COTLEA5AB

Overview
NCBI AccessionCOTLEA5AB
VersionM37697.1
Typeregion
SpeciesGossypium hirsutum
LibraryLambdaGem 12 of G.Galau
StockCoker 201
Publication[view all]
Germplasm
Stock NameType
Coker 201obsolete_cultivar
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Libraries
Library NameType
LambdaGem 12 of G.Galauunassigned
Sequences
The following sequences are available for this feature:

region sequence

>M37697.1 ID=M37697.1|Name=COTLEA5AB|organism=Gossypium hirsutum|type=region|length=3809bp
gaattccttctttttatagagtcgtaaagaagcttgtccattcagacatc
atagtttccctaattataaccaacttacttccatatacggaaaatgctca
agcaattgctgatattgttgaagaaatagatactgaggatgtagctactt
caaataatcctgaagaagaaagcaatgaccatgaatgcaaagctgatgtt
tccttggatgagatggatgtctcagctacacaatcgcaactatcgaagcc
aaactaagatgattccacattttcaaagaagaattttgatgtaagtgaac
aaatttcttgtacttcacttattgatgctgccacattattgggggaaaac
atacggactgttgaccttgaattaagtaagagcattgcctccgaagtgtt
aattcaagagaagtaaaaaaatgctaattcaagaaaatgcccaaaaatta
tatctagccttaggtgaagtagaaggattaactgagtatgatcgctttct
tgcattaagaaaaaattcgaactatccaactcaagtgctcatttcttaag
tctaccttcttctgtgcgattggaatgagtgagaagatttatttctaccc
attaaaaatcatggttgtgttggtgatgttttggtaactttttatatatg
taatatttggatggtataatgacatgatagaacatcacaagctattgtaa
cttttttatgttgtaaaatttaacatatagattatgacatatagctaata
gcataatgtaactttttgttaatgtatgaatattgtgtttggatgtaaaa
tataattctcaagctatttattacttctaatattttactttttagtttag
aggataattaaattatttatttcgctaatgatattttaacacattaaata
tgcattatagtttaaaaataataaagtaggctatatattattatttttat
taattcatattttaataataattatattaagaatgttattaaattatata
tttttatttttattaaattctatttaataataattatattaaaatatgat
taaattatttgttattattatttaattatatttaataacaataatcatca
agctaaaaataattctactaattatactttggtcatttcaacttcttctc
ttatccttatattattacaacatctatttcattcagtcaaatacaagaat
acaattaagttctattccattctattcaaccaaacaattgaattactgat
tacaattctattctattatagtgaaccaaacgtagtgtaagtgtttagta
ttattgtcaaaaagtgtttttgaaaaataaaatgtcaatttgagagatga
tgttgtaaagtaaaaaaaaagtatttaaaagatgttaaggtttattaata
ttatgatatttcaataaaaatataagaaaatatcaaccgatagttagaag
aagtgggagtgacttttttcccccaagcttttgaattaagttcgaatctt
agatttgatattattaggaaagttttacttaaataacacccctgattcta
gcaagactatacttaagctgtaaaatggataacaatatataaaaaaatat
attattaatattttagttattaaatataaaatttaaatatttttaagtaa
ttaatatgaattgattgaataatttaaattaatatataaattatattcta
aatatttaaaaaattataaaaaattaaaatatatataatatcatatattt
gaaataaattttaataaaaaataattatatatcccatataaatatttgag
aataaaactataaaaatatattaaaagcagttttaaaacaataatgatgt
agggttactattactataacaatcagcaaagaatatctaaagataacatt
aaagtactttttgtttgctttaaaacgacgaaaatcgacatttagatcct
tatcgttttaaccttaattccattggtccaaacaaagccatcaccttgaa
gttggatgaaacgcgtgtccgctcccaagaaaatgactcaacgactcagg
agtcacgactcagctgataaggcccaacccaacccacatctttacctctc
tcttatactataaatacataaccccttcaaaccctaaccttcatcttctt
catcaatacaaagagcaggaaaacaagaaaagcagagccgcatcactttt
tgctagctaagctactgtgggagttattgttcttcagaacagcttctgca
gtagctaataataacgttatatattatataaattttatacatccttttta
ccctacgactccatatataagcaagtaaaaataaatatggctcgctctgt
ttcttcctttaagttccttggtgcttctgtttttgatgctctttatgtct
ccatatcaaggtaaccgtgtgtatgttttttcaaaatccttttagtatat
ggtttttggcttactcttttttatttttttggttattgataatgatttgg
gattggctttaaaggagaggttactcaggtgcaccgccggcggcagtgac
ggctagctttggtaggcctggagcgatggggaaagtggaacgaagatatg
cgatgaaagagtcgtcgtcgtcggagacaagggcttattcttcagcttgg
gcgcctgaccctgttacggggtattaccggccggagaactgtggggctga
gatcgatgcggcggatctccgggagatgatgttgaatcacagggttagat
cacagtagaaacttgccaccgcatgtgatcaccgtagcagagcagagcca
gaatgttttgcagatgtttgggtgcctttgtattttgttttggttttgag
ttcaaaatcttttatcttaataatcggtagtatttcttataaagagtgta
gtgtgcttaactttaagctaaagcagaaaattcactaaattaccactttt
acttctttcttttttttaagttagtttatatataaattatattattataa
cattaagattgaataattatgaaattagtaattaaatattttaagaataa
atattaaaattatatataaattttgatataatttataacgttatgtacca
attttaatttagtgcatttgtatatattaactttaattttaatttaattt
tatgtaaattgttgacatgatattttataagcttaaaaaaggcaagcaaa
caaatttaagaaaaccaaattttctaagggaaataaaaccctttttgtta
aattttttaggtaatttataaaaatagtcacttttgtttgtttcaggttg
cgttttagtaatttatgtttgaaatattacgttttagtcacttatgttat
tattttgttacaaagtgattactctactgttaagtttcgttatctctcta
atggtaatcttacgtgacagtctaactagattttaagtgtcaacttagat
ttttaaataagatgaaaatagattttaaattaaaaaatttaattacttaa
aatttttaaacttaaatattaactaaaaaaactgttcatatcctcttttt
aattttcttccatctttttttttcaatggtttttttttcatttgactaga
aaaattattattaaaatcaaaatagttgaaatcaaattgactgcttcata
aagatggattcaatggagggttcaagtgtgtcttctttgtattcatctat
ctcttttattcaatattaaaaacaaaagattagattttttattatttaat
gaaaaccctaaattaaaattcttgatatttttttctactttttgaaattg
tttgtaaac
back to top