AC202829

Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Sequences
The following sequences are available for this feature:

region sequence

>AC202829.1 ID=AC202829.1|Name=AC202829|organism=Gossypium hirsutum|type=region|length=64854bp
ataggataatatccaccattttttgtattttgtggtagtgaaaaagtctc
tttccatatgcttatagaattgatataaataaggaatatctaaataagaa
tcatagaacattaatttaaaaagatttcatgtagtgcagattatattatt
tgatgtttcaaattaggcatttttttacggtggcattttttgggtggcta
attaatcacattgtaaatataatagtgtatgtacatatatatgtatacat
gtgtgtgttcgtgtgtgtatacatttatatttgtttgcatacatacatat
gtttatatgtataaggtgtatgtatgtatgggcacacggaagatcagcca
tctatgtgtgcacaattaacacgataatatgtatggatatatgtcaatgc
attagttttgtagtagtagggtatcactcagtagtaaatagtaaaatata
gtagagttttttcttttgaataaataatctaaagaattctatgcatgttt
ttatgtagacggtaatttatatatagcacgacacattcatgtgtgcaaaa
tgttctttgattgtaggttactatatatgttgtgtgtaattaagtatgcg
tagtatgtgtatttaaaactatgtgcttttgtgcatggatacgtttgtat
acaaatgtgtacgtggcagcatgcatggatatacacatgttctgtaatga
aacatgaacattggtttcgtttgattctttttttacatggaattaactga
aaacagcataaagtcgagtacattttgttaagttggtaatacatacctgg
tgtgatagaagatgcaggtcgtcagaagagaattgtgagcgttcgaagca
tcaaaggaacctgcaacatcagcaattttaaaaataaaagtcagttatgg
atatgtctttgaattcaaatttcgtagtgttgtttcctgtttaaaaaata
gcatcaaaacatatcgtttggtgcattagtagttgttgtactataagtaa
tcagcaatgtcatttaggcaatctttagcagcagtagagttgcttcgggt
gcactttttttagtagatgaagagcaggttgcgtgtgtcataatttaaaa
ggaagacatttatgattgatttaaaaggcacagccgattgaatttgcttt
aagtgtatcaagaagtagttgtttggtcaaatagatataactggttatgt
tgtgtatgtaggtatcaagaaatagatatttcgaagagttgttgatgtaa
acactaataagtattcagcaaattcatttaggaaattcttagcagcagtt
gagttgcttcatttgcacattttttagtagacgaagagcagattacaggt
gtcataactagccgtttgattttgtgacaaggatatcaagaaatagttgt
ttggtcaaatagatatagcttgttatcttgcgtatttaggtatgaagaaa
tagctatttggaatagttgtggatgtaaacatataagcaactgagttgtt
tatctgtatcaaaactaaagaaatagcattggatgttggaagataagcat
tagcctacatgtatggggcaattcagttagacagcatagagtgtaaatgt
tgtggtggtaaactcgtccctgggatgttagccatataaatgagtcgtct
ctgttggttttaggtgtttatttaatacaaagaaaaaaatgttcttcagt
tttcacaacaccaaaaatactggattcccattacttctaaagtgtgtgtg
ttccattttaacattcagagagtgaggagttgcaatcagagttcgatgta
accaattgctattgacacaaaaacaaagctgcttgaatagggcgtttgcc
tccacttgccatggccttagcggcctggacgtcatcagttgaagaaacca
aatgaggaaaagcaagaaaggtgtaggatctcgaaatttgatcacccttc
taaccacaaatcggcaattgagaactgacaacgtatgtaacgggggcaaa
acagaaaataaaaaataggtaagacgaatctctagatttcgttcatgnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntag
gcgattcagagattcgtttgccattgcccattagcattccatgtagtctg
aaggttgtcttgtatctctattgcttcaactccttttgtttaaaacaaac
cgatcgagatgcatgtctgctgattatattaatagacaagtaatctcggt
cgattaggcaaacaacaaccttggaggggttacaatagctaatacaaaac
tactagaggaactggctgtgaacacagagtccaaacaacgtaaccgcaac
gaagacaaatccccataggaaaagacaaagaaacacatgttagaatagaa
tataatataatagcgtgtttggtttgaggaataagttagtatatcgtatt
ctcactccttattattttatttggtttatggaatgaaatgagttgatcca
tcatcatttcattccttatgtactaataattagtaaaagtatgagaaatt
gattcattctaccaaatttgtggaatgaacttataatgcatcaccttata
taaatgtgcttatatagaactagtatctcacgtgtccttcgcgcgttgtg
ttcctcatgtcgctgttatacaggtgtattattattttgtatactttaaa
aaaatataagatgcaactcatatagaaaaattgcaaggaagctattcttg
ggcttataagtgatagtccctccagttaaatacacacgatattttaaaca
tgaagattgagctacatggagaactattttcttgtctaaaatgtcatgtg
aaaatgattggggctagaaacttgtttcacaacaaaaatgaatcatagat
caaccattgcaacattgtttgtaaaaaaaatgcaaaaccacatatcagga
ttaaggtcgcattggaaatatccatgctaatgcatgtaaatcagatctta
aaatatttgaaagcaccagtttcgtatttcactctctgagaagggattcc
ttctgcttttcatcatctgatagactgcattcctgaaatcacaataaata
acatgaactttactaaccttacagagcacattgtaaaaaacgataggagc
aagaggtatgagttgtccatagcatgtactaaaaaatcattctcttatga
cttatttgatcttcacaatgtttttatggttcatccttcgtatggactga
acaaaaaaatttgaaaagaatgacatataacattataaagattagatagg
ctgcgaagcaacaatcaccttcgcttatcgaagatttatgcactcccccc
aaagaataatattttgtcttctcaaacactttatctaaaagttaagtgga
aaacgtaaacaaaaagaggatgaatatggtttagtaaactcaataattat
agtgaatacctctgaaactgcaatgcatagatgttccacttagttaagat
tctttggttggaacattctttcagattcaaaataaggcatcatcatggtt
ttttacgcatactatacatttgcttgatcaaaaagtgatgatagcgatac
aatacaaaaaaaaacagatggaacagaaacataaaagaaaggatgagcac
agatggtggacctgctgactcattgcgaccgcggttgccttcagttgagt
tctgctacggtttggtctggtgcggccagtcgttaaatgcttctttctag
atccactgacaggcccacaacagaaccaaatttcaggtaacactgccata
gtgccaaatatatcgtctaaagtaaatcagctacaatctgattttgttat
aaccatgcctgctgcataaccatgtctttgcggaaaatctgattttttta
tccatcataattctaagaagtaccggttgctcttccatttgagttatttt
ctcagacatggctattgcatcctcgtcacttatcttaccttcgccttcgt
ttggttccaccttaagtaggtcaatttcttctttcagcacactcttactt
tgtctttggtctaaaatacaaatttccataccaaactcagctgtaagtta
ttcatataatataacaaaaaaatataaatgtttgcgcgataagcatatag
gtaatttaaatagaaaatagcatattcgtaattcagcaaaacgtgctaca
aaaatgaactaagtgattcagcccaaaatatgcaactaacttaattcttc
ctagcaccaaagcatcagactttgcaactaagatgatagatttttagaac
agggaagtgaaaagatgcatagttgtccaaagaaaaaacaatggacctca
gtatgtaaataaagggaaatgttatcttcaatacagctctcatgattcat
tagtgcatacaccagtcgacgtttggttatttttgaaggattttagaaat
aaataagaccctcacgacgccaactttaatatggtctggaactcagcagc
ttgctaccgtgggtgtactcggcgtcctgaccgcatcccccggacagcat
gtacggtgtcaaaatagagcagggtgctagagacgttgaggcgtacgcgg
acgacgacgccaaaatcgttgtgcggctagcaggcgacatcgccgacact
atgggttcgacggctgggatgggtggaggcatgaggcggcggcggcgggt
gaagcgcggctccggtgacggaccgggtggggagaggacgacaacaacct
tggacgagctatgctcaatcgaagatggagagcttgaaaccctagctaag
atatgcgctattggggaagaaaagggacatgttgtgttcaacgaacctgn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnna
tgaagcgaatctcgagattcgtcgaaccaaggcaaggttaaaggattggg
caagattgctatcacgaacgagcactcgatttccaatgtattctagtaga
gtcgctcgggtataatctactgtctataagtcaattgtgtcacatgggct
acaattgtttatttacaaatattgatgtatctgtcttagaaggagtgatg
gttcattagcttttaagggtgtattagatggcaagctctatttagttgac
ttttttaaagagaatgccgatctagatgcatgcttaatagctaagactaa
tatgggttggctttggcatcgccgtctagcacatgttgggatgaagaacc
ttcataagcttctaaagggagatcatgtgttaggattaaccgatgtttgt
tttgagaaagacagaccttgtgcagtgtgccaagcagggaaacaggtggg
aagcacacatcacagcaagaatgtgatgacaacatcaagaccactggaac
ttcttcacatggatctcttcgatcccgttgcctatctcatcatcgaggga
agtaagtatggtcttgttatagtttatgatttttccctcttcacttgggt
tttctttttgcaggacaaatccgaaacccaacggacccctaaagcgcttc
ttaaggagagctcaaaatgagtttgagcttaatgtgaagaagataagaag
cgacaatgggtctgaattcaagaatctacaagttgaagagtttcttgagg
aggaaggcatcaagcacgagttctccgctccctacacgccacaacaaaat
ggtgtggtagagaggaagaacatgatgctaattgacatggccagaacgat
gcttgaagagttcaagacacctgagcggttttggtcggaagctgtgaaca
cagcttgccacaccataaaccagcactatctgcatcgtctcctcaagaag
acttcttacgaacttctaactggtaacaaaccaaatgtttcttattttcg
tgtatttgggagcaaatgttacattctggtgaagaaaggcagacattcga
aatttgctcccaaggcagtagaaggtttcttactaggatatgactcaaat
acgaaggcgtatagggtcttcaacaaatcattgggattagttgaagtctc
tagcgatgttgtatttgatgagactaatggatctccaagagagcaagttg
atcttgatgatatagatgaagatgaggttccaacggctgctatgcgaact
acggcgataggagatgtgcgaccacaggaactacaggaacaagatcagcc
ttcttcctcgacactggtgcatcccccaactcaagatgatgtacaggtac
ctcaagaagaggagcgtgatcaagggggagcataggaagaacatgttatg
gaggaagaagcaccacgggcccctcctacccaagtccgagctacgatcca
aagacatcaccccgtcgatcagattctgggtgacatcagcaagggagtaa
ctactcgctcacgattagctactttctatgaccactactcgtttgtctct
tctattgagcctttcagggtagaagaggccttgcattgtccggactgggt
gttggccatgcaggaagagctcaacaacttcaaaatgaatgaagtctaga
gcctggtgccacgtcccaagcaaaacattgtgggaaccaagtgggtgttt
cgcaacaagcaagaagagcacgaagtggtgacaagaaacaaggctcgact
tgtggcaaaaggttatgcccaagtcgcaggtttggattttgaggatactt
ttgctcctgtggttaggttagagtcaattcggattttattagcctatgcc
gctcaccattcgtttaggctgttccaaatggacgtgaagagcgcttttct
caacgagccaatcaaagaggaggtatacgtggaacaaaccctggctttga
ggatgacaggtatcccgaccatgtatataagctctctaaggcgctctatg
gacttaagcaagccccaagagcatggtatgaatgccttagagagacgaat
ctctgaatccccttctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnntaggcgattctagagattcgtacaacgtatgtaa
cgggggcaaaacagaaaataaaaaataggtaaataaaacacgaatacgaa
gagtctgggcaataaatcatgtcgtgtcccgctggaataagacgcagagg
gagagattagaggggaacggagaagcatcttggctacgaaggacttctgc
cagcagcgacgaggttgcgcaggcaactggtaaaagaaggaaaccctagc
gagcggtactataagactcgggtccaaagaaatgacgcggagcagaggga
ccacacctatggaggggtcgctaggagacacgcgaggaggggacaaagtt
cgtcgccgtcgttgtcgaggacgtcgcccccattttttttgcaggaacgg
caggaagcggtcctccgggaagcccttcatacgtgtactggtctagaagg
ctccgggtggctacgactgcgatgtgcttgcccccgtggatgcaccatcg
aacgactggtgttttaaacgaagacgtggacaccgtaagaggccgcgttt
ccttccaggtttaataataaggaaaagtcatgtgttatcgtactagtttt
tgctgatgtgcgatcgaagatctggcaagcggccgcatcctttgaccact
acatttttcaaccgctacatttttcagcgcgattgctttggactaaagtt
ccctccaacagagagattggtgtgattagttttggggaaaatttaatagt
atttttaaatatttttaaaatattaaaatacaaattgaaatacttagata
tgctttcgcactgtttattatattatataatatatagccactttgaagct
ggagaaccgagaagcgagaagcatcccagagacccagacagcaaggaacc
ttgagcctgccggcaactctaacgacgacgatggccgaaggggacggtcc
aactccagcccgcggcgctcgcgtcgtgctgttcccactgccgtcccagg
gccacctcagcccgatgctgcacctcgccagcgcgctccacgcgcggggg
ctcgcagtcaccgtcctccacacggcgtacaacgcgccggaccccgcgca
ccacccggggctagccttcgtcgccgtgcccgacgtcatcccggaggccg
tggcggcgacgacgaatggcatcgcgaagatcctcgccctgaacgccgcc
atggaggcgtcggggcacgtccgcggcgcgctcgcgtcgctcctcgcgga
ggaggcgggcggacagcggctggcgtgcctcatcttcgactccaccctct
tcgccgcgcagaaggccgcggctggcctcgggctgcccacgctcgtgctg
cacaccggcagcgccgccggcttccgtctgttcaggtccgacacctacaa
catgctccacgacaggggctatctgccagccacaggttcgtaacaaatgc
tgccactgccactgatttcagaaatatctgcgctcgcatcgcagtgttct
tgacagagatcattctgtcccgtttcattatttcagagtccaacctacac
atgccggtaaaggagctgccgcctctgcaagtgagggacctgttcgaccc
aagcaagctccccaacaaggaaatcgtgcagaagatcttgggtcgcgcca
cggagagcacgacgaactcgtccggcgcaatcctcaacacgtttgaggct
ctcgagtcccgcgagctcgagatgatccgggacgaacttgccgacagagg
tatcccacccttcgccgtcggcccgcttcacaagctcaccgccgccccct
ccaacgatggcgccgacgagactagtctactcagccaggaccgcgtctgc
atggagtggctagacgcacggggccctggctccgtgctgtacgtgagctt
cggcagtgttgttcatgtcaccgcggacgagttggtggagatcgcgtggg
gcttggcgaacagcggcgtgccgttcctgttggtggtccggcgtggcctt
gtggtcggagtggacaagcaggagctcccggacgggttcatggcggccgt
ggagggcaggggcaaggtgatcgagtgggcgccgcagcaggaggtgctag
ctcacccggcagtcggaggcttctggactcacaacggatggaactccacg
ctggagagtatctatgagggggtgcctatgctgtcgaggcccatctttgg
agaccagttgccaacggcaaggtacgtgtgcgacgtgtggaggattggag
ttttgctggagggtgtgctggagcggcgggaggtggagaaggccatcaag
aagctgatggaagaagacgagggagttggtatcaggggaagagccaagga
tttgaaggagaaagtgcggatgtgccttgagagcagtgggtcttctcaac
ttgccgtcgataagttggtggatcacatactttctctttgagtttttttt
ttatcacacaaacactgtgttgtgtctgtttcatgggnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagagcgattctag
agattcgtctcatctataaatacacccagctaccctctccctcttcacac
acactcaacaccctcaaccaaggcaaacaccccacccactcagttactcc
gctctaccaccagtaatatcacaacaccacatgacacagattctactcaa
gactatacccatccatatatcactattctgaccactatactaaatatttg
ttggcatgcttgcttgtttgtatgtttgcttattcatgttgcatagttat
cggagcgttcgtgccgtttagtggaggccagatctgcaagtctacgccag
gcggtggagccagaagccagttccgcgagctccccttcccccttcgccgg
ataagcacgataagctcattggatccctttgatgcataaattacctatgt
tttacaaccacaaccctcagtctgttattttatgcatgatatgattttga
gacaagttattatggccacccaagccgcttgccgcaatcaatccttgata
tatttgttacaaatgatttgagaaaaggtgtgagttttcaaaagaaaatg
cttttcaaaatgtgtatgatgaagggttttcacccttatcacctttgagt
agggatgatcagggactccctcgtttaggggagggcctaaggtgatggct
cagctggtttaggcgtgagcagaaggattgtcccctcatataaggactgg
tttgtcatctttcactacctgtactcttgataagtacaaccactcgagac
tgtgtgggtagtcactcaatctgaactcgtacggtccaaccccagggtta
tgaaggtcggggagcaccgggaggataaggagggggaatgttttgtccag
tttggacatggtggtggcctgactccttccggtataaccgttaaggttag
gacatgcagggaaaaaaagagattcggattcggatctcattgatcatgag
atcgcagagccgaactagtgggtaaagtgtacccctctgcacaaagttca
aacctattcaaatagtttgtgtccacaggaatggacgagtctggtgtggt
atggcaattagtgttttgttttcaaaaaaagaggtgcttttgagaaaagt
agtttttaaaaggtccggcggttgagccgtgagctatggtggacgggaag
tccagtagctgtttttgaaaatgaaaatcagtgggaaactactgagatac
ctggatggtttagtccaggggattttgttctaatattgaaaaacttcctg
ctccttttagagaggatgcgctttgaaaaaatacaaaatgtttttcaaaa
caaccctgcataaaatattgttgtttctgcaaaatatcctgagctccaca
tattccatgcattatatctgatttacccattccgcgggtgaaggtgggct
gctgagtacgtttgtactcacccttgtttatttgttgttttttagaaaaa
ggagatcgggtaagagttacgactgttcccaaccttgcttgtggctgttg
gatcgctgatttgcttcactgcgtatatcgggctgcttcagccccactct
gatgatatgtcccgagttgtggaccaactcttaaagttgttcgccacctt
tataggtttgtctcgtttaagaagatctggaatcatctgatgtataaatg
tgtttactagcctcctgggactagtaattgtatcacatttgagtcccaga
ggatcgggacgcttcaggtggtatcagagctgttaggttggccgcaggac
gtaacccttagcctgatccaaaagtttttgagtccaaactattttcttaa
aaaaaattcttgctctcatcccttcatttcaaaaatgctttccccctttc
cttctctcagaaatcagatggaggcccgttgccaaaccagcttttgccag
aatgaagatggtttccccaagttgctgagagcatgcacggtccgcctcgg
aatcaggagccagccagagtatgatggtcgtgaattcgtcgagcatggaa
cagagaagtgtgtcgtgactatatacattggatccagtccgcaccatgtg
gaatggagtgtcactgctgctgggcacagattcaaagacacctgccaagt
cgtcgcccacaaggcattgagggccctgtgtcagatctatgaagaagaag
tggtcgacaccccgctcatattctttccgccctttcagagaaaccgtcct
gtttggatggccaggatgtgtgcattggaagggcagcagctgcttgagga
tgaccccacagtcatgtacctcaccgcatacctgctcaccctggatgagc
ggtatgatttcttggctcggcaccaccgtgagatgattgcccgagcagaa
gatgcagagaagcgcaaccgtcagctccatgtggatctcaccacagctca
agcccatgtagctgccttggaaagtcgtgaagtcattgctgtgaacgaat
caagctgatatcatcagagccatggcnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnntaggcgattctagagattcgtcac
aaagacttgtgatggtgatctgtttgtttgccaaatatatgtcgatgaca
ttatatttggttctactaaccaaaagtcctgtgaggagttcagcagggtg
atgatgcaaaagttcgagatgtccatgatgggcgaggtgacttactttct
tggattccaactgaagcaactcaaggacggcaccttcatctcccaaacga
agtacactcaagatcttctcaagaggtttgaaatgaaggatgctaagccc
gcaaagacaccgatgggaattgacggacatctcgacctcaacaaaggagg
tatgtccgttgatcaaaaggcatactggtcaatgataggttcattacttt
atctttgtgctagtagaccggacattatgcttagtgtatgcatgtgtgct
agatttcaatccgaccccaaggaatgtcaccttgtggtcgttaagtgaat
tcttaggtatttagtttccacgccttgcttcgggatctagttttcaaagg
gatctacctttgacttaattggatactcagactccgactatgccggtgca
aggttgataggaagagcacatcagggacgttccaatttctaggaaggtcc
ctggtgtcctggagttcaaagaaacaaacatccgttgccctatccaccgc
tgaggccgagtatgttgcccacgtcagtgttgcgcgcaactgctttggat
gaggcaaaccctctgggactttggctacaatctgagcaaagtcccactcc
tatgtgacaatgagagtgcaatccgcttggcagataatcttgttgaacac
aaccgcactaagcacatagacatccggcatcacttcctgagagaccacca
gcaaaagggagatattgatgtttaccacattagcaccgagaaccagctag
ccgatatcttcaccaagcctttagatgagaaaaggttttgcaggttgcgt
agtgagctaaatgtcttagattcgcgtaacttggattgatctaaagcata
catgtgtttcatgcctttgatcatgttactttgagcatttaaatcattta
tttgtggtggtcaagttgtacaagtcatccccgaatctcacaagtctgta
tgcaaatgatgcacatgtttagggggagatgagctacaacttgactcctt
tgagactaacttgtttgtttgagtacacttgaagtagtctcgaaggacca
ttgaaagggaaaatgaacttgggcgatgaaaagacttccactgcactccg
atataagtgtatttaaattccgagttcatactaatgctctcattgccttt
tttgctcctatttgacattttggtgaggcaatggggttaaagggccaaaa
gttatcccgttttggtgcttaatgccaaagggggagaaattaaggccaaa
gcaactggatcaaccaaccacttgtgaatttcaaaaaataatagagttga
aatttgtattttgtcccaaatcctcttatttgtaaaatttggcctcttat
gggggagattttttattatgggaaaagggggagtttttggcacttgatca
attttattcctggaatatctctctatttgcccaaacaagtgtgtttgacc
tagagataggaaaaagaatttgatttgcaaaaacaaaccaagtggtggca
agagtgatccatatatgccaaatcctatgtgagtaaatttggtctcaaat
ctacacttcttagttgttttttaatgtgttggcataaatcaccaaaaagg
gggagattgaaagggaaatgtgcccttgggccatttctattattgttttg
gtgattagatgcccaacacattgtttggaactcagatgtgctaagtaggt
gaaaagtgcacatcaaagaacaaggtatgtttctagacttagtgaattgt
ttttgaatgctaacatgtttatctatgtgctagagacagtgccaagaaaa
gaacgaatctctagaatcgctannnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnagggggcgggagcaaagagaatcagctt
gatcgttggcaggcttcgccgtgaagcaaccttggccagatgaaacaaaa
agggaccgtattgcaggagcattcaatgcaaggatcggcggacacttcat
cctgacgcatgttcctcagtcgacagggccgaagtgaccgcaatcacttc
gccccttcactgactgacctgacaggaaaacagcgccgcctgccccgctc
cgactgctctgccacctgccaagatgaggctgacagcagctgagtccagc
ctcgggcgccacaggaagctccgcctcgcccaaccttgggccccggcctc
aggagaagtctccgcctcgcccgaccccagggctcggcccccgcctcggc
ctcggaagatgcactccgcctcgtccgaccccagggctcggcctcgacct
cgacctcggaggacggtttccgcctcgcccgaccccagggctcgacctcg
gccccgacctcagaaggaatcgcgtcctcacccaaccccgacctcggcct
caggaggagtttccgcctcgcccgaccttgggctcggaccaaccacgcca
caggggggatcatcattaccctacccctagctagctcaggctacggggaa
caagaccggcgtcccatctggctcgccccggtaagcaagtaatgatggca
ccccgcgtgcgcccatgacgacggcggttctcagccccttacggaagcaa
ggagacgtcagcaaggtcccgacagccccgacagctgtgcttctacaggg
ctcaagcgctcctccgacggccacgacatcgtatgcacagggctctaaca
cctctccaacagccacgttggcatgtacatagggctctggctcctctctg
ccggacacgttagcatattgctacaccccccattgtacacctggaccctc
tccttacatctataaaaggaaggtccagggccctcataaaagagggtggt
cgcgcaggaggacgggctgacgaatgggctctctctctccctcgcgaacg
cttgtaaccccctactacaaccgcacccactctggcgcgggataacacaa
ggccgtggtttttccccctttgtgttccgtctcgcgccaacccatctggg
ctggggcacgcagcgacaatttactcgtcggtccagggaccccccggggt
cgaaacgccgacagttgacgcgccaggtaggggcctgctgcgtgttgacg
aacaacttcccgtcaagttccagatgggtagtctccagcaacctcttcaa
cccgggccgctgctccgtttcgggagtctcgagttcatgtccctcgacga
cagctacgacatggtgctccttcccccacagcgcgacagcgacaacggcg
accgtcagcccgcccggcgacggcggactcggcgacgtcttccccccatg
gcggaagagcagcatccggctttgtcccgtcgccttcctcgccgtaggag
aaggaggcggggcaaccgtggccaagcaggaggcggcacctcgtcggctg
tcgagcgagtcgacgacgctggcgccccagcgggggacatgtcgggcgtt
gacctcgcgcctgagacgaagacgagcgtcgtttccccgcaacacaccaa
ccccaagcggacagatgacgccagcacgctcgcgatgggcctgctgggcg
ttagcctcgtacctgagataacggtgcagtccgtccccgacgcgacttcg
tcaccatccatcgatcgagaggtaccatccgttttccaccctgtgccttt
tagattcagcttcgatccaccaagcgatcccgcttcggtgagcgctttca
taaaggcatatcctaaccttccagggtaccatatgtggtcgacctgggac
cgactaatggccgtttcgacctacgggccctcgggctccgaggaagacga
cgagcccgactctggtttggatttcttcgggctcggtaatcctagcgcca
tgcgagacttcatgaccgcatgtgactactgattctccgattgttccgat
gatggccacagccttgacgacgaaggttgtggcccaagtagcgaatgctt
ccacgtcgatctagggggtcacaacgaaggcaaccacctgggtatgccgg
aggacgatgatccccctgggcctgcgcctcgcgttgacatccttcgggaa
ctagctgtggtcccagtccctgcggggggtcaggacacacagctcgagca
aatccacgagatacaggccaagctcgacgaggaagcaggacaacttgtgc
agctccggcaaaacatcggacaggagtgggtaggccgagcactagccgga
gaagcgcgtcatcaggcccaggacatccagcgccgtatcactgacgatgc
caggacaaggctgcccccccgcttccagtggggtcggtcagaatctgtct
gcttgggcaatactactcctagcgacgtcggattctttcccctccgaggg
gttgtgtatctccggagaactcagatcnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnncctagctgccttggtgctataaa
agggacccctaggcgcatggagcaggacaccaagcattcactaagcatac
taagactcctagactccacctccatgcattcgatcgatcgtgttagtgat
ttgagctccgtttgagttgtgaactctttgtgctgtgtttcgagctcaag
tcttggcttgtgtgcgtgtgtgtgctacggatttgagtcttacgtgtgtt
actctccctcacttactactgtgcttctcttgtgataaacttgtaagggc
gagaggctccaatctgtggagattcctcgctaacgggagaaagattacta
aggaagatagttgtggtactcaaagttgatcattagatcacttgagaggg
attgagtgcaatccttgaccgaaggaggtcaccacaacgtggaagtaggc
attggccgaaccacatgataaatcactgtgtcttgtgtccatcttatttg
tgattggctttttttcttgaattcacactttaacaacttggttttaattg
cactaacatttcataaccaagtgttggctatttagtgctctcaaatacac
catactaggcattcatctacgcatgatgaatggtgatgctaaggggatga
cagaagatgaagttgtattaaagaaatacctaaaccatgcctcgagctga
ctcaacaggacccaccaagcaccgccacgtctaaatcagagcagctacag
ggacccatcggaaggcggacgagatgcaacaccacaacagaggtacgaca
aagcacaacccagcagtcgactccataggggctacgaggcccagaagcat
gaggccgaattccaccccagtagaataatacaagttctcattgtaacgtc
tacccttgagctataaaaagggcaagacaacccccatagaaagaagatct
cacaacttcacacaagcatccaactgtaacacgctccaagcaatactact
atcagcactacactggactagggctctggcatgaaccagtataacccatt
cgtctcagatccacctttgaacccccgtagcttaccattcggagtgagtc
cgcactaacacccctgccgaacacaaatcttattgtcccccagttccaga
aaccacgacacctcccctacctgtcttgccagctatcggaatttggttct
gatggtgcactatatgatgtaccacgtagtgcttttgggtggtgggcgga
gtcgattgcagcttgatggtttgtgtggggcatgatgaaaggcagagaat
tatataggtttgggccagtagagcttgtaacaccctacatcttgtgtgct
ggtggagttgtattgcttagtgatcttggttacagagtggcctagagctt
gaagatgactatgtctaccgagggatctcgacttttcgtaggggtgccct
tgctgccttatgctaatagaattagagttacacacgaccctctgatcatt
accagtctgtccttatcaacaaaactggctccatcttatccgagagtcaa
cgagtcttcatgaagcatgtcatgtcctttgcatgcattggattcggttc
attcgcctttgtgcccatgtaactgccatcctcgcctacttctggtcgcg
cttagctaaccggtttgtaaatcctagaagcccagcccattgatgcctct
atgatggcccatatattgtaatcgggtcatggcgacctgggggatattta
tccaccataggtggtcagtagcaaaatgctgattgtctcctccgtcgatg
atgaatccaacgacgcagtcaagctagtcgatgatgaagaggaggcagta
tgatgtactagtggtggtggcgggcagtctgcttcacgtgaggcagcacg
acggcgacacaacccgactagtggcaaaggagctccagaagagagaaaag
ctgagatgatggcggaggtggcgaacgcgaaagcggatgcaaaaaagaga
gcaaaagaaatcatatagcccctattcctcccctttttataatcacaggt
gccttgaaactcgaaaaagctacacaatgaaacatcaccaatcaatcagc
ctcatctcaatgatcacctcatgaaccaccttgagagcaggtcaactcgc
gattgagggcagcattcgaccatcttattgaagggactttgggacctgct
caccaagttgaactactccctcgagggatattgttgggatgaaggccgaa
ccagacctcgatctccgcagcgtgggaatgacaacctcaagttagaacta
accatgtctaagtacaggactaggcacgacggggatcttcaccaagtcca
ccctgcccaaggtgtcctcatgtggagcgctcaacaaataccacataaag
gcaggcgtgtgcacacgtggactcatcaaaggcaaatcatttgccgcacc
ctctgatcgagggccataaccgtagcgaacaaagaggggttgtagccttc
atcatcagtggatcgtctgctctatccaagataccttagatcatcgagac
cttgctaggaccaagtaatctaccctacggaaggattacaatagtccaac
taggcccactcgttagcctaccagtagagacgcaccctgatgtacttggt
tttaaagcgttattgtattgtaattaccctgtagcactgcatatactaag
gatgtggtaggtaactgggggcaaaatggtatttaggttcaccaaccctc
ggttgccctataaatatcccagactataactgatgggacacgttggacaa
gacgctacagctacctacctaacattttggcgagcatcatgtttatctcc
tgctctcgagtgttgggatccacctgttggacccaacaaaagtcaaacat
tgcttattttagagtatttgattgcaaatgcttcattctcaagaaaggca
caataataagcatgtgaaagcatccaaacatgagatttatctagaaatct
ttgccacataatgagcaagctcacctccccaaccactccacctcgccttg
tgtagatttagggttgttatgtttggatatatacacgcaatcattttcag
aagagattgactagcccatcctcaatgctaacctcgatccgtgtgaaaat
attaggatattcatggtgtgagagggaattaggcttacacctagttccta
aataattttggtggttgaattgaccaacacaaacaattggactaactagt
ttgctctagtgtataagttatacaggtgtcaaaggttcacaacaagccaa
ttaaaaagaccaaagttgggttcaaaatagagagctaaaggcatcccgag
aggctccctggtctggtgcaccggactgtccggtggcgcaccggacagtg
tccggtgcaccaggggacctcacgcagaactcctcagcctcgggaatttt
cagaagccggcgcgctataattcaccggactgtccggtgtacaccggaca
gtgtccggtgctccaagaagacgcggctctagaacttggcagcctcggga
aatcataacggctgcttcgctataattcacccggacaagtccggtgtaca
tcggactgtccggtgtaacagcagggcaacggctactttnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgctcttctgg
atgatatcagcttgattcgtctggatggtttagtccaggggattttgttc
taatattgaaagtccttgctccttttggagaggatgcgctttgcaaaaac
aaaaaagtttttcaaaacaaccctgcataaaatattgctgtttctgcaaa
atatcctgagctccacatattccatgcattatatctgatttccccattcc
gcgggtgaaggtgggctgctgagtacgtttgtactcacccttgcttattt
gttgttttttagaaaaaggagatcaggtaagagttacgactgttcccaac
cttgcctatggctgttggaccgctgatttgcttcactgcgtatatcgggc
tgcttcagccccactctgatgatatgtcccgagttgtggaccaactctta
aagttgttcgccacctttataggtttatcatgtttaagcagatctggaat
catctgatgtataaatgtgtttactagcctcctgggactagtaattgtat
cacatttgagtcccagaggatcgggacgcttcagcaacccaagaacacga
atgccgccctagcggcgtgcgacgtcttgggcgatccccaggtgcgcacg
gcgcaacagccgcccgtacggcgggcagacagccacactccgccccagcg
gtggggaggtggcaccggaagctgcgccagggccagctgagccagcgagc
caggcatgctggagctgacgacgcttgcggccgatcggccccgtgttgtc
gaagtccgccccctccgctaggctagtgagcgccctctcccctgaatgct
gaaggaagaggtggcccaccggcccatacgggaggtagagctccggctca
gctcgcccccagccccagcaaggatgatgaagatccttgaagctgagagc
ggggcagaggccgtagcccggcttgcttctccccaccatcgagctggtgg
tcaccatcatgggtgaccatcgatgagggaatgcagtcgggctgcctgat
gaaaatccttgaagtcgagcgatggctgaagggtgccgacctccgtaagg
ttgcgctcctccaacaacaagacgaagggaacgcgggcgctccccatccg
ggggctcagaaggtggaaggatgcgatgcatgagggaagtgcgaagacat
ggctaccacccggggggtcgatccctttttaaaggcggctctccccactc
gcgtcctcaggcgtcgtggactaagtcttcactgacgtaccctagggtcc
tccccctacgacgcgagggctgggtcccacgcgtcatgcaagctggcctg
ggacagaagaagccagaccaccgcgcgtggagcgtgtgaccgctccgcgg
ttacaagcactcctccatcctcgccgaaaccaatggttgaaagggcagac
cgccatgcaggcggcatgcaaccgcacacggagacgcaccccttcaactt
cgacgcatccagcgtggaggcctaggcccacacgtcatgtaaccggtgcg
ccggttactacatgcgaaaaactgcaccgccacttgcgccaataccgtgc
cttcttgactacggaaccggtgacgcgactcgaggcaaccctgcgcatgg
cccaacagtgccaaccgagcacatcagtcacgggtcagtcagccgcggga
gaaggcgcgacggtcgatatggccaaaagtgggccggcagtaatggcggc
agcaggcgagcgaaagcggcggtcaaatcgtctgcaggctcacgtcttct
cctggagcagcaggggagccctctcccacgacgtgaagacgatgcgcccg
tgttccgtccctcgaacggctcgcacaatggctgccccgcgaaccaccgg
tcccgtcgcattaacttcgcggcagggtaggcgacacctttggcaggcga
agcgagcgacgtttcacctccgccatgatgaccacgtcaaaaaaggtgtg
ccacaccgtttaatttcgtatccttttcctcttcccctttctctctctct
ctttctacagggaccggaaaggggatattttgaaagggatccttctccgc
gaaggaagcgggccccgagccctcctactgatcaagggttcgaaggctgg
cctctcggaagggtttgacagccgccccagagcactcgggctttaggctc
attactgatcagaggttcgaaggctggcccctcggaagggttcgacagcc
gcctcagagcactcgggctccgcgcccactactgatcaggggttcgaagg
ctggcccctcgaagggttcgacagccgccccagagcacgcagagcgaggg
atgactctgggtacgtccgatacatggccgaggttcgggctacgctcccg
aggtaccctaggacatttccgagaccagcaggagcgattttgttacggaa
tcccatcagagggaggcatcgagccctcggaccctaccaaacgggaccgg
gtccagcaaatcacctgcaggtacttttggagcgtgcctctgggccacta
gctgacccttatcgaacggggcacgggcgtccactcggatcacccgttag
caactcactggagacaccatgttcggcgccctccaagggcaacatggcgc
tttccccccctcctccttgcgaaaaggcgacgaaggggcatatgataaaa
gccgagtcagtccttgatcgtcctctcactctgtgcagaggctcgggggc
tgctctcgcaaacccggctctggccaaaccgttgacagcgtcaacaaacc
agcccgagaactcggaaactgaccatgcacccgggctacgatcagatcgc
atgagggaacaaccagaccggccgaggcatcacaaaaggcattaagacct
cggaggagtcaaaccactcctccgaggcctcgggggctacacccggcggg
tgcgctcgcgcgcacccaccggaacaaaatgtacccgagaaaggccggcc
cccttgcaaaaaagtgcgacaaagcctccaagcgagtaccagcactccct
ttgaggctcggggttactgtcgggtaccataattaggggtaccccaagac
tcctaaactcggctggtaatcaccatcagcgcaaactgcagaggctgatg
ggcgcaattcaggtcaaggctctgtccactcaagggacgcgatctcgcct
cgctcgagcctaacctcaggtaggaacagtagacctaggtggattcacgc
ctcgcctgagggcctcctcaaagcaacgggcgcacccctgactcgcccga
ggccccagctcgggtaggcttcgccgtgaagcaaccttggccaaatcgcc
tcgccaaccgaccgtatcgcaggagcattcaatgcaaggatcgcctgaca
ccttatcctgatgcatgttcctcagtcgacagggccgaagtgaccgcagt
cacttcgcccctccactgactgacctgacaggaaaacagcgccgcctgcc
ccgccccgactgctatgccacctgccaagatgagactgacagcagctgag
tccagcctcgggcgccacaggaagctccgcctcgcccaaccttgggcccc
ggcctcaggagaagtctccgcctcgctcgaccccagggctcggcccccgc
ctcggcctcgaaagatggactccgcctcgcccgaccccagggctcggcct
cgacctcgacctcggaggacggtttccgcctcgcccgacctcatggctcg
acctcggccccgacctcagaaggaatcgcgtcctcacccaaccccgacct
cggcctcaggaggagtttccgcctcgcccgaccttgggctcggaccgacc
acgccataggggggatcatcattaccctacccctagctagctcaggctac
ggggaacaagaccggcgtcccatctgtctcgccccggtaaacaagtaatg
atggcaccccgcgtgcgcccattgatagtcgcctagagggggggtgaata
gggcgaaactgaaatttacaaatataaacacaactacaagccgagttagc
gttagaaataaaatcgagtccgcgagagagggcacaaaacaaatcgcaag
caaatgaggagtgtgacacgtggatttgttttaccgaggttcggttctcg
caaacctactccccgttgaggaggccacaaaggccgggtctctttcaacc
cttccctctctcaaacgatccctcagatcgagtgagctttctcttctcaa
tcacttggaacacaaagttcccacaaggaccaccacaagtttggtgtctc
ttgcctcaattacaagtgagttttgattgcaatgaaagaatcaagaaaga
agaaagcaatccaagcgcaagagctcgaaagaacacaagcaaatctctct
ctctagttactagggcgttgtgtggaatttggagaggatttgatctcttt
tgtgtgtcctgaattgaatgctagagctcttgtagtagttgggaagtgga
aaacgaatcaagctgattcatcagaaaatannnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnncactgtgttgtgtctgttca
tggtttcaactcaataaattaataactgctggtttatgatacgctggtgg
tttcgctttacatcattgttagattgaaaaagggcctgtggcgaatttat
gtcggcctaaaacaaccattgtaaataaggtttagaccctcataaataat
tattacatctgtttagacttatttattacattggcttaccgtcataaata
agtaatctgcgtcgatcacagttagccgaagtaaaaaactaattcacgac
ggtcgggtagaaacgtaaattacgatagtttgatagccgacataaataaa
ccagacttatttccgataggttttggcaaccgacgtagacgattcggtag
cgatgtaaatgtgtcaatcgcctacccacagaatttttattttttattag
tcggttacccgtgcgttccgacggcttacaacgatactgaaagggaaata
gggttaaacttttcctataattaattttggtggtttaatgtccaacacaa
atattggactaactagtttgctctagattatatactctacatgtgcataa
aggttcaacacaaaccaataaaaaattgaagatagagttcaaatacaaag
gagcaagaaaccgagtgtgccctggtctggcgcaccggactgtccggtat
gccaccggacagtgttcggtgcaccaggaccgtacaatcccaaaccagtc
actctcgggttttcgccagcacgctccgctataattcaccggactgtccg
gtgtgcacatgtagctaggcttgagtcaattcgtatattacttgtctatg
ctacttaccatgactttaagctttatcaaatggacgtgagaagtgacttc
ctcaatagaccaatcaaagaagaggtctatgttgagcaacctcccggttt
tgaagacaatgggtaccctaaccatgtgtataaactctcaaaggcgcttt
ataggtgtgggggacagatatcccccgggtccactggaagagtaaaagac
ctcacgaaaggcccaagggcccagtagatcgtaaggtcattctttcgtgg
gcctggggagggacaatcagcaaagcaggttgatatgaggccgaattggt
gcaagcccggacggcccacaacgttgaacaagcgatcacaacagagatcc
gactttcccgcgctggagcccccatgcaacggagccatgcgaggataggt
cggaggaactatagggagataaactcaaacagttcactatcttttagtta
cacatagttatcatatccacgtgtaatgccccacggtcggatatataagg
cctagggggcaccccttcagaacgatcgaccctattactcagccacccac
ctcaactctctgcattctcaattcagagagctgccttgtaacttcattca
ccaagcatactccctaggacgtagggtgttacgcatctctaagcggctcg
aacctgtaaacattgtccactgtccctcgtgcatctggcacgaaccattt
tgctacagtcggcgacaccgtcctactcctaaaaacaccttaaggggcaa
ccccgagtgtgcggtcggacctaaaacaccgacagctggcgcgccaggta
gggggtgtgtcgatgatccaagctagctcaatgtccgtcaccttccacaa
caagatcactctccgtcccggatccgtattctgcttcggaacaatctcgt
ccgtagcagatgaagagggaattctacaccgcattaaagatccgccgaaa
aagaagtctcctccaacaaactccgaaaatgtcggagaggcacaaccttc
agctctccggaaaaagatcgccttcagaaagtcaggggctgagagcccgc
tgacccggagaactccactgtctacttccccgacaaaagaatggacacag
atcgcgaggaagaaggagaccaaggggaagcaagttgttctttccgttcc
tccgccctcaaaggagaacggaaagaaggacgccacgacagcaactccat
tctatcccgacgtcctcttcatcgggagagtggagtcgcctcccgtctcc
gacgacgagccgaccgcacccggagaagaaccacctcaacgagaatcccg
acgacggagaaaccggcgccggaacgttcggcgacatcacgtggccggag
aacgggatccggagcaacctgtctcgcgggacgaggtctcggagatagga
gaaactccggaggaacgcgtcttcagagaacgaacgaacacccgacgacg
tgatcgtcgccggactcaagaacaagctgagcaagacgcaagacaacgcc
gggagaatccactcttcgggcgcaacctgaatcccgacttcgcccttgcc
atgaacacgccgagtgaagttgggggagtactagctcggatagctgacgg
actcccttggactcccgacgccgagggctaccgacgcctgttcacccann
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntg
ttctggtgcgccaccggatcagtccggtgcgccagaccagggagcctctc
aggatgcctttagctctctatttgaaccccaactttggtctttttaattg
gcttgttgtgaacctttgacacctgtataacttatacactagagcaaact
agttagtccaattgtttgtgttggtcaattcaaccaccaaaattatttag
gaactaggtgtaagcctaattccctctcaatctccccctttttggtgatt
gatgccaacacaaaccaaagcaaatatagaagtgcataattgaactagtt
tgcataatgtaagtgctaaggttgcttgaaattgagcaaatattaatact
tacaagatatgcatggattgtttctttgtttttagcattttggaccacgt
ttgctccacatgttttgtttttgcaaattcttttgtaaatccttttcaaa
gttcttttgcaaatagtaaaaggtaaatgaataagattttacgaagcatt
tgcaagatttgaaattttctccccctgttccaaatgcttttcctttgact
aaacaaaaccccccctaaatgagattctcctcttagtgttcaagagggtt
ttgatatatcatttttgaaatactactttctcccccttttgaacacaata
agataccaatttgaaatttaccaattgaaagtctccaattttaaaattag
gtggtggtgcggtccttttgctttgggctcatactttctccccctttggc
atgaatcgccaaaaacagaatcattagagccctcggagtgctttcttccc
ctttggtcataaataaatgagtgaagattataccaaagacgaagtccttt
tgctctctccctcaaagatggagagtgacatggagcgacggcgaaggatg
agttacggagtggaagcctttgtctttgccgaagactccaattccctttc
aatacacttatgacttggtttgaaatagacttgaaaaaacacattagtca
tagcatatgaaagagatatgatcaaaggtatataaatgagctatgtgtgc
aaatcaacaaaagaagttcctagaatcaagaatatttagctcatgcctaa
gtttgttaaaagtttgttcatcaagtggcttggtaaagatatcggctaat
tgatctttagtattaatgtaagaaatctcgatatctcccttttgttggtg
atcccttaaaaagtgataccgaatggctatgtgtttagtgcggctatgct
cgacgggattatccgccatcttgattgcactctcattatcacatagcaaa
gggactttggtcaatttgtaaccgtagtcccgcagggtttgcctcatcca
aagcaattgcgcgcaacaatggcctgcggcaatgtactcagcttcggcgg
tggaaagagcgaccgaattttgcttctttgaagcccaagacaccaaggat
cttcccaagaactggcaagtccccgatgtgctcttcctattgattttgca
ccccgcccaatcggcatccgaataaccaatcaaatcaaaagtggatcccc
taggataccaaagcccaaacttaggagtataagccaaatatctcaagatt
cgttttacggccgtaaggtgagctttcttagggtcggcttggaatcttgc
acacatgcatacggaaagcataatatccggtcgagatgcacataaatagt
gtaaagaacctatcatcgaccggtataccttttgatccacggacttacct
cccgtgtcgagatcgagatgcccattagttcccatgggtgtcttgatggg
cttggcatccttcatcccaaacttgttgagaatgtcttgagtgtacttcg
tttggctaatgaaggtgccctcttggagttgcttcacttgaaatcccaag
aagtacttcaactcccccatcatagacatctcgaacttttgtgtcatgat
cctactaaattcttcacatgtagactcgttagtagacccaaatataatat
catcaacataaatttggcatacaaacaagtcattttcaatagttttagtg
aatagagtaggatcggcctttccgactttgaattcattagtgatgagaaa
atccctaaggcattcataccatgctcttggggcttgcttgagcccataaa
gcgccttagagagtttgtaaacatggttagggtacgtactatcttcaaag
ccgggaggttgctcaacatagacctcttccttgattggtccattgaggaa
ggcactcttcacgtccatttggtaaagcttgaagccatggtaagtagcat
aggctaataatatgcgaattgactcaagcctagctacgggtgcataggtt
tcaccgaaatccaaacctttgacttgggagtatcctttggccacaagtcg
agctttgttccttgtcagcacaccatgctcatcttgcttgttgcggaaga
cccatttggttcctacaacattttggttaggacgtggaactaagtgccat
acctcattcctagtgaagttgttgagctcctcttgcatcgccaccaccca
atctgaatcttggagagcttcctctaccctgtgtgactcaatagaggaaa
caaaagagtaatgctcacaaaaatgtgcaacacgagatctagtagttacc
cccttatgtatgtcgccgaggatggtgtcgacggggtgatctcgttggat
tgcttggtggattcttgggtgtggcggcctttgttcttcatcctccttgt
cttgatcatttgtatctcccccttgatcattgccgtcatcttgaggtggc
tcatttgcttgatcttctatttcatcaacttgagcttcaacctcattttg
agtcggtggagatgcttgcgtggaggaggacggttgatcttgtgcatttg
gaggctcttcggattccttaggacacacatccccaatggacatgttcctt
agcgcgatgcatggagcctcttcattacctatatcatcaagatcaacttg
ctctacttgagagccgttagtctcatcaaacacaacgtcacaagaaactt
caacttgtccagtggacttgttaaagactctatatgccctcgtgtttgaa
tcatatcctagtaaaaagccttctacagtcttaggagcaaatttagattt
tctacctcttttaacaagaataaagcatttgctaccaaagactctaaaat
atgaaatgttgggctttttaccgattaggagctcataagatgtcttcttg
aggattcggtgtagatataaccggttgatggcgtagcaagcggtgttgac
cgcctcggcccaaaaccgatccgaagttttgtactcatcaagcatggttc
tagccatgtccaatagagttcgattcttcctctccactacaccattttgt
tgtggtgtgtagggagaagagaactcatgcttgatgccctcctcctcaag
gaagccttcgatttgagagttcttgaactccgtcccgttgtcgcttctaa
ttttcttgatccttaagccgaactcattttgagcccatctcaagaatccc
tttaaggtctcttaggtttgagatttttcctgcaaaaagaatacccaagt
gaagcgagaataatcatccactattacaagacaatacttactcccgccga
tgcttatgtaagcaatcgggctaaatagatccatgtggagtagctcaagc
ggcctgtcggtcgtcatgatgttcttgtgtggatgatgggcaccaacttg
ctttcctgcttggcatgcgctacaaaccctgtctttctcaaaatgaacat
ttgttagtcctaaaatgtgttctccctttagaagtttgtgaagattcttc
atcccaacatgtgctagtcggcgatgccagagccagcccatgttagtctt
agcaattaagcaagtgtcgagttcagctctatcaaaatctactaagtata
gctgaccctctaacactcccttaaatgctattgaatcattacttcttcta
aagacagtgacacctacatcagtgaaaagacagttgtagcccattttgca
taattgagatacagaaagcaaattgtagtctaatgaatctacaagaaaaa
cattggaaatagaatggtcaggagatatagctattttaccaagacctttg
accaaaccttgatttccatccccgaatgtgatagctcgttggggatcttg
gtttttctcgtaggaggagaacattttcttctccccagtcatgtggtttg
tgcacccgctgtcgagtatccaacttgagcccccgaatgcataaacctac
aaaacaattttagttcttgactttaggtacccaaacggttttgggtcctt
tggcattagaaacaagaactttgggaacccaaacacaagttttagagctc
ttgtgtttgccccccaacatacttggcaacgaccttgccggatttgttag
tcaaaacatatgatgcatcaaaagttttaaaagaaatgtcatgctcattt
gatgcactaggagttttcttcttaggcaacttagcacgggttggttgcct
agaactagatgtctcacccttatacataaaggcatgattagggctagagt
gagacttcctagaatgaattctcctaattttgctttcgggataaccggca
gggtataaaatgtaacccctcgttatcctgaggcacgggagccttgccct
taacaaagtttgacaatttcttaggaggggcactaattttgacattgtct
cccctttggaagccgatgtcatccttaatgcgagggcgtctcccactata
tagcatacttctagcaaatttaaatttttcattttctaagttatgctcgg
caattttagcatctaattttgctatatgatcattttgttgtttaattaaa
gtcatgtgatcatgaatagcattaacatcaacatctctacatctagtaca
tatagatacatgctcaacgatagatgtagagggtttgcaagattttaatt
ctacaaccttagcatgtaacatgtcattcttagttctaaggtcggaaata
gtagcattgcaaacatcaaaatctttagccttagcaagcaatttttcatt
ttcaatcctaaggctagcaagtgaaatgttcaattcttcaatcctagcaa
gtaaattatcattatcatctctagaattggaagttgaaacattacaaaca
tgagaatcaaccttatctaataaattagcattttcatttctaaggttggc
aatagtgtcatggcatgtgcttagctcactagatagtttttgacattttt
ctatttctagagcataagcacttttaaccttaacatgttttttattttct
ttaattaggaagtcctcttgggaatccaaaaggtcatccttttcatgaat
ggtactaattaattcatttaatttttccttttgttccatgttaaggttag
caaaaagggtacgcaaattatcttcctcatcactagcattatcatcacta
gaggactcatatctagtggaggatttagatttaaccttcttctttttgcc
gtcctttgccatgaggcacttgtggccgacgttggggaagaggagtccct
tggtgacggcgatgttggcggcgtcctcgtcgtcggaggagtcggtggag
ctctcgtcggagtcccactcgcggcacacgtgggcatcgccgcccctctt
cttgtggtacctcttcttttctctcctcttgcccttcttatcgttatccc
tgtcactatcacttgataatggacatttagcaataaagtgaccgggctta
ccacacttgtagcaaaccttcttggaacaggatttgtaatccttcccctt
ctgttgcttgaggatttggcgaaagcttttgatgattaaagccatctcct
cattgtcgagctttgaagcgtcgattggttgtctacttggtgtagactcc
tccttcttctcctccgtcgccttgaaagccacgggttgtgcttcggacgt
ggagggatcatcaagctcgttgatcttctttgagccccttgatcatacat
tcaaagctcacaaaaattcccgataacttcctcggggggtcattaatgta
tatctagggattaccacgaattaattaaacttaagtggggttaaggaaga
tgagtgatataagaataaccttaaccacctcgtgatcatcccatttcttg
ctcccgaggttgcgcacttggctcaccaaggttttgagccggttgtacat
atcttgtggctcctccccttggcgaagatgaaagcaaccgagctccccct
cgatcgtttcccgcttggtgatcttggtgagttcatcaccctcgtgtgcg
gtcttgagtagatcccaaatctccttcgcattcttcagcccttgcacctt
gttatattcctctctacttagagaggcgagaagttttttgtggcttggga
gttgaagtgctcgatttgggctacctcatcctcatcatagtcttcatccc
ctatttgatggtacctgtgcaccaaactcaacaacatcccatatgctttt
gtggagtgaggttaaatgaaatcgcattaaatcactccacctagcgtaat
cttcaccatcaaatgttggtggtttgccaaatgggacggaaagtaacggt
gtatgtttagaaatgcgagggtagcgtagggggatcttactatacttctt
gcgctcttggcgcttagaagtgacagatgccgcgtcggagccggaggtgg
aggttgatgaagaatcggtctcgtagtagaccactttcctcatcctcttt
ttcttgtccccactccgttgcggcttgtgggaggaagacttctccttctt
ctctttgtgtgaagaagatttcttctccttccctttggaggagtctttct
tcctcttggtgcgggactcttccgatgaagtgctcccgtggcttgtagtg
ggcttttcgccggtctccatctccttcttggcgtgatctcccgacatcac
ttcgagcggttaggctctaatgaagcaccgagctctgataccaattgata
gtcgcctagagggggggtgaatagggcgaaactgaaatttacaaatataa
acacaactacaagccgggttagcgttagaaataaaaacaagtccgcgaga
gagggtgcaaaacaaatcacaagcaaataaggagtgtgacacaaggattt
gttttaccgaggttcggttttcgcaaacctactccccgttgaggtggtca
caaagaccgggtctctttcaaccctttccctctctcaaacggtccccgga
ccgagggacgaatctctagaatcgcctannnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnaagcttccaagaaatccatcgc
ccaggagttagaaactgcccggttggctgccaaggttgctgaagaaactt
ccgttactctccgagcccagcgcgacagagccatggataaggccattcgg
gcggggcgaattttgatgaggagacccggcgtggttgttcccgaagatat
aagggctgacgtgaatgctgcccctgattcctcgagtcgcccttcctcat
cgattgctcctgagaaaaatatcacaaaatagagaaacattttgcgtgct
ttgagcgtgcggttagcatggtcagacatttgttagaggatgtcatttca
gtacttgaacgacattgttattctcatattgtttcagagttcatcagttc
gtaaatttgcagtagtaaaatgatgtgcgatggttttgaaatttgtttgc
gggatatagaagtcatccttatatgagtaattgtaagttcgtcagattgc
cttaagtcgctgctagcttaagtcgattgcttctgttaatagggcgcagt
ggtcaccctgaattgcgtaggcgcgagcatgttgcaccggcttaagttgc
tactgactttagccgattgctccgttagcagggcatagtggtcaccccaa
gttaagtaagcgcgagcatgttgcaccgccttaagtcgttgccgacttaa
gccgattgctccgttagcagggcatagtggtcaccccgagttaagtaagc
gcgagcatgttgcaccgccttaaatcgttgccgacttaagccgattgctc
cgttagcagggcatagtggtcaccccgagttaagtaagcacgagcatgtt
gcaccgccttaagtcgttgccgacttaagccgattgctccgttagcaggg
catagtggtcaccccgagttaagtaagcgcgagcatgttgcaccgcctta
agtcgttgccgacttaagccgattgctccgttagcagggcatagtggtca
ccccaagttaagtaagcgcgagcatgttgcaccgccttaagtcgttgccg
acttaagccgattgctccgttagcagggtatagtggtcaccccgagttaa
gtaagcgcaagcatgttgcaccgccttaaatcattgctgacttaagctga
ttgctctgttagcagggcatagtggtcaccccgagttaagtaagcgcgag
catgttgcaccgccttaagtcgttgccgacttaagccgattgctccgtta
gcagggcatagtggtcaccccgagttaagtaagcgcgagcatgttgcacc
gccttaagtcgttgccgacttaagccgattgctccgttagcagggcatag
tggtcaccctgagttaagtaagaatgcaagtcaatcatgaacaaactgag
tatctttgaagcccttttttattgatgacatatttccattttacagagta
catcgtcgtcccgatagcttttgaaatacagctagggatagaatttcctg
aggtgttctatattccaggagttcccgacttctgtgtcgaccatctgagt
gagacgatatgatcctggccgagtgacttctgctactacgaagggtcctt
cccataagggtgataacttgtgccgtccctcccccgttagaattcggcgg
aggacgagatctcctactgagaaggatcgctgccgtacggccttgtcgtg
atagcgccttagagtctgctggtatcgtgctgattggattactgcattca
gccgttcttcctcgagtacatcaatgtcctctagcctggtggcttcgact
tctgctatgctttcgaagatcaaccttggcgccccgaatttgagatcggc
gggtaacactgcctccgacccatagaccatgaagaaaggagtgtttccat
gcagagctcggctaggttgggttcttaggctccagacgacatagggcaat
tcccttatccattttcctgcgaacttttcattcttatcgaagacattttt
cctgagtgcctccagtatcatcctgttggctcgctcaacttgcccgttgg
ctcttggatgtgctacagaagcatacttgatctgaatgcttttttgctcg
cagaagtcgaagaactctgaacttgtgaagttggatcctaggtcagttat
gatgctgtttggtatcccgaatctgaatattatgtcttatatgaattcca
cggccttagatgaggtcaatgaggcaatgggtttgaattctatccattta
gtgaatttgtcgattgctaccagtacatgagtgtatcctccttgagcctt
cttgaaaggtccaatcatatccagtccccagcacgcaaagggccaagtca
ctggtatggtctgcagttgctgtgctagtagatgttgttgttttgacaag
tactggcaagcttcgcacctctgaactaactcggttgcatcactcttcgc
tgttggccaatagaatcctgacctgaaaaccttcccgactagtgtcttgg
acgccgcatgtattccacattgcccggcatggacctcctccagaagttgc
ttccccgtagatgagagaatgcatttcatgagtacgcctgatgcacccca
tttgtataatgtctccccaatgagtgtgtagtgagccgactatcgggcaa
tgcgctcggctgaatttttgtcatctggttcctcttcattctttatatac
ctgatgattggcattctccagtcatcagagtctgactcgggttgatctat
aatattacactcttctgcttgatccattgagatgctcggctgtagtattt
cttgcataaagattccaggtgggacctgagttcgactggatcctagcttg
gacaatacatcggctgccgtgttccgatctctttctacatgatgaaattc
cagaccctcgaatttatcttccagctttcggacggcagtgcagtactttc
ccattgaatcgcttgaacaatcccactctttgtttatctggctaatgact
accagagagtctccgtacaccatcagtctcttgatgcccaatgatatggc
gatgttcaatctgtggatcagagcttcatactcggttgcattgttggagg
ccggaaacagcaactggagggcatatttgaggtgctcgcctccaggtgcg
gtgaagagaattcctgctcctgctccctgcagcttgagcgagccatcaaa
atacattcgccatacttctgcagtctctgggttatctggtacttgctatt
cagtccactctgatacgaaatcaaccaatgcttgagttttgatggcagtg
cgaggtcgaaattcgatgtcatgagatcccagctcgcaagcccacttagc
tattcggccaatggcttccttgttgtgaagaatatctcctatcggaaaac
cagtaaccactatgactttgtggtcgtcaaagtagtgacgtagcttgcgg
gaagttagaagtactgcatacaatagcttctgaacttgaggatacttttt
cttcgagggacccagaacttcactgatgaagtaaacaggatgttgcactg
ggtaggcatgtccttcttctgctcgctcgactaccaacgcggtgcttacc
acgtgagtcgtgcaagagatatacagcagcagatcttcagctggttgagt
tgacgtggctcatcgtggcggcttcagtactggtggtgttgtcaagaatt
tcttcagtgcatctagagcttcctgtgcctatgaggtccactgaaactta
tccactttcttgagcagcttgtaaaatggcaaacctttttctcccagcct
agatataaatctgctcagagctgccatacatccagtaagtcgatgaacct
tcttttgtgatcgaggtgcttccatcttatccggattagcctcaattccc
cggtggctgacaataaatccgagtaactttcctgctggtaccccaaagac
acatttttcgggattaagcttccatcgatatcgcctcagactgttgaaaa
ccagttgtaagtctccgataaagttttctgaattctctattttgattacc
acatcatctacgtaggcctccacatgcttgccccagtgatcggctaagca
tgtttgaatggctctctgataagtcgctccagcgtttttgaggccgaacg
gcatggaggtataacagaaagcaccaaacggagtgatgaacgctgtattt
tcctcgtcttcctttgccaaactaatctgatggtatccagaatagcgatc
caagaaagacagcacagaacatccagcggtggagtccaccacctgatcta
tcctcgggagcccgaagggatccttcggacagtgtttgttgagatcagta
tagtcgacgcacatgcgccaatccactttattctttttgagtacaagaac
agggttggctaaccactcggggtgtaacacctctctaataaatccagccg
cgaccaaacgagctaactcggcgtgaatggcctctctcttgtcgggcgtg
aaacgacgtagtttttgccgaatcggccttgcctggggatagaccttcag
tttgtgctcgaccagttctcttgggactcccggcatatccgcaggttgcc
atgcgaatacatctcggttatcttgcagaaactggacgagcgcgctttcc
tatttgtcgtccaggctggagctgatgatgacagtcttgtgttcatcagc
gaaccccaggttgatccttttagtttattcagtcggtcgcatagaggtcg
cggcctgagcttcgtttgccggtactgcaaggtcctcctcaggcttagag
ttcgcctgtgttgaagaaatcgtcgatggcttggtggtgagggccgcttg
gatggccactcggaaacactctgcggtgccttggaagtcggcgcgcacag
ttatgattccttgtggtcctggcatctttagtatcatgtacgtgtaatga
ggaatggccatgaatttggccaatccccggcctcccgatgatggcgttgt
acccgcagtcgaagttcgccacttcaaacctcaggaactcggttctgtag
ttctccggagttccgaaggtgacggacatgtagatgtggcccagcgggta
ttccccttcagtcggcacgatgccgaagaagggagtgtccgactcgtgga
gctctttgaggtgaactcccaagccttggagtgtccgggggaaggtgacg
ttgatgctgctccccccgtccaccaacaccttcttcaccctactctctcg
gatcaccggatcgacaaggagcgggtatttgcctgggtggtcgaagttga
gccattgatccgcccgagtgaacgtgatcgggtgctctgaccactggtac
ggggcgagaggaccgatggtcgccactagtatctggcgatcgttgagctt
ttgttgtcttttgttctcctgcgacccgtgttcgccgaagatgacgttga
cctccctgtcaacgcgcgggaaagctcctcctcccccctcctcctgctga
tggggttgtcgtggttcttctggtcctcccctggcggaggaggaggtaga
ggttggaagggtcggccgtgcccgacggagtgcttgaagtcccggcagtt
ccgaagagtgtggcgcatgtccttgtggtacgggcactgggcgtcgagga
tgtcgtccagcgtgcgctcgcctccgcgaggtcctcctcgggtgcgagag
gctggtggtccggcggcgtgtacttcttcgcgaggtctcttctcccagcg
tttgtcgggttgctggttcgcgtcgcgtcgtggtgctgccggcgcgggct
ttactcccccgatgaggtcctgggctcgctcatcggcggtgatgtagagg
tcggcttcccggaacatctcctcggaggtagtcggcgccttctgcaatat
ggctcggacgaaagccgagtcattggatcccctgtagaagtcctcgatca
cggccgtctccgtgacctcggggatacgatttctcatggtctggaacctt
ttaaggtacgaccggagagtttcgtccccccggcgcttgatggatttgag
gtcccatggttgcgccggcttgtcggagagggactggaaattggcggtga
agcgctgactgaagtcgccccagtcgtcgatgcaatgtcggggtagatgt
cgtagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnntagcgattctagagattcgtgatatattagtgcctcttagggacg
gctccggggagctccggctcccagccgaccaacgtccgcagcccatatgc
gcagacgagaaacgctgcagcggcaccggctccgttaattccatgaaatg
cgctctcacagtgaatggctccctcccaagagccgcaagaaagtggctcc
attgctagaggcctagagccaatgcagttagaagagctggagtccgagca
ttttggagccctcccaaacacgctctcagtcgtgctcgcgatcatgaact
gctcgagcctctcacatgattaaatgatgaaactaaacttaacctgtcat
gcattgcattgtgagaattattatttttgatcacttatttatttaggatg
atgtttacttatacctattaactactaataaaattttaaccaacaaaatt
aaatactatgctcagcatcagccatatccttggtaagccttacactatac
ttctcaagccccaaccataagtgagctcatacacactttttctcgcactt
gttgagcgatgaccgtatgagagcttacctttactataatcacatcaggt
caagagtagataccacatgaggaggatcatgaaattgagttcggataagt
ctaagatagagtagaagtcaagaaggccacgtacaaaggaatagaccggc
aaacctaatccacagacaaataaaggtgtaaagaaaataacctcatgagt
atctttggtgggcactgaaattccttcctaaatcctccaaagactcaaat
ttttgggaggaagaacattcatttcgactaggcacaaaagtccagacttg
gtgacagaagtgacacggaaagcgtaaaataatggaaactagttgttatc
atcaaagggggcaatataacctgtcaagtttctgtactcgctggtggccc
tcttccccttcgaggccatcaaagctatcacaatcagtgaatggcagcgg
gagattggaattgaaagcggagacaatggtgaaacggagatagggtttcc
gggaataacaaactattgaaatcgggaatgtcctcaaatcctgatgacgt
cgacacccacgaagccgttttcaattacgtaagttgggacaaaggaactt
ggtcgggggagttaagtcggataaggagaaaaaattgttccaattataaa
gttatgtgatattgtataattaatgttgttactatgtagtagatatttat
acgaaactaacacaacttgaacagagtaaatcggagttaaaacgtgatag
ttatggattaaacaagtgtctggaattatttttatacatataaatcagat
ttcatatttaattttattaaaaccaaacgcttatgtatagcgggttggat
ttacgaagattgcagggttcagattataaaaacattaaaacagggacctg
tatgagacgttcttttatcatggctggactacaggtaggttagcaaaaat
cctagggactatttagcaaaacgatttgacagaaggggtacggtttagtc
ctgcccgcccgatcttctaccaacgacccaaattagatcatcgaggcgtg
atgcagtatttagtttgtatccattggatccagaattgtaacacccactt
tgtaagaaagatctaaaaaaagagaaataatattactctgtagctataag
tgttaccaatatttatcatttcgtgtggacacattacttacacaaataca
taaacaccaaaagatacccaaaaacaacttatgcatcatgctgggtctta
ctttgtgtgcattctaggatgataaaaaaatatggtaaaaaaataataat
aagtgtgttaatactccaataggaaaactaaatcctaaaagaaattctaa
agtttggaaaaggaagaaagggaatactatgtgacaaaaaaatatagaat
aaaatatatacaataaaatatattatttctaccttaagatttgaatttgt
acatttactcaaaggtgaaattcatacaaggtctcaaattcaaatattgg
aattcaaaattaaagaaggaaggagaaaagaaaaagaaaagaaagaaata
gagaaactgcgcatttgggcccaaactcctttcggcccaaaaccccccag
ccgcgcggctgcgcactccacgcgtgctacagccgtcctgccgcgcgggc
cctcttgtcggccatccaaactgtgtgccatctcgccccgcgcgtgcgtc
acttgatggcggggcccacgtgacagcctcctcccctcttcctcctccgt
tcaccgcagctggtgctgttgggattgaacgagatctccgcctaccagct
tctacgaaatttctagcctcctcttccgcgcacaacaacccgacgccttc
accgcagattccgccgcagctcctgcatgtccacctgctcggtctcagcc
agagtataaagtcgtccgtcttcatctccttcgccaccagaacccaagcg
ccgccgccacaacaaggatgtggtgaagagaatccgggcggcctccatcg
aactagcacctcgacgacgcccggggatcgatctagtggtcgcgggggat
cgcctgcactcaccgcgcgtgttgatggccatcccaggcgtggggatcct
agtgggctctttggattgctcaccggggttctggcacaactacaaacccg
cgcgccactgttggcctacatcctcgttacctcttcaccatggtgaatcg
cttcgggtgatcgccggagagcctgcatcgtgtgcaagagagtggctggg
cacgggagatctctggatgctgccaattgctcgacggggcaaggatgccg
ccgaggcgccacaccatcacatgtcctgcaataatgagtctgctgctggc
ggtaaggtatgatttgatgaagtctgtcgttgagtgcgcatcatgtagag
cttctggaggcagggattaacgctcggggatggaatgaatcgctcaccgc
cgcgcatccgccaaactacgtggggcggttcgtccattgccggaatcgag
gtaagaattcctccgttgaggtctctatcatctcggcaacgcatagggct
tttggatcaaaggatttgtacgtgtgtgcgcgattggggttcaccggtgg
gatctccgccgtcgggcctgtgggcgccgccgtccctggccgtcgggagg
ttgagggcagtgcgatggtcgttggattagaatgaacggctaggattaga
aggcatataccctttcggattaattgaatctgtgccctcaattgtcaatc
gtacggcctgcactgattatgggctcgggatcgatctaggccatcagatc
tcgatccagtggcccatggcgcgtaccccttcatcgttatatcggattcc
ttagatcgtgatcggacggccgatagtaaacaataccccttcggcctgac
cgttatacaaaagagcccctatagtgcattaaaatcaacccgccatccct
tgttgttgtgcactgtgtcttaggatctttgcgctgtggcccctgcattt
cctgaattttggtgcgcagtccagagatccgaggaaatcagttaaataat
tatagaaaagaatttttaacataaaaacaattcctataacttgattaatt
catagaaaattcatatgaagcccaaattaatccgttccaattcctataat
tttgtaatattattgtctatcatctaatacctttgttttgatatgaaagt
cacattagaatttatatcccatttaatcttgtacaaaacacatagaatct
tcagaaaatcataactcatctgttttaactccgatttgatccgttcaagt
ttcgttagtctcgtagcaacgcgtagatcattattattcagtttgttcct
atgtttggtgtgatgttaattttatctataccatgtttgtctgtattgct
acgactagtgggaggtttcgaggatctgaagaatcaccctggtaactgga
atctcaagtgcgaggcaagttgtgcccttgaccacttttattacccaata
atgctctttaatgtaattatccatacataggtttaattttgatgggcccc
gataggtccccccccttttttaaccattttacctgttaaccctgatctcc
tcttctctttttgtggttcttacaggatttgggataattttacgattcaa
gctgattcatcctatctcttctagcnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnataacaatctagggtgacctatcgg
gtcccatcaaaattaaacctatgcatggataatgacattaaagagcatta
ttgggtaataaaagtggtcaagggcacaacttgcctggcacttgagattc
tagttaccagggtgattcttcagatcctcgaaacctcccactagtcgtag
caatacagacaaacatggtatagataaaattaacatcacaccaaacataa
gaacaaactgaataataaagatctacgcgttgctacgagactaacgaaac
ttgaacggatcaaatcggagttaaaacggatgagttatgattttctgaag
attctatgtgttttgtacaagattaaatgggatataaattctaatgtgac
tttcatatcaaaacagtggtattagatgatagacaataatattacaaaat
tataggaattggaacggattaatttgggctccatatgaattttctatgaa
ttaatcaagttataggaattgtttttatgttaaaaattcttttctataat
tatttaactgatttcctcggatctctggactgtgcaccaaaattcaggaa
atgcaggggccactgcgcaaagatcctaagacacagtgcacatcaacaag
ggatggcgggttgattttaatgcactataggggctcttttgtataacggt
caggccgaaggggtattgtttactatcggccgtccgatcacgatctaagg
aatccgatataacgatgaaggggtacgcgccatgggccactggatcgaga
tctgatggcccagatcgatcccgagcccataatcagtgcaggccgtacga
ttgacaattgagggcacagattcaattaatccgaaagggtatatgccttc
taatcctagccgttcattctaatccaacgaccatcacactgccctcaacc
tcccgacggccagggacggcggcgcccacaggcccgacgacggagatccc
accggtgaaccccaatcgcgcacacacgtacaaatccttcgatccaaaag
ccctatgcgttgccgagatgatagagaactcaacggaggaattcttacct
cgattccggcaatggacgaaccgccccacgtagtttggcggatgcgcggc
ggtgagcgattcattccatccccgagcgttaatccctgcctccagaagct
ctacatgatgcgcactcaacgacagacttcatcaaatcataccttaccgc
cagcagcagactcattattgcaggacatgtgatggcgtggcgcctcggcg
gcatccttgccccgtcgagcaattgacagcgtccagagatctcccgtgcc
caaccactctgttgcacacgatgcaggctctccgacgatcacccgaagcg
attcaccatggtgaagaggtaacggggatgtaggccaacagtggcgcgcg
ggtttgtagttgtgctagaaccccggtgagcaatccaaagagcccactag
gatccccacgcctgggatggccatcaacacgcgcggtgagtgcaggcgat
cccccgcgaccactagatcgatccccgggcgtcgtcgaggtgctagttcg
atggaggctgcccggattctcttcaccgcatccttgttgtggcggcggcg
cttgggttctggtggcgaaggagatgaagacggacgactttatactctgg
ctgagaccgagcaggtgggcatgcaggagctgcggcggaatctgcggtga
aggcgtcgggttgttacgcgcggaagaggaggccagaaatttcgtagaag
ctggtaggcggagatctcgttcaatcccaacagcaccagctgcggtgatc
ggaggaggaagaggggaggaggctgtcacgtgggccccgccatccagtga
cgcacgcgcggggcgagatggcacacggtttggatggccgacaagagggc
ccgcgcggcaggacggctgtagcacgcgtggagtgcgcagccgcgcggct
ggggggttttgggccgaaaggagtttgggcccaaatgcgcagtttctcta
tttctttcttttctttttctttttcttttctccttccttctttaattttg
aattccaatatttgaatttgagaccttgtatgaatttcacctttgagtaa
atgtacaaattcaaatcttaaggtagaaataatatattttattgtatata
ttttattctatatttttttgtcacatagtattccctttcttccttttcca
aactctagaatttcttttaggatttagttttcctattggagtattaacac
acttattattttttttttaccatattttttttatcatcctagaatgcaca
caaagtaagacccagcatgatgcataagttgtttttgggtatcttttggt
gtttatgtatttgtgtaagtaatgtgtccacacgaaatgataaacattgg
taacacttatagctatagagtaatatgatttctctttttttagacctttc
ttacaaagtgggtgttacaaatcctacccctaacagaaatctcgtcctcg
agatttgcaagaaagagatacagaaggatttctgtaattcggcttttagt
ctataattggttcaaaaatcaagggtctcgttttttttatatagccaatg
gtgggtgattaagagagcataggtatccagctacttattatgtaagatat
aagagatggataggttgaggtaagaaagattatgaccaggaaaagacttc
atccaaaatgtctatgtcttgattcatctcgagattcgttttgactgtta
tatgcttccttgtcgaggttgatctcctccttcttgctctttggtgtctc
tatccgagtttgggtcaagaggttaagatagatctgtatgtaacacgtag
gtagagcagctggtttagtagatggctatgagtttaatgaggttagtcag
aatctggtttggtcgtttgcttctagacgggtcggataggttatgtaacc
tatcatgtaggtcaagttgttgggtatggccgagttgatctaagtcacca
atttaggcataagtgaattagaagtatggccttatcctttgtaccagcat
taagtaactcacactagattagatcatataagattagataggatcgagat
tagattggatatgactagattagactagttaagatctcattattttggat
tagatcctggttgttactagtgtggggtaaatatgcttattagggtaaga
tgaatccctaaaggacaaggtagaatcttttgaggtcagttagatctatt
aggatgtcataagacccttttcgagataagatgagtatttttttagcata
agatggatctatgagtgtaggatagaatattttaagatgagatggatatt
gttaggctagatactttaatggggaataatctagtttgtctagttatcat
tttgataagcattttttcctatatgcatatgcagatgtaagtgtggacat
tactccacaactcatcacactcaatcaaagatccaaatcaaacaagtatc
ataagaacaaacattcaagttcatagatatctataaaaaaattgttttat
ttttgtttcttaagagtaggtctcctatttccaaaggtcactttaggcac
aggatttcaaagtgtgaaatccacatttgtctttagaaagaagaggtaag
aataatcagagtaaagcggaaatagatgagaaaagattaagataagttta
gaaagaatcagagtagcaaaggtaagtagacaatggttgtccagttctat
ctaggtttcgtcctacagtcaacattcctctgataccacttctgtcacac
ccggattttaggggtccaaaacccgggcgcgaacataatcaccaggtgtg
ctgggaccaagtctcacacatatgatgattcatggcacaggatcgaatgt
cacatctttactacataacaggagttctatacaaaataaataaataatta
cattataaggagacaacggtccagcaacccaaagttgactgggagacgac
ggcctagacctctcacgaactcatcacagcatcctccatgcgcctcatcc
tgtggtacctgttcttgacctgtgggggaggtgtgagacagcaagagtga
gctcacatacgttcatcgctcaacaagttgtggggaataatgtgcatgaa
ctcgccaaaggtgggagctcacgtgaagtgtaaggcttaccaaagaggat
ggttagagctgagcattgcttttaaagttggtcaaaattttattagcaat
tactaagtataagtaaataccagcccaatttagtagaacaaaagtaacaa
cctcacctgcgatgcaatgcatatgacaaattgagtttaagttccataat
ttaatcatcagagagtcttgagctgctcatgaccgtgagctcggctagta
taccagttttacactctgcagaggttgtaccctttacccacaagtcatgt
tacccatctgcccaggggtcgcgactcccatacacctctactaaggatgc
gaggcagggtaacactacgaggcctttacaaagttccactagcttcagaa
aacccgctacagtttataggaagctccaatgcagggttcttgcctgaccg
ccatcgcagcaaaatcagccaaggacctccctacactgaccactccccta
ctgcccttgcccctttcgggtaaggtagtcctccactagctttcctaatt
aatcagccaatggcgtccataaacccttgtggtggcacgtgtttctcaag
ttaagctctatgttccaattaacattaatgatcttgacatgaacataaat
agaataacaaaataactggaacatagatatgataaataattatcccaaat
ccatgtaaagcaatagcaaaactacccaagtgattcagggataacaaggt
aaaatgggcatccaatgaagggtgacggtctgggcaccatcaaatccggt
ggcacaccaggataattacattaaaccaggggactgggtaataaaactgg
tcaaggtcgggaattgcagaagccggcgcttccagataccagggacgaat
ctctgaatcgctatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnagaagcgattctagagattcgtcaattctcagtttt
aagttgagcaacatcagataatacatcatgattatcacatttgctcaaat
aaaacagattcatactgttggaccaaagtatcatgagagcactttagctc
ctcatgatatttggtcatcttctccaggctgtcgttggttttgatgagag
tctcctctagcctgagaagcgtctcgccttgttccttgttccttctcaac
agcctaaccaagagcactttgtcttctttgttgagatgggtgtagaaccg
gcgaatctcctgttcttccacatcatcggtctcattttccctgtcattat
tttcagtggaagcaaaacaggaaattgtaccttgtggtgatgaagattca
tcctcgctatcatcctcatattcctcctcatcatcgctttcatctccact
ctcattgttagcaacaagacatgtataactattgggagatgaacctgtcg
gtgaggtggatccttcgcttggtgtccatcgttcttgttcttctcccttg
gacaagttagtaccaccagcaatagaggaagcagaagcagtgcatatgga
cttaaaaaatttcaacttaattttagtccatagatcatgagcatcaacaa
ataaatcactatcactactcatgatggcaaaataagcacctctagaaaga
gagtcaactaagatgttgcaagcatggtgattgagagatagacatcttag
ttcagcattagaaggttttttactaatatcagagggaaaaatacttctac
taaagatctgtctcaaatcaggatcaatatgcatgaaagcattataaata
gagacagaccaagatttataattagaaccatcgcctaaaagaagttctag
agttacctcttgtgacgacatcgtcatctacggacggctaagccacactg
gagaggcctagctccgataccaattgaaagttccctttgcccgagaacag
gatctggatgtcgcccagagggggtgaataggcgaataaaaattatcact
ttaaaactttagttcttactctactcaaagaccagatcgcagtggaatga
aagatccttcgagtaggttgcggcggaatagaagatcctgtctcaaaatg
ccctgcacttcaaatataacttgtaccacagataagtgttgaagtgcaga
tataaaaagtgagtaagacagagtcagcacacaatacagaatgaagcaca
cagacgcaaggatttatcccgaggttcgaccaagcctgaaatgcttgcct
agtcctcgttggagttagccacacctgggcttggaagtctgtttcaactc
cttcctccgtttgctcagatctgtaagtatgacagatagagccttccact
atgttgagttgggttacaacaaagccgcggctgcttacaatcttcttgac
agcactccggcagagtaacgatatgctcaagaccttgctctagctcttag
cagcacttttccactctctcaaggcttatagctttgcctttacacaaact
agagagatatacacgagagtgagagagagaattgatccgagtgatgtata
caattgttggctgcacttatcttcttgttggaggcgcctaggagtccctt
ttatagacccaaggggcctaggagccgttggaattcattttggaaggcaa
tatttgctttctgtcgggtggcgcaccggacagtctggtgcaccaccgga
caggtcctgtagcttgtccggtgcgcgatctccttccaaatcgggctcag
ctgaccgttggagcaacggtcgtcttggctcaccggacactgtctggtgt
acaccggacagtccggtgcgccaactattcgttggcccaagccacgcgtc
gcccgctgatcgcgctgccgaccgttggcgcagtcgaccgttggcttacc
ggacagtccggtgcaccaccgaacagtccggtgaattatagccgtacgcc
gccaaactttccagagagtggcctgttcactggagttcagcctggcgcac
cggacactgtccggtgcaccaccggacagtccgttgtgctagactgagct
gagtcttggttgtacacagccaagccttttgcatctcttttctttccttc
ttctttctgtttctaacacttagacaaatatattagtacacaaaaaccaa
tgtactaagtctagaaacataccttctctttgattttcacttctttagca
tttggcatgcttgagatttatgttggactcataaatcatcaagtcagctt
gacttgatctagattgacatttctgagctccaacgtcctgcaaaggtcac
atagagtatctccaaacataggaacaacccaaactaaaggtcaaggtgca
cttagctcttttgggctgcttccagttctgattggttctccttccggtga
tcttgtttacatcttgagctagatcttgagccttatgacttacaccacat
aattgtggatgttacctcattggttgtaagtcatgtccttatgtagtgtt
ccttgatgcaccataactcttaacaagatcaaccttgactttgcaagtct
tcttcttcacccctggctttgggttcctggtctccttgactttctcccgt
gcactcggtacctcgagtctcttattgcttccatccttggcttgatcggt
tgcctctgagttatgcacatcgaatctcacttaagcaatgtccatcctaa
ttttgatgtccattatctatagataatctagtctttggaccatcacactt
gttcacttgtgttgaaccctgttagctttgcattaagcacctgttcaaca
cttagcacacttgttagtcctttaattaagttgtcatctaaacaccaaaa
cccacaagagagctttcaaaagctccctggatcgtagctttgacgtatac
cttcgcactgtgtttgtttatatgctgatcttccgaagctatttgtgctt
agaggatcttcggcgacgaagcaggcccccaacagtagccccttcgcggc
gctagatcgtttttcataatgagcttgatccgtgaaaaatctccaaggct
tcgaaatgccgaaggtccgaaaaacaccttccctgagctcgttgccgaga
aacgattaaaatatttcgagcgcgaggtggcccaccgcgcggtgggtacg
aacgatctggcgattcacttcccaagcgccgtggtccaccgttcagcggg
tgcgtgcgacttggcgattcaccttcccacctgcagcactatataaacag
acgagtaggtgtgtagttaccacaacattcattgccattgcactattgtg
ctgttgaaaaatttaaccatagccgaagctttttcgctgcattctcgagc
aaaccatcattttgaattagcttcgtcaaaagagggagcttcgtcaaaac
tgtaaaaaacatcagcttcgtaaaaaccacaaaaagatccatcagatgac
cagagtacgctcgactgcgagggtgacccgtgaaggagaagagactgagg
ctaccgagacagctctgatttccaaagtcatgagacaatcgggcttagtt
gtgacggagggagccattgaagaaggtgcatctactgccgaagctgaaca
agctgatgttgaggaagaaaacgttgatgaaggagaagaggattatagca
ttctgatcccatcaaaacccggccacttggattttgagaaatctactgta
tctgaagccgacgagcccatgatgatgaaactgggctacttcggagaagc
tgaaaagaagcttattcgcttggccggagaagaaactactccaacaccga
aggatgacgaagtagtagttttcaaaagctttttcagagcaggattacgg
tttccgctgaatgagatgattggagaagttttggatagttatgaaatcta
tcttcatcagctgacccctaacgctatcgttaggctcatcatctttatct
aggcccttcgaagccaaggaatggacccaaatgctgaagctttctaccga
gtgcatgaattgcattaccaaacgaaggccagagaagacgggctacatga
aaatttcggttgttataacttcacgtatcgcaaggatacgaaggctccgg
tcctcagctatcgcaccaagtggccaactggctggaagagtgagtggttt
tatattaaggttgatgagaagaaaagagggaaactgatgacgatggtgat
gagcccgctgtccttaagcttcgggatgaccagacccttgtgcaacatga
agccagggtcagcatgtccgctggccatagcagaattcagagtggtggct
gaacaaatcagcaccagggatctagtgcaagaatacctagccaatagggt
atctccaatgttgagtgaatggagtatgccgaagctaaaaagaacaaaga
agaagaatgaacttgttcgattaccctatcgcttcaagtttgagaaacag
tttaaagactcttgccaagaatggttggagatgattgagactatgtgtaa
tgaaattttgggcaattataccaaaaagatcaactaatgactgcagcctt
cggcacccgaccaaaataaaggttgaattgggtaatggacgctttaaatt
ttgaataccctgattatgagcgactcagcaagggtgccgaagggataaag
agaaaaagagttgttagtgttctgagcaggcaagctgctagaatgttgaa
agaggacgaaaaatctctgaagaagaggaaatctagtcctgaatcgaagg
tggcgacttcgaagaagagaagggttgcaactccggagccaaaggtagct
gagatagaagaggaaactccttcaacgccttctgctgctgaagtagaaga
aattttaaaggtaatgactgaatccttacctatcaagctgctaagtcctc
tgggaccgcatctgacgaagcttttacagaagaaggacgagccttcggca
acaaaaaaggcggttgggcctaaaaagcgaagaattgttattgttatgca
agctattgaggaaacgccaccggcggcctcagcatcaaagatgacaccag
ctatcgaagctgcgaccaccaaagctaccaatctggagagtacgttatct
gatattgataaagtgcttttggatatggccgcagaggagactgctgcggc
tatagaagaagccctagccgcagtgcctgagaaagggaaagaaattgttg
aagatacttcggaagaataaggcttcagctttcaaaatctagttggtcaa
gaattatccaaggccgagaaggaggagctgtaggaatatgctatatcctg
tggctaccaaccaggagccatgctctttagtggaatcaatgaagaagcct
taggatgtattcgagaccgcaccggtgcgaagattatcagtgctctgtca
aagagtgttggttttccgaagcttnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnntgatcggatgaacgaacgatcggaat
ttcggcagcatcacggcagtacaaagatatctggaagaacgatgaatagg
gactatgaacgaacgatgaacgatgaatagaactatgaacgaacgatgaa
cgatcgaatgatcgaacaaacgaatgatcagaatttcggcagcataacgg
cagggaaaaggatatttggacgaacggacggacgaacgatcgaaggatcg
gacgaacgaacgatcggaatttcggcagcataatggcaggacaaagatta
tctggaagaacgatgaatagggactataaacgaacgatgaacgatgaata
ggaactatgaacgaacgatgaacgatcgaatgatcaaacgaacgaacaat
cggaatttcggcagcataacgacaggaaaaagattatttggacaaacgaa
tggacgaacgatcgaacgatcgaacgaacggacgaacgaaccatgaacaa
tcggacgaacgaacgaacaaactaagaacagggggacgaacgatcaaaga
acgaccgaacgatccttgtgctagtgtgtgcttgtgcggaacatggagtg
agtgtgtgtggggggggaagagagttgccatgaaatggcttggggtggga
tgagaggaggcccttgcccttctatttatagccatggtggggggattagg
gggagggatgagaggattagtgggagattagcatggatttgtcttgtata
agtgagatttgcttgtggagctcaccgtatgacattggaggcatacgtat
acgtatgagcatgaggaaagttatgaagaaaatatttatagtgacttgaa
aaatgattcggaaggtatttctaaagaggaaaatacttggagatatattg
gtggaatatttgggcaatatttctggaaagaacttgagggggattattgg
ggaaatatctgggcggtatttccagaaagaatttgagggggtcactggag
aaacatttgtaggatattttgaggaggattttggagagaatatagaccac
tatattttatttgttgatatcaacttgcaaacaaacattttgaaatgaaa
tttgaaattcattttgaatttagggcaagtttgagaaaaaaatcaaacat
ttgaatttttgggatgctacagttgccctgccctcgctccggcacgacgc
ctccgcgcggaggtcggtggtcgcccatccgggaggacttgagttgggat
ctgccggtgggcaggtggctgccgtcgttggtgctgaggtggtggcagcc
ggaggaggtttctccgccgatgagaccattggcgccacccgcggatcgac
ctccggctctttggctttgatagcttgtcctcgcccctcgagtggggacg
cgggcgagggccttgtcgcagcagcgtctgccctgaggtcatcgctgctg
ctgtttagccgctcggagcggaggtcgttgtcgctgctgatggagcggtc
agcggcgagccaaccggagtttgtcgtcccgcaggccctccgatgtggag
gttgttcatacccgcgggagtggaaccggagttccgtttgtaatggcacc
ttgagtgccggtgtttgttcattgtggctgtcggggcctgaacatctagg
tatttgagtgcaataccatgtttcttcctcatttcgagcactaggactcg
cctgtcggctagctgaaccgcttaaccatgtgtgagttgccctgtgcgga
aggtgacgagtgaggtatccgtatcctggaggctaggagtccctcggctc
ggtcggccttgccacccaaggcttctcttgctcggttaaagaatcctcgg
ctgctctgcaatgagccagagccggaggcagcggtgtcagcgtggacaga
ggcggagtcggctcgagaagaagcttcgtcggcccgggagcacgtgggct
ctctggccgaggaggtgcagcagcggcggctagaacctggctaggtcatc
cactagcaggaccaaccccggagtcgggctgccgaggccatgagccgggc
tgatgtcctcgggggacagctggctgaggctacggagcggccggtcaagg
tgttcgcccgggccgggacccttacaaagaccttggctatgatggcccga
gcttggtgttggcttccgtctttgaggtggagatccttctgcccgcgtcg
ccgttcgaggccgggccagattctgccgaaggtggagacgacgccgaggg
tgctgctgctccctctattgatgtctgaatctgcagggagagtttgtccg
tagtgtgcgtatgtttttcgcggccgccgaggcccaaacatatcattgtc
gtgttgtaaagctgcgtttcctttcctcttgtttcgagtatctggacttg
ttcgtcggtaacagaattgtttatccgagcgagagttacttttcacggaa
ggtgatgagtgaggtatccgtatcccggaggggtaggagttcctcggctc
ggtcggccttgccacttacgtgcactcttacccgttcgtaggattctgtt
atcgatatagtcgagaaggcacaaaaatcgttttggcaaaaaagttttcg
agcgtttaagacttgttcggtcagcagaaatcgcttattcgagcgtgagt
tacttatcgcagaaggtgatgagtgaggtatccgtatcccggaggcatag
gagtccctcggctcggtcggccttgccgcttacgtgtactccgtcgtttt
caggatccctgctatcgaagcagtcgaaaagcgcgaaagatgttctggca
gaaagactttttccgaggaaaactttgatgcagagggggttccccccttc
tagcccctgagggagggtcgggctttgccgaggcaaggctgacccttcct
tgacggttagactttatttgtgtatgtatagaaaatgaggtatatgaatg
acttgaaaacatcttaagggtaaaagtgacgtagctgtcggatgttccaa
gcgttgttgtagacctcgccttgattgttggccagcttgtatgttccggg
cttcaaaatcttggcgatgatgaatggcccctcccagggaggagtaatct
tgtggtgccctcgggcgtcttgccgcagccgaagcaccaagtctcccact
tggaggtctcggggccgaacccctcgggcgtggtagcgtcgcagagactg
ctgatatcgcaccgagtgtagcaaggccacgtcccgagcctcttccagct
ggtccagtgagtcttctcggctggtctggttgctttggtcgtcgtacgcc
cttgtcctcggggaaccatattctaagtctgtgggcaagacggcctcgac
cccatagactaaaaagaacggtgagaaacccatggctcggcttggcgtcg
tcctcagactccagaccaccgagggtagttccttcatcgaccgcctgccg
aacttgttgaggtcgttgtagatcctcggcttaagtccctgcagaatcat
gctgttggcacgctccacctgcccatttgtcatggggtgagccacggcgg
cccagtccacccgaatgtggtggtcctcgcagaagtccaggaacttcttg
ccagtgaactgggtgccattgtcagtgatgatggagttcgggaccccgaa
gcgatggatgatgttggtgaagaacaccaccgcctgctcggacctgatgc
tgtttaggagtcggacctcgatccacttggagaatttgtcgatagcgacc
agcaggtgcgtgaagccctcgggtgccttctgtagggcaccgacgaggtc
cagaccccacacagcaaacgaccaagtgatgggtattgtttgtagggcct
gagcgggcaagtgcgtctgccttgcgtagaattgacacccttggcaggtg
cgtacaatcctagtggcgtcagccaccgcggtcggccagtagaaaccttg
tcggaaggcgtttccaatgagggctcgaggtgctgcgtggtgaccgcaaa
cccccgagtgtatttcttgcaatagctcctgaccttcagcgatggatatg
catcgttggagaatgcctgaggggctgcggtggtagagctccttttcatc
gcccagtaagacgaacaacttggcgcgccgcgtcagtcgccgagcttcgg
ctttgtcgagggggagctctccttggtggagatattgcaggtacggggtc
tgctagtttcgattaggcgtgaccccattccgctcttcctcgacgcgcag
tgcctcaccttcgacggccgagggtgcctcgggctgggtcgaggcctcct
cgggctcgggcgtgtcgtcggtcttgacggagggttgatgtaggtcttgg
gagaagacgtccgggggaaccgttgtccgccccgaagctattttagccag
ctcatccgcagtctcgttgtaccatcgggcgatgtggttgagctcgaatc
tgtagaacttgtcttccaggcgccgaacctcgtcacagtaggcctccatt
ttccggtcgcggcagtgggagttcttcatgacttggttgatgatgagctg
cgagtcgccacgagcgtcgaggcgccgaaccccaagctcgatggcgatgc
gcaacccgttaaccagagcctcgtactcggccacgttgtttgatgccggg
aaatggaggcgcagcacgtagcgaaggtgcttcctgaggggtgagatgaa
gagcaggcccgcacctgctcctgttttcatcagcaacccatcgaagtaca
tggtccagagttctggttggatcatcgaagttcatcagctgttggtagct
gggtgtcgacccattcagccacgaagtctgccaagacttgggacttgatg
gccttccgaggaacgaacgagattgtctcgcccatggtctccaccaccca
ttttgctatcctacccgaggcctctcggcactgtatgatctcccccaggg
ggaaggatgacaccacagtcaccggatgagactcgaagtagtgtcgcaac
tttcgtcgtgtcagaattactgcatatagtagcttctgaatttgcgggta
gcagatcttggtctcggatagcacttcgctgatgaagtagaccggcctat
agacgagcagtgcatgcccttcttctcgtctctcgactacgatcgtggcg
ctgaccacttgagtggttgcggctatgtagatcaagagggcttctcctgc
agcagggggcaccaagatgggcgcacttgtaaggagtgcctttaagtttc
cgagggcttcctcggcctcgggggtccaagagaagcgctcggtctttctt
aagaggcaggcggtacaagggtacgcctctttcgccgaggcgcgagatga
agcggctcagagccttgaggcatcccatgaccctctgtactcctttcaag
tctttgataggccccatgttggtgacggccgcgattttctctgggttggc
ctcgatgccccgctcggagacgatgaaccccaggagcatgcctcggggga
cttcgaagacacacttctcgggattgagtttcacgcccttcgccctcaga
cacttgaatgtcgtttcaaggtcagagaggaggtcggaggcttttctcgt
cttgactacgatgtcatcgacgtaagcctcgaccgttcggccgatgtgtt
ctccgaacacgtggttcatgcacctttggtatgtcgcgcctgcattcctc
aaaccaaatggcatagtaatatagaagtacatgccaaaaggtgtgatgaa
agaagtcgcgagctggtcggactctttcatcttgatttggtgatacccta
agtaggcatcgaggaatgacagggtttcgcacccagcagtggaatctatg
atttgatcgatgcgaggcagagggtagggaaccttcagacatgctttgtt
taaaccagtgtattctacacacatcctccatttcccaccattctttttca
caagcacagggttggctatacattcgggatggaatacctctttgatgaac
cccgcagccatcagcttgtggatctcctcgcctatggctctgcgcttttc
ttcgtcgaaacggcgcagaggctgcttcacgggtcgggctccagctcgga
tatccagcgagtgctcggcgacatccctcggtatgccaggcatgtccgag
ggactccacgcaaaaacctcgacattcgcgcggagaaagtcgacgagcac
tgcttcctatttggggtcgagcttggagccgatccagacctgcttggagg
cgtcgttgctagggtcaagagggacggacttaaccgcctctgctggctcg
aagttgccggtgtggcgcttcgcatcaagcacctccttggtgaggcactc
caggtcggcgatgagggcctcggattcggcgagggcctcagcgtactcca
cgcactccacgtcacattcgtacgcgtgtcggtacgtggatccgacggtg
atgaccctgttggggcccgacatcttgagcttgaggtaggtgtagttggg
gacggccatgaacttggcgtagcatggtctccccagcaccgcgtggcagg
ttcctcggaacccgaccacctcgaacgtgagggtttcctttcggaagttg
gagggagtcccgaagcagacaggtagatcgagttgtccaaggggctggac
gcgcttcccggggatgatcccgtgaaaaggcgccgcaccggcccggatca
tggacagatcgatctgcaagagcccgagggtctcggcgtagatgatgttg
aggctgctgcctccgtccatgaggaccttggtgagcctgacattgccgat
gacggggtcgacaacaagtgggtactttcctggctcggcacgcggtcggg
gtggtcgccttggtcgaaggtgatgggcttgtcggaccagtctaggtaga
ctggcgccgccaccttcaccgagcagacctctcggcgctcttgcttgcgg
tgccgagctgaggcgttcgccacttgcccaccgtagatcatgaaatagtc
atggacctcggggaactcctctgccttgttgccctccttcttgttgttgt
cgtggcctctgctaccttctgccgaggacccggccttatggaagtagcgc
cgaagcatgacgcattcctcaagggtgtgcttgacggggccctgatgata
ggggcacgattccttgagcatcttgtcgaacaggttggccactccgggag
gctttcgagggttcctgtgctcgatggcggcgacaagatctgcgtcggca
gcgtcacgtttcgcttgcgacttcttctttcctttcttcttcgtgtcgcg
ctgggcggacgcctcggggacgtcctcctgttggcatccttgaggctgct
tgtccttccggaagatggcctcgaccgcctcctgaccagaggcgaacttg
gtggcgatgtccatcagctcgctcgccctggtgggagtcttgcgacccag
cttgctcactaggtcgcggcaagtggtgccggcgaggaacgcgccgatga
catctgagtcggtgatgttgggcagctcagtgcgctgcttcgaaaatcgc
cggatgtagtctgcagggattcccctggctgctggcggcagcttcggaga
tcccaggagttcccagggcgcacgtatgtgccctggaagtttccagtgaa
ggctttgaccaggtcgtcccatttggagatctgcgcaggaggcagatgct
ccagccaggctcggacagcttcggagaggaacagggggaggttgcggatg
atgaggttgtcatcgtccgttccacccagctggcaggccagccggtagtc
tgcaagccacagttccggcctcgtttcccccgagtacttagtgatggtag
tcggggctcggaaacgggtcggaaacggcgcccgtcgtatggcccggctg
aaagcttgcggaccggatggttcgggcgaggggctccgatcctccccgct
gttgtagcgtcccctacgcctggggtggtagcctcggcgcaccttttcgt
cgaggagggctcgacggccgtagcggcggtgctcgttgccgaggtgatcc
ggggccacaggcgtcgcgtcccgcgtgcgcccggtgtggaccgaggcttc
ccgcatgaatcgggaagtcgcgacgtgatgctccggggagtacccttgcc
tccgggaggcagtgctctcggcccatcggaccgcggcatcctccagaaga
ttcttgagttctccctggatacgccgcccctcgggtggtggatggctccg
acgt
back to top