GF110984

Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Sequences
The following sequences are available for this feature:

region sequence

>GF110984.1 ID=GF110984.1|Name=GF110984|organism=Gossypium hirsutum|type=region|length=231bp
cttaaattcaagtagactcttacaattcatgcccatcccctcccaagccc
cccatccacttgtttgacttgcttttgattttattgctactattcctgaa
tggcaatacctgattggtatcaccttaatccacttcacaccttatacctc
taaaaaacaaattctatataataaacttacttctcttacattgttgcttt
ctctaaccagccaatgcttttgaagcagcca
back to top