaaataactgactaaccaaccaccaaacaatttagcacataatcag
acttaaatttcaaacaagcatttcataaaacacatggtagacataaaata
aaagtaaagagtttgaaaaatgctcatttaatttattggaatatgatgaa
gcctaagagttttatcctctcccttttacatactcttcaaaaaaagaaag
aaataaaacaaaaaaaaatctattctaaaaagaaaagagaaaatctaagc
taaaaaggtgaaaagaaaagaaaccctaacctaaaactatgaaaacctaa
taagagtgctcaaccaccaaaatctaaaatcaaaggcttataaagttgta
tttatagcctactaaaatttaacctaacattgatcattatgctcttaaat
gaaaaaaagacttaaacttgtttaaacataaaattgcctctgcagttttt
tcactcatcaggcttaggtatcgcgatacccgcaacagtcttgaatttgg
aaatcatattctttttgtttatcaacttttttacgttttttatgtttttt
gtaattttttatcatagatgacgactcatcagatgaagtgttttcttcat
cggataaaacataaatatgatcttgaccattaccataatataaaaggacc
taaatctacatcggactctatattattattaaaaacttgatctaatttat
cattaatattagttaatatttctttagactcatggtttaagtctaaatct
tttatattacctaaattatttattttttcttctacagaactgaccttact
atataatttaccaaaataagaagaagtcatatcaacaagactattaatac
ccttactcagagatgaaatgttattttcatttctagagtctatatgcgta
atatgttcacaagttttatctttaaactgacactcgatttgctccatatt
atttgcttcgggtacctaagaccagcctgtaatcctaacgtcttcacaaa
acgccaacacgtccaccccggactcaacgacaacaagaagacagattaac
agatataggttttgaaacaaataatcttgaaacaaacagaaatgtaaatc
aaagataaaaacttactataatattacgatatttctccagaaattcgtta
caccggcacctctgataccaaacgaggggagggaagggaggtgccagatt
tttgagagtatgagcggaagggaatatagactctttattacaaaaggaaa
atgtttacagaagagagaaaactaaaagaaagataatgcggaatttacaa
gatgctatacaattgagctttcctccctatttatagaggaaattttaaaa
attctatacaattgtattataaaatttttatcacacacaaacttatggtt
ttctacaagtggtatttccacagaaaaattttctacagataaaactacca
aatttttatctatagaaaaggcaagtgattatatataaaattatttccta
aaaatatgtcaccatgcatttcaggaaaaacataaaaattttttggaatt
acaaatccaacatttgttttatgtacattcgggcannnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngcattgatgattctt
atgattcttcggattttgtgatttgccattgttgatagcttgagattttt
gttgtttgatgatggaaaataaatatttgatgtttgattatcatgtttaa
ttaagtgatttttgataaaaatccaaattagagatttattagtgaaatta
gaaaatttagggccttaaatgtgaaataaatgaaataaataggctactag
ggaccctaggaaaattcggctaaggcatggttttgatgaattttgtgtat
tttgtgatattataaaatagggactaaattgtgaaaaatgtgaattttag
gggctaaattgcaaattgccgaaattatgtatttgtggtttaaattgaat
gaaatgtgttattaaatagctaaatttgaatttatatagatcaagaacaa
aagaaaatgaaattagaatgggggaagtcgaaagtggtcgagtagtcaat
ttcatccgtttgtcttcgtctgaggtaagttcatagtaaataattgttgt
taaattcatatagaaatgtatttaattgtgcccgaattgaatttatagta
attatatatgtgtatgcctaattgatttaagtatgggagaaagtaactac
gagctttgaatttgatggatttacgatgtccgaaagcccttacgaaccat
aggaataattgggatatatatcatgacatagaattctgatatgagttatc
gtgtaagacctcatctgggatgttggcatcgatttgagatttacttgtaa
gaccctgtttgggacagtggcatcgatatttgattacatgtaagaccacg
tctggaacattggcattgtacgagctttccaagttatccaaatatcctta
ttgactctgaatgatttaacgagcaatattgagacatgaatgattatgca
ataattgtattcagttcaggtacgtttggtttgttaatataattcggaaa
tgaaaagtgagtatgatttaaatgactacattgaattacatgacaaggaa
tgatgcctatgtagtaagtgaatatatatatgtttgaaatggttggtatt
cggtctatttgaattgaatttttaacaatctcataatgatttattttcta
tgacttactaagctttttaagcttactttgtgtgttcattcggtgtttta
tagattttggaagctagttacgagctcggggatcgtcgaggaaatccatc
acactatcgaacactattttggtattttaaaagcttgaattatgaactta
tggtatgtataggctagcatttgttttggttggttttgaaagtgtatata
aatacataagccatgcgaaaatggctttatctttatgcttgagcttggtt
atgtttgattataatttaagcttattgtggtagtatgtttcataacttgc
atgtatgataaatttggttatatgttttgttagcatatcacgaatgcctt
gtaatagctcatcgaatatgcttgttacatagatagatttgcattttggg
ttagtttaaaattcggcttaaaatgaggtaatataaagactttatatttg
tttgtattggttaattttgattcgatttgcaagtaaaagagtatgcatat
atgttatgcttgcattaataaatcattacgtacgaatcaaattagaaata
gtaaatttttttttgacgttaagtttgatgattgtaagtaaggttatttg
ttttggtatgtacatgaaaatgatacatgattgaggttatttatagaaat
gcaaaggctatgaggtttactcaatatcttcgactaatagaattataaag
cataagtaaagagatatgtttagtataattttttggaaatggctcaattg
atgtatagttgttttagaaataggtttagatttagtatgtaatgcacatg
caaaatcggctaaagttaggtaaattgattatatatattatgcgcatatg
tctttgttgttaatgtttgattttatagttaatattagttgaatgagttg
cgtatgaaataagtatagttttctttttatatggttattgctagccaaat
tagaagattgtataattagttgtgaaatgaggtttgtttaggtgtgttat
atatatatttggatatctagtatgtcgtatgatattgattattaagttta
atatacaattatattaaagtgaaatgttgaatatctagtttatgaaatat
atgttttataatatgttcgaggtatgtcgtaaagttatacgcttgaaagt
aaattttaatatacaaatgatatgatcatagtagtattaaaatttgaaat
tttgtatagatgagtgtattatttagagtgatttacggactataaaaaaa
tgaatacttattttgagcagtgttctgttcggtagtgccttgtaacccta
atctgggcgacaaatacgagttagaggtgttacacccacccacatgaaaa
ataatataatattcatcatctgatgacatctacaaaaaacaataacacat
tgtaagcaaaaaacattaaaaaaacaaacaaaacagtaacagaagtctac
aattttaacatcttttctgagaaaaaaacaaaattgctttgaataaacaa
acaatttttctaagcaaaacacattaaaaaaaaaacaaacgtcactacct
acatcgggaccacttctttgaatacaatacaaaacagtaacacatgtcta
caattttaacatctttttgcttaggtaacagaaatcaacataatcaggac
cactgtcgcatcacagattgacaaaacaaacgctacattgtggcattgaa
attgcaataataaatcacaattaaccatctgcaattttgacaatagtttt
aacaacaacatcgggaccactgtcgcagcaaaaattgacaaaacaaaccc
tacattgtgacactgaaattgcaataataaatcacaaataaccaacaaat
caaaccaaaaatagaatttattttcccaacaaaccaaataagaaagcacc
tacctttcatttttgggttacggaaactgctcacgattgttgaagctttt
tcgttcctaatagttttcgggattcaacgatttgatttgtaaaattttta
gggatttcaagaatatttcaaaatgctaatgatttagggattttaagaat
tagggatttgaaaattttagggatttaatgaagatttttgaggttaggga
tttggggaattttatgatttagggattttagaagttgggaaaaaatatcg
aatttgagggtttggggatttagggttttttattttatgattattaaatt
tgtttaatttttttgccatgtcaattttatttattttaatgtcagccatg
tcatcagtcaataggaacgccacgtagaccaaacgaatcaagctgattct
tcggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnaaaacttctttacaaattgcatacaaatattattcatcaaaataaa
taaaaaaactattcatagggccaatttccccaagctttattggaatacaa
attaagccttaaatacttatgcttttacccatgtcaaattcattcaataa
tcaaacaatttccatgctttaacatacccaagaccgatcctatatatata
tatatatatttactatgtattatttacccctcaaaggttcaaaaggtcat
ttacaagaccaattccataaacaaatactcattatgcaatttaccaattt
caaccactctatattcatagtaaatcaatatacaaactttcacatagtaa
atgataattcaaattcaatctcaattaccgaaaattaaaatatttccatc
catgatttcaacatagcttatacttataccatatcatatcaatcaacttt
acttgtctatcacaatcaatattcataattatcaaaattcaaaatcctcc
aaagcataacatcacttatattagtctcaaccatttaagaaacatagcca
aatcatcaaccataatatttaatcaaagcatgaaaccattcatgtcaaaa
ataaacaagccattttcgcatggcttattatatatatacacttcattcaa
aatatattcaaaaaggggtagtatagcctatacatgccatagattttata
tttaacttttgtaaataccgatgacagacgatagtctgattgacgtcgct
gacgatccccgagcccgtaactagcttccaaaatctataaaaccgaagga
aacacacatacaacataagccatcacagcttagtaagtcataatcaatta
tacaattcaataatgttaataattcaataacaaaaccgaataatgcaatc
atattcatatatatacacatttgagcttgcaaaatttaattatctaatat
gtaactatgaatcaatttcaacttggccgaatatacatgtaaataaaaac
gtattattttttttcagtttcaaatcatatacccactctttaccaaatat
attcattcatatatagatgcatataattcacaattacaatatcacatata
cttaccatttggccgaatatagaccttcatatactcatatactttcattt
acctcatataaattttcttatcacaattgaagtaactaacttaccttgat
atcatgtattattcaaacattgcatacttgacctatcatgtactaaataa
ttggtcaagacaataatgaagttgcacaattagtgctctttcccatctaa
ccaaattgttgtcggtatcgcacacttagtgcccgttattcaacatcatc
attttaatttctcacacttaatgcccattattcaacatcatcattttagt
ttcacacatttagtgtcgttcatatagttgtagctattccatactcgcac
actatttagtgctaaatattgataaatctcattcacgtctatttctactt
tccaactaaaacatattcagctatatatatatatatatatatatatatat
atatatatattttcatactttcatttcagcatatataactaatatttatt
tagaaattatagcatctatttgattataaacttacctcagatagcgataa
accggaacagaacgatcaattaacgactttatttttccctcgatccaagt
ccgatttctttaattcttgatctaaacacattcaaatttaactcattcaa
acataatttcattcaatgtcatccaaaaacacataaatgggtaatttacc
atttcacccttgatatttaacatttttacaattcagtccaaattgcacaa
aacacaaaatattccaaattaatcacaatatagtttggccgaatattccc
tagtctcatataggtctttgcatgtcgtttatttcacaatttagtccctc
aatttaatatttcttacaatttaactcaaaataatcaaattcatcaaaaa
ttcaaaaacaaacattataatctattacatatcttttattttctaccatc
aacaaacaaaaatcacaaactatcatcaatggcacatcacaaaatcatca
taaattccaaaaattaaagcatgggttttgaagaacacgaagcaacgatc
tcaaaaacgtaaaaattatcaaaaaaatgatcaaaaactaaccttaattt
aagctcaatcaaggtcgaatataacaaagcttcaactctttctatttctt
tcaatattcggtgatggtggatgaacaatccactaacatttttcatttgt
ttttattataatatacattataattcatttaccaattaaccttgaataat
aatatttaacatatatgctaaggtcattcttgtcaaatgccacccactaa
ccttaataatggtctatttgccacataaatccttcacattaaaagaacaa
ctattatttggcccttttgaatttaacccttaaatttttattttacgcga
ttaaatcctttcatttaatcggacacttaaacgataaaattaaaacacga
aaatttcacaaaagcaaattcacacataatagacatataaaataatatta
aaatattttttactcagatttatggtctcaaaaccactgtgtccgattag
ggtctaaatcgggctgttacatacttcatgattatatttcgtatatcctt
cttgttcattcaagtctacaatggaaaaagtgagtgattaatgaataaaa
acgtatgaagaaaatgttgtacataaaatgatgctatttaaccttgttgc
ccatatttattatatttattatttaagtattttttactgatatactatat
tgaataaaaagtatccatgtttattatatttattatttaagtattttttt
tactgatatactatattgaataaaaaagttaaggttaagaattttaagta
tttactaaacctttcaccaatcnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnntgagtcaaaaaatagtcggagctttctt
tttgaataagcccaattctaatgtttagggtttaagtcctactactttaa
agtatgagtttcgttattttattactatgtagattattattcacgcataa
cttggttatattaatgaaaagctagatccctcatttttcaataagtgttc
ttaaatgtttttaggatgattccatttaatagtattttttcttattaatc
ttatgtcatcttttgtacttaacgatgaaattccttaccatatcttattt
ccttcaaaaccattatttcctattgagcccatatatttggtaacacttgc
ttggtttgtgatcttcatctaactcataaaattggacccaaagtctctta
aatgtgtttttcttggttatttttggattaaaaatggttataagttttac
tttcctaatcttaaacgatatcttgcatccattgatgttacctttcttga
aaacacactatttttcttggtgtcatctgtttataagacttccccaaaag
atgatgatttgttcttatatactataaatcgtcctgttaactccttagaa
acaagtataccagaacaagtaacaactcgaccatcaatcattcatgttta
ttgaagagggcaagatactttagctacatgcccaccacatgtcttttcgt
ggaaaagttttgttcctaattaacctgatcctagtgttgacattctcatt
gcctttaaaaaaggtaaccgaaaatgtacttatctcatctcctttcttat
ctcttataatcatttatcacctatgagtagctcttttattgtttctttgg
tatttcaattcctaaaattgttagaaaggccttgtctcatattaactggc
taaatgcaatgatagaggagatggttgctttagatggtaatggtacttgg
gtattagttctgcaatgatagaggagatgattgctttagatggtaatggt
acttgggtattagttcatttttctactagaaaaatggttattagatgtaa
atggatgtttatagtcaatgttaatcctgctggatcaattacatgactaa
agtccatcttgttcgtaaaggatatgctcaaacctatggggttgattact
taggcactttctctcgatggctaaaatggcttctgtttgcttgtttattt
ctatggctactacatattggtggcctttgcaccaacttgatataaaaatg
catttttgtatagtaatctacaagaggaaggttatatgaagcaatcacca
agttttgttgctcaataggagaatgcgaaggtgtgtcatctttggaaatc
tctatattgcttgaaacaaagtcgacgagcatggtttggatgtttcaata
aagtggttcaagatttgggcttatagaagagaagttgtgatcactcgatt
ttctataaatattaaaatgcaagtataattttactagcaatttatgttaa
tgatattgtttttactggagtgatgatgcaatcatttttattttgaaatc
attccttcatactcaattttaaatgaaagatttaggacaattgaatattt
tcttggagttgatgttattgttttatctgatgccttaagtgtaataattt
cgccaatgtacacttgtaattttttcgaacaaattggttaataaaatata
ttcgttgactacattaatatactttgtataattgtcctcatatggttttt
gcacacaaagaaaaatgtaagcaaatgttgctcattggttgtctaaagtt
taaactgatactaagcaatattacgtgatcagatcgtaatatgaaaagat
agcttgtattagtagacaaacctaaacatatccttagtctaattggaaat
gagcaaagcgattgaaatactaatatatcgtccatcaagtccaattgggg
agatgctttgttttgagcatcgaaatggatgactcctagaagatagagac
acaaatgtgactgactagactgacagtacattagataggacccaagatga
atagatcttgaattcgtttatggacttattcacttgtgatgttcatagtg
tggcatatctaaatcttgaatggatgacggactatgtatgtgtggctcgt
acactttgatgtaagtaaaagcctaagttcgaatagataaggaaccaaaa
gttggtgcattaagtgtacgacttttgcagtatgtagcttcattctaaat
agtggaatttatagcccgagacatgagtaaataatatcatcttattggca
ttacctggttgataaaaagtaaacgcagccatgggttgttcattattgtg
acggatgacttgatcactatttggctaccatgagataaaatatgatcata
ttgagagaacaaatattatcccaaagagattaaggatatcctatgaggga
cacacacttatgacaaggcaatcgaacgaccactaatcgagttactttcg
ttatggtatgtcgatgaggagagctcagtcccgatactatagtggaatga
cttcatgggtaaatgagtttataattaataggcgaaaagctggaacttaa
ttataaattatttgagcctcaattgcattgtttaatcggtccccccgcta
gctcgttgaaacctgaaatgaattgcttgtttgaatcaaaatgaatagaa
ataaagaaacggaaaacattcagaaataattatggttttctctgaaatgg
agaaatattaaatatattttctcagaaactttaccatgggtaaaatcatc
ataattttatcagggataaaattaggttgataaaattatttaatataaat
attgaagtttgtttttgggaaatagaaaaacaaatatcgggttggatcta
attataaagtactttttaaaagtccgaaaagtacttgtaattggacctga
tatggaacaagcccaaaagccccttatgttaatagagtggacaactaacc
ctagttaataaacttatctaattttgagagattgttactttgtcggaaaa
tagagagaatttattcccaactattaaatatatttttccagaataacaat
tctaccggtttctattaaagaagagagaattttcgttttcaccctaaaag
gaaaagaaaacttttttctagttttatgttttgattcaattggtttgagt
ccacacttgaagcaattcgtggtatgagaatagtggagaagatcatttgg
ttgaaagttggaaaatatcaaggatccgctaatccaaaaacacatgtacg
atttcggtctaaggtttatcgctataaatatcacaaccgggtcgattttc
aaaattttaatttttcgttgtgtaaaaaaacaattttcaaaccaaatttt
ttccaacaattatcagaagtaagaagggtatttttttgtcttagaggaaa
catacctttgacttacttgtagaaactaaaaaatcaaaatgtaaaccgtg
taacacactgatagatttcaatttgcaactcatcaaggaagatagtgaac
cttttaaggatccacaacattggatttatccttcataccaatagagctcc
aatgcacattgtctttttttgttccccatttgtaatgctttgtttgagtt
tgagaacttattttccaacttaatttaaacttcttagctaccttttgaag
aacaaatgattgtatgaaaaaaaacaaaagaaagaaaaagaagcagagtg
ttgaggaatgtccagacgacagtgagaagagaaaaaaaaagcttttggat
taattatatagaggttcctagctttagtcaaaaaaaaaaaggagtcatgt
gtcaatcactcaataggctaatgtgtcatgttagcaatttgttaatgaat
taacagaatttttaacaatcataactaattcgaacaaatatattaattag
agtgattaaattaaaaaaatagaagaatgaaaataggatttatcgtattt
taaagtgacctttaccctcctaaacaaagagataggggaataaagaaaaa
aaaaatttagtttaatggcagtgaccatttttgtaatgaaaagtgggtgt
cggcattcatggcgtaaaggcattgaaaattgagaatggcatttgggcat
ttggaattaaaaagagaaaattcgctcatgaccatttcaatgcgaaaaag
gaatgggctttgcatccaaaaaaagatattccagcaatggcattcggcca
ttgataatggaattgttaaacgaattaaggtgttattatttttaaagggt
tccagaaagaaaatgaggaaataagttttctttaatttgaaatgcaatct
acgaattctcaagatgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnntatttatacatcaaataaacttttattttattac
atcaaataatatcaaaataactaaaaaaactttctattttattacatcaa
ataaacttctatttattacatcaaataaatatcaaaatattcaaaatatt
gtacaaataaatttaaatacggcaatcaatgtctatgcccgggggattca
gtgccacatggcagtcgtcgacggttacgcgctggattcctcctttctct
agcttctggcggcggttgttgttcctccggcggggattctggttcttctg
gtacgacatctagttgtcagacttgggacgatgatccaccttcaaagaat
agtgtatgcggaggtgtttgcgtcacgaacggcgacggtgtttgaaactc
atacgttggtggagattggtaaaaaggagagctccccgacagcccctctt
gagatccctcgtgcgccgctggcctatacatcggcggtccactcggtata
acaggaaatggagctgaactgggcatttggctccaacctgccataggact
cggaaaaggataaatataagggttaggatacatataagggctaggaaacg
cacctggcatcatctgaaaagacggttgcgtgggtattatctgttgaact
gctgcgtcgggtgactgtgtcggtgctctcgttggacctggtgattgcat
ggccgctgatgatgagccgggtgaatgtttgggcctcgttgaggggctgc
cttcgttgtcttgtcgtcttggatttaaaggcccgcgccttttcctttcg
acacgtatttgccgctgcctctcctctggcatcaataaatacggcttgcc
atgaatcctaaaccatggcatgtattctggaacgcacgataactccggaa
cgatgattggttcccgagtaggtatatattcataccgatcttcccacatt
tccatgtactaggaccagtatctcgtccaatccgtattcaaatgccgaag
gttgactttgtgttgatcgtcaaacacctcaggatccacgggaatcggtt
gtctacatccaaactgtcgtagcactctgtctgtctggtgcgactccacg
attgcgtagttgatcaacacgactttcacgtgccaagcttgtggattttg
taagaactcttccgggattactgcccgaattgctggaacctcgtatggtg
tccattgaaactatatgaacatgatagaaatattagttatatacataata
ctaaatactaaatatcaatcgactagcgaatgtatgaaaatatctatttt
atttaaaacttacttgtacttctgaccgttggtccaatagaagccgtata
tcttcaagagaggacggtaatcgagcatgacttaccggatgattccacct
aattaaataaatttttagcatacttttatttttaaaaatctatataataa
ttgtaaaatctaatataaaatttacctcgttatgagtgggaatgtatatg
agtggtccactcgaggacgtagaaatggaaagcgaaaccgtgcccacgac
tgcagtagtgacaggcaacctctgatttttgctctcctcggtcgcgtcgc
cccgcacatctcccgatataacgttgccaagacggcagacccccaactca
attcaccgtctgctttaaaatcaacgagttttagcagccatcttagatgt
atgtggctccgtgacatgtcggacatcagataacctccaattaattgaag
aatgtatgccctagcatatcggattctttcaatttcggttgaatcttcat
ccggatcaggaaatgtgtctcgtaaaccagcccatctcgaccttacctcc
cttcattttctccggaaatagcgctcaaaaagctcgtagcacaccgcccc
ccaatcgctagattgggcagacccggtgactgggttcccgtccaccggca
atcccaattgcagactaacatcttctagagtgatagtgcactctccacat
ggaagatggaatgtgtgcgtctcgggtctccacctctcgatcaacgcact
gattagtttcgggtccaccttgcatccccggcctactgtcgccacgtgcc
aaaaacccgcttctcgcaagtagttctctaccaacggtgatggaggagca
tgcatattccggatattgcattccaatacccgatctacagacttttataa
caaataaaaaattaataattatctaaaaatgcataaataaaaaattctta
aataatatttaaaaattaaatttaatacttactattttcatttgtttcat
cgatatgtgatgcttattaagacgagtcaattctccggtcattgctgaaa
tcgtacaaatttttacggtttaaaaaaattttaaaaaaatatttttaaaa
ttatttaaaaaaagggagttaagagaaacttaagaggagcttgagagaaa
attgaaattaaatatggatttaagagaatttttaaaggaaattgagagga
aatttgagagaggattagtttgtgaaaaaaaagggtgggggtatttatag
ttttttttttaccgttaggggggcaacggtcaaattttttaccgttggag
cactgttcacgcgcggggcaagtcgtggccacgttagcaaatcgcgctga
cgtggccgcgatttttcggaaaatagaccattccggtaaataattgaata
atggacccatttcggtaatttttaaaaaaaagtttttttttctataaatt
gccttcattttttccaattatataaaacgttattattttaccagaaaaaa
aaagcataaataaaaccagcagttaagggcatttctgtcatgaagagaat
caaaccgtaacaatggtatataagtcattcaaataaattcaacatagccg
ttcaataaatttgaaaaaaaaaaaaatacttgcgctctatcttttcttca
tcgcagtttttcatgtatcttcacagaaagggaaagaaaaaagaagaaat
aaataataaagaataaaaaacaagaggcaccgtacgttgaaattaaatgg
ggtttcagtttttataatttcgtttctcatgcagatctgactgtagatct
cgaatcgccgaaaaatctctcttcattgttccctctttctttggtaattt
attttattttctgtttgttttaatgtttcgaaaggatttgaatgcgtgaa
ttttgaaattttttcttcttggatagggtaaaaataatttcacggattat
tggaattcgccttttcattttggaagaaattcactttcatgttcttcttc
gaactcggattttctccatattgcaactgacactgccctcttgcatatat
tttgatttcttataactgttttataaaatgattttttacacgcacgcatg
acatgcggtcatggcttcgggattgggctcctcctccttgtaacatccca
aattcggtcatccacccgacaaacgatggtgttaccggaaaacaaaaatc
attacataaagtcaaaaacaaaggtttcggtagttcaccattcaatacga
atttagtacactagtctgaaaataccatttggcgaattatagttttttaa
ggaaaattccactgggaaaaccaacatatgnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnctctaagttgataatcagct
tgaattcgtttattcagtttaaaatggggtagacaatgtcaatatcgaag
aaaaaaaaataggtgtcttgataactctagaatatagagttatctttagc
actttctaacatataaattatgcaaattctaagtagttgataacactttt
gtattttttaatcataattccattatactaagcaatattatgaaaatgtg
ttattttaactaattattttgctaaacacatggtttttcatctttttaaa
aatgtaattggactcagtgggaaaatggagcagaagtcacatgatgcaaa
tctcgtagcaatgcacaattgtgctgcaacataagaccattagattagtc
ttagacatatacaactttagaagtcccaatccaactttcttagatttcaa
agttcatctcaacccaactacagagtggatcaacaatcttggacaacctt
gaagagcctaacccgatcactagaagagaatgaagcctaaactgtccacc
acatgctcaaatcgaccaagggacttgttcttcaactacctcaaccgcat
gctttaaatttaagaacaaccaaattagccttgaagagatcatggggatg
gtaccaacatggaaaaaataaaggggaagttgataccaaaaatagcaagg
gataaggtaaacgagttgtttaattcacatagggataaactattagagag
gaacgatgctctcgaggccatggtgatggctttgaaggaggaaacaatgg
ccacgataatggctttgagcacaagaatacaggagctcgaggtaaagctg
gacttgtatcgagcagccgtgggggaagagtgtcaagtgtaacagtcagt
tacgaggatgtttcaaagtcgaaagagtttgtggggacaaattcttcatg
cgatgtggacaatttcttgtggaggatggaaaactacttccgtgtcaaag
gcatcatggatgatgcggttaaggtaaacactactttaatgtttcttact
aatattgcttttttatggtggtgaggcaggaccatagataaaaggcaatg
tgacattgggacgtggtaagagttctaatgtgagttgaagggacaatttt
acccaaaatttgccgaggaaaaagcccgggcaaatttgcaaaagataacg
caacggggcacagtgggggagtatgtttgagagtttaaagaactcatgct
tcaagttttagatgtgacagagaaagaagcatttcttgtttttcagaatg
gattgaagccgtgggtcagacaggaggtggaaaaaataggtgcccaaaag
ctgtcggaagccatgacggtagcaaaattcgtggttaagcttggtctagg
gaaagacaagcttgggtcttccaagtctgaggaaaggggcgtatgtgaaa
aggatcacaaggaagataatgttggcaatggcatcagcgacaatggtgtc
acgggccgcagttcaaagcccatgaccatgcaccaaatgcatccggtgga
agtctattgtgtagattgggatcatttggcagatgaactagcctgattcg
ttaaactgttggagaagcctgtcagattgaagcctagttggcccgataat
gaagatatggcaatttaggctattttggtaactaatcttaaaagattgat
agaatcatatcttgtaaagattagattagatttgatatagcatatcttat
aaatcccattatttaagggataggatgaatctcgtccgtcgatgtattgt
aatcttgaccatcggtttttggggagctcaactataaatagagagcctcc
cacttatttgtactcactccatttattgtttcattattctttttaataag
agaatattgagaacatttgctcaaacaccttgtgtgcgttctttctattg
ttcttttgttgcttcttctagcataaattgcttccgctatacaaattggt
gccttggaggacttctaaaggaatcctcacttgagtaaaggctgacttag
gtgagtttggatgaacgaattgcctaaggctgcacggatcgcgagacaaa
agatctagccctgtgataactagtataaataggggtaatcatttgagagg
aaaagacacaagtaaagaagccggacacttaccaaaaattgagagcaaaa
agtaaagtaatatcttgagagcatttaggtgagagtgacacctaggagag
gaggaaatccactgtgagaagcaagcaaaaacagttgtggagaaccactg
tatctgtctattatctattcttattgtgccctagttgtggataaccccct
cgacatttcatctttcttttcgcttattcattattttgttattgtgttga
taaacatgattgcaacttattattgtgttttttaatttaatgattatgaa
ttaattctatttttgctagaataattatgaatctttgacatgtggttctt
gattctatattaagaatgttttgtgcaagtgtttattcattcattcaagt
agaattaatgttaacatttataaatgcatggccaaaattggtaagttatc
aagttaactatttaatctgagaagaggtaatacttaatagacaaaagact
taaatggtacatgtcatattgatatcgagagatgattgttgtatgcataa
accgatgtgatgcctgagtgggtgatcttaaagttagtttgacatagata
tatgcaaagtagctaagagacataagtaggacattgagaagagcctatgg
tttaaagagttggtttagtgagtcttcatattaccacaatctattgtaac
attctataacataattatcaatgatcactagttaaaaagaagtaactgtc
ctagcatattcatgtcattattgttaaatcgttagagttttctgctgttg
ttatcttttgtaatgtgtttagtttactttgtttgcatacttagtataac
tagttaaatcattatctcacatcaataagttcttttgtcacataacaagt
tgttaataattaattttgaaaataattcgtatacgcagtccctgtggaga
cgataactcatatacttactacttattacttgtcaccacagtgcacactt
gcacataaatcaaaaatcgctcgacatgtcgcaacactgatcttctgatg
ttgtggaactaagagaagattactctattaactccaatgttacgacagta
gagacagattgcccaaaacataacttaaacaccgaaaactaagtcaaaac
tatctttaaacattcgtaacatttctaaaagcttttataaatcaaactat
gtcaaattatcattcaaaaacttcatttaacacatgagtatattcatcta
agggagattatcccaaggtacaaaatgctattgggcatgcatgacatagt
tttggaaccacttgattactttacaattaaaatttatatggttataactt
atgtacatgccactctatcaccaatatctaagttctatacacttcaatcc
ttgcttgatgatgataataggactaggatgacacttcaaaagatgcctta
aaaatgatctttacctacgcgttcaaacacacattaagaatggtgaaagc
tnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ngcggatgaatcagcttgattcgtttcgatgcttaatcataggtaaatac
tcagtatgatgttgaataagtttacttaagtggatattttcattgttatg
cactttccaatcccagtttgattttgtacattacaacatgcatgcatttc
ttaaatatgtttctctattaacttattatgtacattacagtgttcaatta
gttttgtgatgatttgatgcttaatcacaagtcaatgcactttttgatgt
ggaagtagtttacataagtgaatatgttcttcattgtgcgctttttgatc
ccagattgatttttgcattaattttgcaggcattcagaacattttcagat
gaaagtgtgactactgagtggctacattctgttccacgtttaataacaga
taatgaatctagcattcaagaagaatgtgaaaatttgttcttggaattgg
ttttggaccgggtgtcaagagccggaccggcttgcgcacccaagaaagga
tctgttttgcccgagtcacatctaacaacaaagagtttagaaggggagtt
ggagttattattccctggagggatattgattcttttgaaaggcatctgtg
atggtgaggtgactccatgggtgaagaagctttgcacaagcctcggtaac
aagaaacggttgaagcccaagattgctgctgctcttcaaaatattataaa
gacatctgaatctatctggttgaatcattccatgccaattgagaagtgga
cagctccagctggtgcttggtttcttctatcggaagtctcagtatatctt
tcaaaagctgttgagtgggagttccttcatcaccattggctactactaga
caaacctggttcaaaaggcaagttacaaagcccacttttgcaaggaaatg
caaatgaagatggagagggcgtagaatccaattcagttgcatgggcagga
gatcgtgttttcctcttgcaaaccatctcaaatgtttccatggaattgcc
tgctgaacctgctgcagatttagcccacaatttgcttaaaagagttgaaa
agttcaacatgcattccacagaggtactgattgcatcaacaaactctcaa
atgcagcaatgctttgtttattttccttcctgttgtgaaataaacttgtt
catatgcagttagcgtcttagagataatacatcatatgcataatcagcac
tgttttatgacaggttaatgctcatgtaaaagctctcagaacattgtgca
aggtaaagtcattaaatcctgaggaggctgatcaacttgttatgagatgg
gggcagcagcttctctctaaagcacatgaaattttagaaaagtacatttc
tgatgataaagaagcaaataacaatagtagtttctttacaccaccaagaa
gtgggagcagaaaagggaagcaagcagcaagagcatccaggttattatca
aaaacagtcactgcggtctatactgttgggtctttggttgttgtctgtcc
tgctgcggatgtgagctccattgttccactattatacacagtcgtaactt
cagggaattctgatccgaagttaaataaattaccagggcctaaggtatct
ttgaagcagacagccccttctttgtacattcaagcatggttgacattggg
gaaaatttgcctcgctgatgggaagcttgcaaaaagctacattcctctct
ttgtgcaggtgtaatcatcaacctgatggcttctctagtctatgctatat
agtttcttgtatgattttccattaatgttttgcaatccttggttcttcaa
atgactactttttcattcattcatattcatcacaatttgcatggcaaaac
atttgagcatacccagctgcatcaattcatagaacagcaccctattgttt
tcaagttatgcccacagtttttctgaatgtcatcgatttcaggtagtatc
tgataacaatgttaaccatgcattttaaaaagcaggaacttgaaaagagt
gattgtgctgcccttcgcaacaatcttgtagtgatgatggcagatttctg
cgtccgctatactgctctggttgattggtgagtcctgggaaaatttaata
taaatgagcttacttgggtagtttcttcaaagcaactaattaaaagggaa
agaaatggagcacaaaaatccttttctatgaggctgattgctgctttaat
gaacaattgtaatatgcagttacatagctaagatcaccaagtgtcttcgt
gatccatgcgagcttgttagacggcagacttttatattgctctcaagatt
attacaagtaagtttgcattgctggttgtttcacatgtgatgttatctta
atatcctattgaatgctgtcattttgatcttaaatccagagggactatgt
gaagtggaggggagtgctattccttcgtttccttctgtgtcttgttgatg
actccgaaaaaataagacaacttgctgattttctctttggaaatattttg
aaaggtaagcagcttaacaattcttcaattgtaacattgtggaagtttgt
gatacatgttggattgacttttgaatttgtttttcttccagccaaggctc
cacttcttgcttacaacagtttcattgaagccatttatgtactgaatgac
tgccatgcacataacggacataatgattccaagaattcacggacagagag
tcgacttttttccatcaggtacttgtttccttcattcagatgctggaaaa
gggatttctacaactgagatacatattcatgatctattttcagtgttttc
ttcctttataaattctatactttacaatttccaggggtaatgatgagagg
tcaaggactaaacggatgcggatctatgtgtgcttgctgaaacaaatggc
accggagcaccttttggctacctttgcaaagttatgtgctgagattctag
cagctgcatcagatggtatgctcaatatagatgatataactggacaatct
gttcttcaggtactgatcatctgcacatttgtagaccgtgcctgccaaaa
aaatgtagtgtttttttttcatgataatgttatgacagcagccaatctca
gcatttattatatgtttatggagcaggatgctttccagattcttgcctgc
aaagagatccgagtctcatcccatcgtggagctgcatccgattcagcaga
ggtagaggaagatggtgatagcagtgcatctgcggctgctgcaaaaggaa
gggctataacacaagctgtgagaaagggtcttattcaaaacaccatccca
atttttatagagctaaaacggctactagaaaacaataacagccctctcac
aggttccctcatggaatgcctgcgagtccttctcaaggactacaaaaacg
agatcgatgacatgttggttgcagataaacagcttcaaaaagagcttata
tatgacatacagaaatatgaatcagcaaaggctcgaacaacagctgcaga
agcagttgcaggcatgcaaaaccaaggtgtctattggtcaccgccttgcg
ttccgaaagctgcaactggagctcatcctaaaaacaagatgaaccagaag
ttgtcaagtgattcgaaagtggcatcagcaatagcagatgcagctgcgga
agccaccgcccggtctgtgctaagggaggtgaacaaaggagcaatgaccc
caccacttaaggccattaatatgccaaagctcaagtctaaccaggcagga
agctctgctaaaaatgatcgctccttagatgtattggaatccttgaggag
gcgaattgatgatgagaactgatgattatgaagtctacactttttgtttc
atttggctaccacttaatgacttaatgtaaatagtaaaagattttgctaa
caaatcaagagtaataactactatgtattaatatataatattttcatcat
tctttatttaattgttcattattagagctggattaagagctggataagat
tttcgaatttgagtttggacaggtttataataataaatattttgttatta
aataatttttatttaaattaaataaaattttaataaaaagattaagggta
aattacactcataatcattttaacgaatcaagctgatcatcggcgtaann
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaa
gcttcatttcctgtaatatagatgcaaaacaagaacagtggtttaattgg
tgtgcaagtatttgagatacagaagcaaagcttcatttcctccagcttat
tgactcaggtttggtataacaaaatctacttacttcacgaacaatctcca
ttgtatcctcgatttcttttctgtgagctgcaattagagcctcttcttcc
tgcaacaaacaaaaagaatacattggatgaagaaaatgcttaaagcccct
aataaaataaaacacaacaaaacaaaccatatcgatggtctacctcaagt
attgcattgatattcccatcggtgggaggctcaggattatatcgtcgacg
tccaacatcatttgtgctgttgtgattattagaatttgactgcatagagt
tttgagttgacaaatcagatcctcctccatctttcttggtccggttcccc
atcttctccggtttttcttctctagtcacttttctacggggtggtgacac
cttccgcactttctcttccatatcagctgagttttgagaatttgatgagt
aaactcttagacttctagaaccaccataagaattatttacttcaattttt
tccctatctgttgggccagaagccattccactttcctccctcccaatgaa
agttgaaggctgtttgtcaaaatcaaaagtataaacatctttctctacag
gccttcgacctgtatcaacaacttctacttctggttgtctttcataaaca
tcttctacatctgcagtagctaacagagacaaggatgaaacatccctgtt
acttggtggtaaagaatttacggtctgatcttttttgggattaccacttc
tcgaactcgaaagacttttaaccctgctcatttcaataacagtaatctat
atttagtcaacaagaacaccatcacaatctagtgcatcaaaggaagtcca
tttttttggaggctcagtatagaaacaagaatacctatcagcatatctta
gagtattgagagtgtgttcacatgaacctgcattaggagaaatacatgag
atcataactgtccttgaattgccaacaaaagagtcacggagcacttcggt
gagtttgctcccacgaaatggtatatgaatctggtcattgtccagagcac
gaatgcactccttaagagccaaaaggcttttattaatttcagcaccctca
atcctgaaaagaattcaaaccagttatatcagaacaagccaaaaataaac
aaaggtgaaagaaaaaaaaaatacatgttaaaccagataaaaaactgaca
gacgaagcaacccataaatagacctttgaaatgggtttctacaccattct
ttttcgacggaaagtttcaaacatacctagtttgccggtcattgtctgta
gtatctgcacctctttcactgccggcaagatcaataaaagaaatctttcc
cacaaccttcccagctttagactcattcacatcattgttccgcttggact
cctttatctcagggtgcttcttgatgacaagttgtaaaattgcatgtgac
cttgaagattcctcgtttgcaccagtagagccagtgcttctagcagagtt
tcccctctcaatgtattccttcacaacttgcacgtctgacacctcaaatt
cttgcagtccaacaatgcagacttgttgtctcccatcttctctcatacaa
agtttcctattgaacatttggattgttcaatgatctaattattattaata
catatgcatccacattccagtgtataccagagatacacaatgaagagaaa
atctgcgcttggcataggacacaaattgtgcttgtgctaatagagtcaga
ccagctgacatttcaaagtcattacagcacatcataaatgaatcagatat
gtcttgaagaaaggggaaaaagaaaaaagaataaaaaggaagataaatca
gaacacacatacacgtaagtaagtaagcaaggaaagaaaggaaagggaaa
tactttctatcactcagaaggtcgaagagttttccaccatatatctcaaa
atagctaagccacaatttaaatctctgattgcggtaaattggctgatgca
agaatctaacaaggtcttgtgcagctctgagaggtaatggttgcatcgtg
aacgtcttaccactacctaaaatcacaaacatataccatcaattattagt
gcagaaaatagcaacaatgcaggacaaccatgaactggaaagacaagaaa
tgtggagcaagaataaggacaaggaaaatgagaaaatgaacaatcatgcc
ttaggtttatgtgatttagttcagaacagagtgcttcttctctttttcca
gcactagttgttctcctagcagtaattcgttaatctaatcaaaccttgtg
atatctaaattccaaagcctaatcatatgcattaattaaagcatacaaag
tagaatgcaaaaatatagcacatggcccattcaggaagattgcagaaact
atatgcacctgtttgcccatatgcaaaacaagtggcttttgttcgctgga
aaatgattggaataattggctcaacagtagcatgataaacctgtacaagt
aaataagagaagaactcaaacttttgctctaacaaataataaacaaagag
aagatgaactttggtcatagtaaactcaacattattcagaaaccatgtta
gactggcaacaaagcaaaatagctcaaccgagtactacctcgtcattgtt
aacatgctcatccagaacagcatcaaaacagaactcatgcttctcgacat
acgctgtcaagtccacctttaacataacaataaaagcagatataagaaaa
agaaaaataatatatcaaaacaagcacaaatagttctaaaatattcatct
cagaaacatataaatgaggttgcaagaacttctgtggataatagacaaac
ctttagctttggttcatggacagttaaaagcattctcactcacagttact
atatcatcctcctttcgagaaatctccttcttgtttaatggtcttttacg
taccttatcccacatgtaagacaaaaattagctttccaggaaatctaaaa
agcaaggtaaatgcatcaactgcagccacccagaaaaataatcaagcaca
aaggcagtttcaaaactggacaaatgtatagttttttaaccttaggaagg
acagaaagatgtccttatctccatagaggatgagaaagcatagagaaatg
aagcattgacataccacaactttaatcttggcaacattattttcccttgt
gctgctgatctctttttcattggcagaaaataatgaagcagaggcatctg
catcactttgctctttttgctgccagttagttgtcgcattaaagtcattt
tcaaatgctttgttcacaccaggtatgaatagtgatggctcaaaaggttc
tgaggtaacatgctgcaattaaatcaaatcaatatttatttccggaggaa
aaagaaacaacgctaaccatcatggtagtttcctagaatgctagaatcat
acctcagacagaagctctgtatcatccatagcatgaagatccaagagctc
agctccaaaatcccccctgaactctggagaataaaacccatcagatgcag
caggccctcctgaattttgagcagttggtttgtatggctccaacccagat
tccccattaatattgaggttcctcattaatttgaatagcctctgcttctc
ttctgtagattgtgctccataacccttcaatagtgcaatagtaacttctc
gttatctcagaatgtgtaaattgtaaaacccggttaaacacatacaagat
tatattactaaaaaatttatgtaaaaatcaaatgtggttttggttgaaat
ggtaaaattaaggttttaaatatcatggtgtcttgggttttaaagatcac
ataaataaaatagctattttatagattttatataaaaatataactcgtga
caactctttcgtaagagtttttaagtatagatacaaatagatagagtaac
tgcccgagaaaacatttaaaatacaaatatttcatcaaaagggaataaaa
gcatagtagtctgtactatactggtacctaccgtcgtcctaaaccggtac
cgaatagcctatgttcagtttcggttaaaattccggtgtatttaggtcat
tttggtgtatttctgccagttcagtcaataccggcttgtaccagcccgta
ccgattgatacaaaattttagcatttaaaccaatttttaaaatttttctc
ttaaccatttcattttccaaaattgcatttaaaatgaaaagttattaaat
tgaattattcaacctaattaataattttaaaacttatatttagatataaa
tatatttatatggatataattgagatatatttgcatgttaatataataca
taatttattctctaaccaaaataaatataatttatgaagaaactaaaaat
tagactacaaatatatatatgccagaaaatatttaaaaacattaataaac
ccaaaacaatacaccaaaacaagctggtaccggtacgtagaagtaccaaa
acaaaaatggtacacccgtggataaagataaagtactggctaccttgaat
aaaagcaaagggaaaaaaacctcatgagaaacaatacgaaaaaacatcag
aatgatcaattaatcatgaactccaactttcttaaaaagcccatcaacct
aattgtcaatactaaaagcgaatttcataacttcaagcaaatgaaaaagt
acgcacccccatccactcggcatggaatataaatggcaaaaaggacacat
caagaacaatgtacagatgtcaacaacatttccgttgaaaacgcaaaggc
tatttcactaaataattcattaaaatgagtaaattcacggcaattaaata
tacaaattaacccaattcaaattgcatgaatctgaatcgagcaatgaaaa
gtcaataatcgaaaacaacagaaggtataaataaatatacggaaatcaaa
agcaaagcgtccgttacctgcatgaggagattgggaaggaggcgttggtc
gataccagtagaagccaagggagaagccaaatgctgcaatccagcagact
gcaaccgccgagccataacggcatcaccagcatcgccgcctgtgggaccc
gcattgtgcaaggaccctacgccggcgtgatcgtaaagcgccgtcgctgc
agcattgctttgctgcatctggccaccaatgtggcgctgcgatcgccttt
gaggagccaattttaagatctatttatccacgccaacttcaaaaaaaagg
aacaaaaaaaaactaaactccaaaatcaattttcaaaaacaataaaaaaa
aaagataaaagaaatcaaaatatatgtgtatagctgaattttacttacaa
tttggagaaaatccgagttcgaagaagaacatgaaagtgaatttcttcca
aaatgaaaaggcgaattccaataatccgtgaaattatttttaccctatcc
aagaagaaaaaatttcaaaattcacgcattcaaatcctttcgaaacatta
aaacaaacagaaaataaaataaattaccaaagaaagagggaacaatgaag
agagatttttcggcgattcgagatctacagtcagatctgcatgagaaacg
aaattataaaaactgagaccccatttaatttcaacgtacggtgcctcttg
ttttttattctttattatttatttcttcttttttctttccctttctgtga
agatacatgaaaaactgcgatgaaagaaaagatagagcgcaagtattttt
tttttttttcaaatttattgaacggctatgtttgaatttattttgaatga
cttatataccattgttacggtttgatttctcttcatgacagaagatgccc
ttaactgctggttttatttatgcttttttttttctgtaaaataataacgt
tttaatctatttgggaaaaaatgaaggcattttannnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncactaattcaacacca
tggttggtttcaaacaccttcctgtttagcttatcgagtcaactctttaa
aataaatgtatgtacatctagctcacctagtttgtgaatcctctctatga
tgattatacatttagatcacctagtactgaggtgccagacagccacaacc
tcaacctcctgattaccctttactttcacgctatggttacacgtagtaaa
gctaatttttttaaacccaaggcttatctaagcatgacaacatatttatc
taatgttacttttgttgacatccatgaaaaaatgagtaataattgctaga
aggatgttgtgcaaagtgagttataggctcttctcaacaacaacacttag
agtctttgttcacttcctgttgatcgtagggacataccatgtaagtggtt
gtttaaggtgaaaaagaaagctgatgggactgttgaaaggtataaagcat
gactggtggctaaagggttttctcagtatgttagatctgatttttaagag
acctttagtctagtggttagagcaacaaccattcaaactgtgcttactat
tgcagtcatgaagggattgtcattaaggaaaattgaagtaaataatgcat
tcctcaatgggaatttgactgaggagatatgcatgaatcagccacccgaa
tttgaagtgttaagtaacaatggacagaggcttgtttgcagattgaacaa
agtattgtatggtcttcgctaagttcctcgtgtatggtttcacactctaa
aacagtatctagttgatcaacttgggtttcgtgtttcaaaagctaatatt
tcattattcatttgagcatcttcaggaactttcttactgctcatggctta
tgtagacgatattgttataacaggcaatgcgaatggtgatataaagaaag
tggcgcatcagcttcacagtaagtttactcttaaatacatgggaagactt
taatttttttcttaggtgttaaagtttagcacacatcttgggggtttcta
cttacttaaaagaagtacatctcaggttgctttcacaaaacatgaatggt
gggagcagcagttacacttacacccatggtgagcactcccaaattggttg
cttcagatgggaagctaccatttactgatgttcattttgtatcgtagtat
ggttggaaatgcttcagtataatgtgtattacacaccctgatttatcatt
tttgtgttaacaaactcaatcaatacatgaattccccgagtgacactcat
tagaaggcagttaaatgagtgttgagatatctcattggaaccatggatca
tggtttgtacttcacaaaaggtcaatttgagttagtctgttactctaacg
ctaactaggcttcatctgttgaggatagatgttccaccacaaggtatgtt
gtttatctaggacctactcctgttgcatggtgttccaagaagcaagtggt
agtgtccaggtcatcattagaagcagaatattgcagtttggccaattgtg
tctctaagctattatgggtaaaactattgctaggtgaagttggtttgcca
atttgtcaatcactagtggtctggtgcgataacacttcaacagtctcaat
agctgcaaacctcatacatcatgctagggtaaaacatgtagaaaccaatc
ataattttgttcgcaaaaaagtgcttgatgttgtactgcaagttaatttt
gttccatcaacaaaacaagtcgttgatgttctcacaaaacccatcacacc
caaatagtttgcttcatttcgcaatgctcttcgagttctatttgttgatg
atgatcttgatgttcaagtttcagaaaactgagggaatgttagagtaact
gattaagtcagttaatttgttattagttgttaattaaagtaactgattaa
gtcagttaatttgttagttgttaattagctgacagttagtttgttaactg
ttgatagcatgctttgttgttgtgtataaaagcatttgcagcttctgtat
gttcaagatgaattgaataaacatctttgattcataaaacctctgttatt
tttcattctttgttatagtttcccaatcgaatatagttaatttttttacc
aaactattttaaaataattatgtttgataaaaaaattttaacactaattt
ttaccatatattttaaaatagcatttaaaaataatatttatgctttaaat
tactattatttttaccctactatttaattattaagttattgttaaattat
tttatcatactattctttaaaaaatttagatacttttaatttcaaaaaac
ataattaactaccatgtaaaataacattattaaaaaactaagaatatata
ccaaatttcaaattgtttaaattgttgggagaataatttatttcaaagaa
tcacacgccctttagttaatccccttgagttttatttgtaaagcattaga
tactattgggcttgtaagagttcaaacgagaggatgagctcatgcacatg
agaactaagctagaaagctaagttgattgtaaatcgcttgatttcttcct
atgcacaatataaggcaaagcatggtccattgtttattttctcaacttat
ttgactaacattcaaagcattgctagcctttcaatttgtaggtaaaaggg
cttatttgatattttctcatctagttttgactaaattatcccatccttga
ttttatcaacttattcgcctaacattcaaggcattgtcagtctttcaaaa
atcatcccagcttaaagtttcatttttctcctctctcaaatgcctatcat
ctccttctacctctagttgagtgattttaactcgttttttcctactcatt
gtttcctttaaaacaaaagtgttgttgaatcttggagaatactctatctg
tataatatccttaagcacaatgcgcagtcacacctcaagctgtaaaccca
tcctttacgttccatcctacttcattattttttttcagcaatcttaatga
tatttatagatccaacttcaaacactgctactaacacccttgcttctgtt
gacattgctgccaataatgccaatgttctaaccaacgccacatatattgc
tactattattaccccaattccaatggtgcctatcgctttctacgttgaac
tattttttaatgtctctaaaattgaagtattcaatggggaaaaacttcaa
aagatggaaagaacacatgtttttttgtacttgggcatgaatggaattgt
gctcacacttataaaaaagccatcatctaatgcctcggataagcaaacag
aattatgagtacacatgaataagttatgtagacacataataaatacaata
ctattgaataagctttttggtgcttattgtttgtacaatgaactaaaaga
aatttgggatatgattatcaagtgcattgctaaagatgctggtacaaatc
aaaaattaccacaatttgttggaagatctaaagtccaagaacattacttt
gctagaagagtttgttgttggactacaaattgagaaactgccctcatcat
agtacaactacaagcaacaacttaaaaaaaagcacaaacaactttctcta
gtggacctaatcactcatgtgatcataaaggacaccaatcgaaaataagc
taaggtcgccaaaacaaaagagatcactactctctccaacttggtcaatg
gtaaacctaagagaggtatgcttaaaaaacataagcctaaaacacaaaac
catgtctttaagaaaagaaatcaatgcatacgctgaaaggggagaaatga
taatccctcaaagacaaatgtaaacttggtcgaagaagatgacataattg
cagtgatcatttctcaagtaaacattgtggcaaatatgaaagaatgagtg
ataggatctagtgccactagatacatttgttccaatcaaaatatgtttgc
ctcctattcccaaactataaatgcgtttaagaaaaacaaagttatgttca
aactcatttctagaaagacatttgccttaaatgatgtgctctattgggct
attagaaaaggttaaaataaaagtctccttcaagtctaataaggtcataa
tgaccaaaaacaatgtttttgcaaataagagatattgtaataattagatg
tttgttcttaatttttgtgaaataataaatggaaatgctagttcttttgc
ttacttgactaattcatatgatttgtgtcatgatagattaggacatgtga
atatttctcatgttaaaaaattcaacttggttttgtttctaataatattt
gcatgcgaaaatgtgaaatatatgttggatcaaaacaaaataagaaaact
aaggtaaaagatattatgttacctttattgatgatttttcaagatacact
aaggtatatctacttagaaataaaaatgatttttttgtatgtttcttaag
cataaagtcgaattagaaaaccaactaaatagattaaaagagttagatca
gacaaaagaggggagtatgttttgtttaacgactttagtgaaaaaaaggc
ataatatataaatttattctaggttatccacattaatcatatggtatagt
agaaaggaaaaataggacattaagagaaatgatgaattgtatgcttgtta
gttctaatgcacctaaaaatcaacgggggaagctatttgatgttacttaa
aaactaatatcctcataagaaaattggtaatactccttttgaattataat
cttcctaatctaaaatttttaaaattctaaaggtgcctagcttaagttat
gttagttgagcccaagaaaagaaaaaacaatagtttttaaaacttttgat
tgcatgttcaaaggttatgttaaacatagtgctacatatagatttcttgt
tgtgaatagtgatgtgcttgatcgtaataccatgcttgagaaaaaatgtt
gaattttttagcatgtttttccttttgaatttgataatatgtgtcaaaca
cctattatggaaaatgattgtgactattaggatttgagaatgtttatgtt
aaggaatgtgtagatatgcaatcataggaaaatcaattagttaattatta
acgatttgattttatactaattttttttctttccttatagagtaggttct
aaacctatatatgtatcatttggttgtatgtaatacaatgaaattcattc
tctcattctccttgtgtttcattatttcgttcttcagtattttgttcatg
gtatcaaagtatcttggttcaatttagtgagttcatgttttgttttttta
aacgtaaacgatttagttttttgtgggtcacttttttcaaagtaattttt
tgtactcacaattggcacaaagaagtgcactattgtcttaatagacaatc
tgcaaattcgggcaaccagagaccccgcacttgaggtttaggcactactt
gaaggatagtatcccatcttcccgcattgaaacatatgggtgtgtaaagc
atttttaggccaccgacttctacccctaacgttgactccctgtctgccca
tagccaaatgatcgggtgcttaattggtggaagttttgtaggtcattttt
tgcataattttttatattatttgctattgttaaattttggttactatttc
gagactattttattattttaacttggtttgggttgtttgacttgatgtgg
ttgttgggatttcgatttcttgatttttaataaatacgatggtaaacaca
aaagttactatgattgagatgattcttgtaatgtctaaaattacaaaaca
taaactcaacagaaccaatttttttagtatagtaggacagttcggatcta
tttgagaagtatcaacaaggatgatcacttgagtgataacccacccacaa
tgagactcaaaaagcatggctaagagataatgctagattttttttttgca
aatccacgattgtattgatagtgaggtaatttctttgaaaaatatgactt
tggggactaaattgaaaagcttttcatttgggcaagctctaacgcaaata
agagaaattggcgaactagatgataaaatattagatttcaacttttagtt
ctattacatttgaactagaaatttcttagtgggagacatgatgatgaagg
atatctacagttggttgttgaattagtattgatgaaggaagtgtggaagt
attatataaaggagagatgtttttctctaatgttactctttcatttttct
gttctttcttcatcttcttcactggtctggttgtaagagagaaagattaa
ataacagtttacatggaggaaagaagctaaagtttgtgcataagtaacta
agaatttatcaagccaataagctttctaaactttctatattcacggattt
aaaaaaagggaataaagttaagtttttcggttaattcatcgattttgttt
tgtattgtgtaaggttgtggataataatttaaatggattttgcatgtaaa
ggaattattattcttataattatgaattttctttgctggaattttgaaat
ggttgttatgctttcttgactaaggagacttatgtagtaagggaaaagct
aagtaaatggatttgacgtcaactttcaattgagttccaaaactcaagtc
ttaaatggttgttcatgtattttcaatatcatgtgttgggtatgtctaag
tgactattgtgtaaatgatgagtcactctacaactgcatataaatgtatc
atgacgcatgttgtgtagatatgaaaacacataactgtttgtaagtttaa
ccactttgaatagatgaaatgtttggcataatgtgtgtcgtgcatgaata
gtaatatcggttgactgcttgtgtatgaaacatgtgtatgaatgatatgc
agagttgtagaggtctgtcgatgtgtaattgaaatgggaagaggagcgga
gaatatgatatgttacacgttttgcctttggtttggcatgtgaatacaaa
acgagaatggcgaatgaatccagccttgtgagggaacacttatgtgttta
aattaccaagaaggatttgcggaggttcgggtggactgtacggagaaagg
tgcaccagtatatgaaagccctttaagggtagtaaaaaactctacggagt
cggaggctttaagctatatgaatgaatgcaagtctatggccatggcatga
actagggagatctacgaaacaatttgtgtttatgaatccattagaatcgc
ttataaggcatgatccatggaggtccactagactcgcctatatggcataa
tccaatggaggtatgcgagataattcgcatatgtgaatccatgtatatgt
ctacagctaaatttccacaaataaaggatccgctcttaaaaattcgccta
catgtaatttgtttctaaaagtaggccattatgtatgggttatctattgt
cacgagacattcacaaattatgattgtccattggatttgttctttaagct
tagtgttgaagctagacatggaattccatcttatgaaggttcgcaaaact
gctcgcgtattggaattcatttctatataaagatcttttcttataaatct
gtatctacatacatgaattcatgagttattattcgtatatatattgcctt
ctaagaatgatggtctatctttcaagtggaagtcgcagaagctatccgcc
aaaagagtgtctgcaggattcaactgtgatgtgctaattcgccatatagt
ggttagcaaaggtatttcacggttgaaccaatgatgagccggtaatatga
cttcagctatctaatcattgaaaatggacaactaaaaataatctacaatg
ggttccataaagaaaagtgaggaagaggaagtttgtgtcatagaagataa
tatgtcaacttatgagatgcttcgatatgtgtggagacaagtttatgcca
gtgatattagctaactgtcctagtactgataaagttaacatgaactcaaa
tccaagaagtccttgcaaataaatgattttgtaaggatataaggtatgga
caactcactaagttcaatttaaacttatgtttgtgttattatgtattgta
ggtaaaatgaaaaattcgaggatttgaggaaggaccaggtcaaaatctgc
cgtgctcaggcgggcatgtttcttagatgtaatatgcatccaaaggcaga
gcctgagtgtcatgttcgaatttgtatttaagtatgaacagaacattctt
ttcagaactaaatatttcactctagtaaagttacgtttgtaaattttttg
tatcttaaattaaaaatatataattgaaaataaattcatgtatgtggcaa
agtcatttagctaaccatgttaaataatattcgtattaagtgaatatatt
ttcggaatattttaaggaatgtgttagctaaaatagggtatgcagcatag
taccctatagcccagaatcgacgatcggatttggtacggagtgttacaaa
ataattgtgagtttgttaaagaactaatagagtatttggattttttgtat
tctaggaaaggcaatatctcttgtatgtatgaagtgtgccaagcgttcta
tcgtccagaaaagaaagatagatccttcacaacttacttcatggatttta
ggagagtattgaagaactcaatgtgttgtgtcattcaattcagatgttaa
agtacaaccatctagtgataaaatatggagatcaagagttttctctttgg
tcttctgttgaaatttgatgctatcaaatcctagattctttcgagttcta
aaattttgtctctacaagatgcattcacaagagtactataaattaaaaac
atgcattctgcttaaacttatagtaaatgcattggtgaagttgtggtata
agacgcgaaatcaactagtcatgataaaaaatgatgaataatcgtgagac
aagaggaacgaatgtgctattattgtcatgatcctagcattattgccaga
aagctttagaataaggcttggagagcacagctaacacatattgcaacaat
gagttctgagaccatttcgtcatctaaaaaattcattcctttttatcatt
gttattgtcgagtcaggtaactcaactaagtgactcatctcctaatcatc
caattagatcattgacttcggtgctataaataatatgacaagtaatctaa
atctattttcaacctctaagccacatatacatactcttaaatttgtttta
gctaatggatccacctctcgtgttcttagatctagcatcgttcatcctac
attttctatttctctcagttctgtgttaagcctacctgatttttctttga
acttattttatgtaagtaaatcttacatgtgctctcaactgttgtgtctc
attttttcctgatcattatctctttcaggatgttacgatggagtgggtta
ttagtagtggctataggtctcaaggtcctataacaactcagttttagtgg
tgtcgagaacggtgctttcggaaccccatttttgatgttcaagaccataa
atattatcacttaatatttacgaggttagtataaagtttaattaaagttt
ggtccattaatttttttcaattggataattgattgaggtataaggactaa
attgtaaaagtggtaaaaattaattgctatggattttaaataattgaagg
actaattgagaaattagacattttttaagtcaccaaacggtggtggatga
caactttcatccaccaatttggttaattatcattaacatttattaattaa
ggttaaattaaataatttatattttattagttttaattaaatgtatataa
gacaaaatgtaaacgaaacattgttaatctttttattctcttctccactc
gaaactatgaagaaagaatagggtttctgcatttcagctttggtccctaa
attggtaagcaattccaagtctgtttttttgtaattttatattttttagg
ttttaggagcttgaattagctagcccatgtaccaattttttaaaactgtt
aaagttttcaaaagttctcattgttgaatacttgatgaaatttgtgttat
tttgctagattttaagcttagatttgaaaaaaaaaattagtttgtaaagt
ttaattgcgagtttgtgaacatagggactaaaatgtgtaaatttcaaatt
tgatgattaatttctataattatagataataaagggctttagaatgatga
aattgagatcattttcgaaattgaagcttaaatttagaagctatagcaat
ttcgattttaaggactaaattgaatcaaataaaaaaaatttaaagagcat
tcaaaaagtgaagttgaattatcatatgcatttaatagggtgatataagg
tatttggagttgattaactaaaataaattatcgtatagatcgagatttga
accaatcagacggtaaatcaaggaaaaggcaaaattttagattagctctc
gatgtcttgcttgttgtttttggtaggtaagttcatatggaacttactat
gttatttatgttatgcttgaactatattataatgtctattagtttaggtt
aattgtaattttaatggttttgacatctaaaggactaaatcataaagtat
ggaagatatgatcattacatattaatacaatgtattgaatgaatgtgaaa
tggttatattattgaatgatatatatataatgacattataaggtttgaaa
tggtacagaaacagtaacagtgcccgcgtgaacttagtaaacgattagaa
tacaaatgttatgacattagggttcaaatggaaaaggaaatggttcaatt
gaaaaaggaaaatgagtgtttgatcagggattaatacaatggcttgagat
ccaacatttgtgtggattctctaaagctaatgttaacagcatcgaactaa
tctcgaatgagcaaccttaatctgaagctagtgctagcaccctgattatg
agaactcgtgtgagcaaattagtctcgtgtgtccgaattcaatttgctat
agttctccgagagaaaaaggtaattaaatgaaaatgaaaatgaaatagtt
gaaaagattgaatatgaattcaatagatatgattgcaaaatgagcaaggt
tgaatggcatgatatacaatgatatggttgtacatatatataaattgatt
attatgacatgattatgttaatatactaacctattgggttgttgtatgga
attgtacatgaaagtataaggatgctaaggaaatgtcttgttatgtacca
ttgtgttccaattatttaaatttttggaatatcaaggtaagttaaggcaa
ttttcatatggatttactaagcattcaaaatgcttacttgttgcctccct
tttaccttatagattgttagtttgtggaacacgtcgaccagatcgccttg
aagctcacattatcctactatcattcggtagtattttgcccattttaagc
ttgattttatagcatgtacataggtgttgctttattaacataaaaatgtt
agtttggtttgaaactttggttaatgattgattttgagcaaaccaatgcc
aagttttgtatatgtttgatttggttattgtacgattttgtgaatggcat
tttgaatagcataattaagcttaatatggaatgattaaatgttgttttaa
atggtttaaaaacatgattctataagtaatatttgaataggttgaattgg
tatgaaatggtgccaaattgaggcatattagattgattgattttggaaat
ggttaaatgaatgttatagaatgtattttggtttattttgtgtaggtaga
cgaatctctagatcgtaattgt
back to top