AJ567336

Overview
NCBI AccessionAJ567336
VersionAJ567336.1
Typeregion
SpeciesGossypium hirsutum
LibrarySau3I cotton microsatellite enriched library
StockGuazuncho-2
Publication[view all]
Germplasm
Stock NameType
Guazuncho-2obsolete_cultivar
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Libraries
Library NameType
Sau3I cotton microsatellite enriched librarygenomic
Sequences
The following sequences are available for this feature:

region sequence

>AJ567336.1 ID=AJ567336.1|Name=AJ567336|organism=Gossypium hirsutum|type=region|length=330bp
tcaggattactccaataaaaaaccacaatatataacttatatatttttat
attttcatgtagaaaatattcaaagtttacgtaacatataatcaattatt
tgagtaaaattcatattattactcaaaaatgtccagtcaattttcagact
cagtttatatcccctaaatgtaataaaaaggttgaagtgttataaaatgt
aaatcaattactatgcttaaatcgatttcaagggcctaaagaatatctta
gcgcaagtattcgggttagaatggtgcccaagtgtgctttgtgtgtgtgt
gtgtgttgaattagtgactataagtggatc
back to top