AC245509

Overview
NCBI AccessionAC245509
VersionAC245509.1
Typeregion
SpeciesGossypium hirsutum
LibraryCotton BAC Library
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Libraries
Library NameType
Cotton BAC Librarygenomic
Sequences
The following sequences are available for this feature:

region sequence

>AC245509.1 ID=AC245509.1|Name=AC245509|organism=Gossypium hirsutum|type=region|length=117318bp
ttctgctccaggaagaatcagacaaagagtaatgtcgattccctcacctc
agctgaactacgtgccttctcaatatcttgcttgcctaatgtttttacca
cttttggcatgcaggaagtttatgataagcagaaggaattgatcttgact
ggggagaggcttttgttggcaacgattgctttcgatcttgatatcgaact
cccttacaagtcccttgttgcagctgtgaagagattggaaatttttccga
acctcttaaaagtggcatggaattttgtgaatgattggtgagaacttgcc
agctagttcattttaagcaaactacttatctttatgctatgttgaattat
tttggatcatttccttatgtctttatgatattaacctaacatgaattgaa
ctagcaggcttcgtacaaccttgtgcttgcaatacaaaccccattacatt
gcagctggttccatgtgtcttgctgctaaatttcaaaaagttaagcttcc
aatggagaagggaaaagtatggtggttggaatttgatatttcacctaaac
agttacaaggtttgtactacatatatctttctatctttacatgtgtcagc
tttaattcttactcatggtcattatatttttaatgaacaggaactatagt
tgataattaaaagcctggctgtggttcttatatactccctacaatattta
aaagtggtacacattgttcatggcggaactttctttttcaaatcaccctc
attaaccttaccctgttttttccctcttatataataaatataaatgacgg
aagcttattggaacgtttctcgaacattaaatgcatggttgttcataacc
ctctttttctttttacctaaatatatatatttgggacggttatcttccat
tgccttgatgtgtgcataattattgtggctaaaaataagctctaccccca
aaattttcagaggtcactcagcagatggtcaggttgttagagcaagacaa
aagacgagctttatcgtcaagacatgagagggccagtctatctgcttctt
tagctgggaacgcaatgacgcaatcatgcaccttgagtgcatcagttggt
actcagtctggtgctggagctgagagtagtaaagttagcaaatcaatgga
caattgtgccagccaagattgtgtgaaagaagttttcccacatcgaacaa
gtgatgatggcgcaagtggtggtgttgaggatggcagtggtacgggtcag
ccaagaacagaggaatctgaccagaaccaaagtttgaatattgtttcatc
cgttgcctgtgacaacaagcaagcaagtgcaaaagaaagtttaccaagtc
aaaccagtgatagtggtgcaagtactgttgtcgacaatgctgaaggcgat
tgtgagctaagaacagaggaatctcatcatctaaacccaagtattaagat
tgtatcaatttgtaatactttcagtaagagcgacgccgaccggattcgag
agatctttaagaggaggagatgcgatagggctgcaaatttgaagcgaacg
aaagttagagatgacgaggtagacagtgaagcctggatagagagagaact
ggagatgggaatagaactggaatctgccacttcccggaagcgagggaggg
tgcactgaggttttgaagttgggagaagtagttcgttgataccctctaac
cacatatcttctttctacttaatgcatcaaagcgacccttccatggtctc
atttatggcatttcaagaaagactgaattctatttctctcttagaacaac
tataattattgccttgttgtagactgtatacaagtgtagaataattgtaa
cattttttttcgagagatattttatttgtattttggatcattcatgcaag
aatcacatccattcttttctgttgaattgtaaatatatagttgacctacc
atttattaaaacagattcattgttattcacttttagcaactaattgatga
aatatactaagaaactaatagtgcaaaaaggctgacctaggtaaggcccc
gatgtatgtattacttctttcctgttgcttcttttttttttttctacctt
aaacaccaaaatcagtgtatcaaaacatgaagtcattctttggctaataa
tctcaactacccttcattgattacgtacttgacagttggtaccaaggagc
aagaaagaactaaatttatgccttctgctttttggcataatttcaacttc
atctgaaaagatcccattattttttgtggacgtacatgcatacacatgta
aatatacggaaaatgtaatgatttgggttgattggattgcttttttattt
caagatgatcgtttcgttaaaagacgaacaaaaatagaaaaagaagaaga
aagaactgatttacgtttaatacaagtcatttgtaaagaaggataaacct
tgctttttcaagtataatgaccagaaaagattgtttttctacgacttcct
ctctctcatggtcttttcttttgtgattgtttttctacgacttcctctct
ctcatggtcttttcttttgttactggtcttttgcgtcatttatcttttgt
cttctcaactagacgagtttcgaatatgtcgaatgtattcgacgtgagta
taattagatttctatttttttttagtttttgaaattcatattttagtaat
gttacacatgaaagctttaagaaaaatgatgaatcggatcagtatggcta
tatgttgcattatatatagatgatttttataattgtataagcttgaaaac
ttggttcaaatttgatctggtcagaaggaagaagcagagaaacatttaag
cacttaactttccaagtgtggggatgaagatgaaggtagtggaaccctcc
attgccgtgaaaagcaagcacataaagctcttaacccaccaaatgcttcc
tccaaagccccgggcatcagccatgtgggttatgtttttgtctttctttc
tttcaaccagttcatcaacatctcccattatctggccttttaattttacc
ctggaaagaaaaatctgtagaaagaaaaagaatctggtcaaaactgtctt
atatgttccatgtatttgtgatccttgaaacaaagctctttttctttttt
tatttttctttttctagattattttaggcatacccctttttcccttaaag
aaaaaaatagagaacatgatccatcaagatttcatattggaaaaatcaaa
ggataaaactttgatcaaagtggtctgttcttagatggaaactgaaaata
tgcacaaagctaaagtgtttgaatcattgggctgactggcatcaatattt
taacaaagaagtggataatctccaccattattgttggaagataccaaagc
tacatataaaaatcattctaaataaccatagggaaataaagggatcaaca
cagaataaggaaatatatatacatataaacatatacatgaggctaagtgg
gtgggggggggtgatagaaagcatatattctgctatgacaatggctttgt
cttcttcttatgacatacctttaaatcttacaaaaactttaaaccccctt
ttaagggctttctgattattatttttttgactaaaaaaaaaagttgcaat
atgtataaatatacacagcgaaaaagcataagcaacaaatgagattaaac
aattgaaatgggaaaagggaaggaaaaaaaaggttgcataaaatatgtaa
taattgttcagaattaatgtactaccatatagtatgcaaggtattttagt
ttttatttttggaaattaacttttgtattacagatttacatactggattt
gattcatatcatacaattattgggttatcaaattatcatacatcaacatt
atcatcataaccatgaacataagtcattaaaaataattcagatcttacaa
ttattgaatcaaactatcatccatccatccatcatcataacaaaataaaa
atcatttggtatgatggtagattatatatcaagtaaaacaaatacttcta
tactaataaagaatcatttagaatgatgttagctatatgtcaagagacac
caaacaatcttcattggaattagttcacataagttgggacaagataatgg
tattacataaaattaagacaataaattgataatcttgacagtattttcta
aattgacctttttaagttttttttttctttttaaatataaactttggaga
ctgaataatccaataattttcaaatcgctccacggattaaaaaagaaagg
aaaaaaaaggcatgttgtatcatttaaaaatgcttatattcactatcatg
gcatcagagttaatatttccatcaattaagccaatgttgtctaaaagttt
ggatatttttacattacatatatatatatttgtgggaagtggatgtttga
ccctcggccggttgactgcctacgcccataaaagccaacatagggctctt
gctttttccccctaatggacccctaaaaagcgattaatcatagccaaaag
ggcccaattaagttgttttatatgtaaagaaattataataaaaagtattt
gaatctttaaatttttttacaaataatgcacccacaaaagatcaccaata
tgtggatatcaaagccatctgcttttttaaatattgaccactattttata
tgcttagtctaaaccaagtttgaagagattgagaagtgggagaggggtag
ctgaagtcatataccatatctgatcttttatgttaaatcacataaatagt
attattgtttttcaatttcaaattgctaaccattagctaccgacaccact
ccattcatgcttctatcatttagtatcgtgaaggtaactctaacatgcac
gaatcatcacttacacacaaaaagaaaagaaaataaaaatccccatgaat
ctgtttacttaattattgtaagttggaacccttttgaatcactttgttaa
aagggtttagaggaggaggggggggggtagttgaatagtttatcactttt
tttttcatctttgtttgttcttttggagttgtgttttgttctccgtttat
gggaaagatttctatatataatatttcatctttgtattctctcaatcatt
tttttaaagaaatgacggtgaacaataataatataaaaacatgacgtaca
aacgagaaattaatcactataaactaatgcacaaacgttatttttgtata
ataatcttaaaaataaagggaatgacaaattaacagtaaccgcaacacta
gaataattcagaaacgcatcaacttaatcaaatagctgaaatttgcatcc
caaccttgtcatcatcaaatcaatctaatgacgtacaccgatcaacaaaa
aaaaagctgtcaaaagcctcaaaagatccactatgtacgttagtgatgca
caaatgatcaggtctcagatgacctgtcctcatcatctcaaatctatcac
catcattataatctatcatgataatgcccttcgaaaacggttcctaataa
atttgaaagtatcattatattggcaaatcccacatatatgttagaaccca
actaaaaattaaaaataaaaaaatagactagataaaataaaaatcataaa
aaatattgataaccgtaaaattatagacaaaatcaaaataatatagattg
aaattaaaaacaaaataaaactataaaaaaatagttaaagagaccgcacc
caacaaccaaaacactgcggtcgctaaagcaaaaatttaatttgaaaata
ttgaaggggtaatatatttttacaaaaggaaaagatacatttatcctttc
aatgattaaaattaaaatgattgatagacttatatatatattaaaactag
ccataagctaaaatatgtatatataactcaaagtagttcataatttattg
agggtaattaagaaattatgttttgaaatagatgcataggatattggaag
tgaaatctgatgcagaagcagcttttgtgaaatgaaacttggaagataat
gaaattgggaaatatggaaaagtttacaactcacaagcaaaggaaaggga
aagaaaaataccatcttttttttctttttcaataaagatgaaaagctttg
aaggagaagatgatgggggaaaaggattaaaaaaaagaggaggggagaga
gggatttgaacaaaaagtaagtatcgacagagaaacaaagatttataaac
aactcaacaaggggaggaaagaaaaaaagtgaggcattggcaaaggcaaa
ggcattgggcaatgcatgatgcccataccgtgtgcctgagtctcacagag
agggactcagagtctttctctctcactcccatcaacttttggagtgatgt
gaaatattgtggggactcttcaaatatcgctctctcagggaatgacaact
taatctatcttgttctttatacatatgagctttattaaggaatgagtact
ttataagtatttttaaataaatttaattaatatattaaatataatcattg
atatttttatattatcattttaaaaaatatttattaactaaagtcgtata
tatatatatatagaaagtaacagattttgttttcttactatattaaaaaa
ttaacaaatataaaaaaatatttcatattaatttttgtcgttaaacatgt
tcataattatatcaatccttttaacttatatttaaaaagtaattatgtat
gctaacagttttgactgtgcgaaaaccttgaatatcatcaacaacataag
cccttggtggtgtgggaacattggatatcatcgacactttgatgctttag
ttgtatgggagcctcggtcaccacaagaccttgcctaagccactaagggg
cacgaaggagggtgctaataaattgtcttgtttcagacaatttaatatct
attagtagcagttttataaaagcttgtaagctctttagggggtagtggtc
tgttgcccctcaacgaccccccacaccgagtggtgagtcccttacccccc
ataggggcagggatggttgccatgtatgggtcatggtggcaagtagatca
tcggacttggtagtaggggcatggttatgccgaaaggttaagttcatgcc
catagtaatgttgccgatgactctaggatcaaatttcctatttcgaacaa
agatttcttgggatgacttatgtagagctatgtgtttgagcttggcctaa
ccattataagaatatgtgttgtttgttaaaaatagtcaattaatttgtga
cacaaattaaattaaaacctttatatataattgtagggaggaagtgatca
taaatttgattattgaatttgaattaatgatgttgagagaatggttatta
taagtaattatatgtttgtatatgagctctaaatttttgtaccacacctc
acaataatcttggcttatccaacaacacaaatcatctagcattatatcaa
ttatttgttgagtttcaaagaaacatgtcagatgataaatttattttatt
ttattttatgatatttcgaatttagatcattcatatatatatatatagta
aatcaataagttttattttgcaacatattattgcttcatgaagatgacac
acctattacattcctattcttttgcctcccttccagtttatcatcataaa
tattaaaatataaatttttatttattacataaatatttacgtgcaacttg
attatggttcattcgcacactttaaagatataaaaatatcaatttatttt
tatatcggatgagtataattattgagtatgtaatacatagatgtaaaact
gaatcaaatcaatattttaaatataaaaatacaccagactaaaagaattt
tatgatttcaatttttttggtaaattaggcaacaaaattgaattttaaat
atcggtagtttaattcaaatagaagaaagaaaaaaaatgaaaactatagt
ggggggagactggagagggccagaattggaagaagagaagaaatgaatga
aaacggcaggacagtggcattataaaggaacggaaggggattgcccataa
atattcctttttcaatctttacataaattatcataatagaattttatctt
ttaatacctctccgacttaatatttaatatttcatttcgaattaatttgc
ttcaaatataagtagatgtgagatagaatacaatttttttaaattattat
gataattatttgtctcacctgctatatgagattactattttatcctttgt
atatatataaaattattgaaaaggtaaagtattaaaaacaaaatattttt
tttgaagaattatatttaaatatatatttaattttaaaaaaaattaaaaa
tttaaattggagtgaagcagagtgaggtgaggatcgttaattacattcaa
tatctataaaggcagttgaaatttttaaaattatacatttataatgaagt
ggagtaggtggatggcgaagcagaatatgctgagcgataatgaatctagt
aaggatccgtttctgttccattctattaccatttctatatttgatgcata
ttgtatattaaaattttcttatctttattttacacagatatataaaatat
ataatagtttactgcatcgatatctcaattgtggaaagggggagggggag
gcccctcacacttgggaaattcccagtgagtctggttagtcttcactaaa
atcatagctataaatatagtctgatctgatcatctctgtatcacaaagga
cgacatctctatctgaacaaggcctcattcaaccacacaaaaccccatta
atggcagtgaaaaaaggtgcatcccaccagcatcgggtaggccaaacttc
taaaacataatttcatgtctaaaattctaaacaaaagaattttttgaaaa
atattacagccgacatatcatgtatatagtttatattctaacgataaaat
aaaatatattattaagttcagacaaaacttatatataaagtatttttttt
tcttctttttaaatgtgactgtacgaagtagtaatattttagggggcaag
ttaagtactttttgagatgaccaatcacaatacaaagagacacacacaac
aaaaaaaaaagaaatttaagttaaggtgtcccaatcatgtcatcgatgaa
agaatttaaaaggatatatgataaattccagtggaaatgtttgtagaaaa
ttacaatattttgggacactgtattaatgctgaatttataaatagaagat
aacaatagaagcaatagatatatataaaggggctttgaacatgtggagat
gagaggcagctaagagagcatggtgttatcatttctctcctcagaccttt
gctgaaagtcttgggattgaaggcagggatcttaatcatggctttgagga
agtattaatcatctgcctgtaattgcagtgagtgcaataaagctttattt
atatatataaataaaagtggggagtgagtttcttttaagcaaaatcttgt
tttgagggatagctgcaaaaaaaagtttaggatgaaaagaagaataaata
attaaagtcaagatagagggtgggggattgttgaagctcctctctctctc
tttctttgttttcttttaaagatggaaacttgaaatagtaaagaaggaaa
aaaaaaaaaactagagaaaagttgcttagataaaagcaaaggaggtggtg
tgtatatgtgggtgtcacctgaaactgttttctttgattagcgtgagaga
ttcctggaaactagctgtgtagtaactaaaattttaattactcaaccttg
ggattttcaagccccttttcttcttttggctctcttttaaattatcatca
tggagcctgaaaatgcccatcaccaacaccaccttcaagaccagcttctt
gggtcttcttcttctttacctatctcaccttgttatggagtttcaagcac
ccattcttggaccccaactactgctttgtaagttaaacctttctctttct
ctctctctggttaagctttctacaaatatgtttgtctcttcatacttcac
aggccattatgaatttactttaactccggaatctatcgtccctttttttt
ttctgatttgatgtgcatcaatcacaattatgttgttttaagttttactt
atttatcatttgttttgttttttcaggagaatattttctttttgttgcat
tgtttttggattcctaaaacttgtcggttcaccaagtatagtgcatcaga
tactgctttctctcactaattgcttcccttccatttttttttgggtcagg
aactccagtgaattcaatccgagttataatggggatatcttacattccag
gctgaaaaatgacatgttagtatcacctcaaaacagttccatgatccaag
gctggactaacaacgaagggagcttcactacccattcttgccatggccta
caccttcctaaaataaaggacgagctttcagaatctatcactaaatttac
tgatatcctaagcgacagtacctccagcgtcatagattctcaccacctgc
ctcctccaaactacttgaaaaataatgagcaaagggatttgagtgatctc
agccagaaactattgctcaagacaatatcttctggtttcccaatgttttc
tacaggaccggaattttactcgactacccagaattgttccatccctagga
atagctttttacctagtagagggagtttcagccagatttaccctagtata
aatatttcaagtttgaaccaagcttcttcttcccccaatatcccaagctc
cttcgacatgaatatggaggccttggatctcttaaacccagcaaggttta
gcagaagcagtaggtttagctacccttcggaagatcatgataatcttgat
atatacaaagagatcagcccttcttttggtcttcattaccaccataattt
gcaacagtcaagtcagaggccagtagcttatacccctagtaaagtaagtg
ctctctattctttcttgtagcagcattcatttctaccacaaaccatacct
caagtacaaaacattattgttttctaacactgcactgtcatggctctgat
ttatatatatgtatatatgtatgacactgcatgttatgttccctccccac
cctttcatgcattgaactcaaaaatcaaatataagatcaactagtgctaa
gcatcttataatcctatgtaaaagtatagttggaatctcaataatactat
ctaatactccattaaataacacaataatgagtagaatatgattaattagt
ggagcactttcttaaatgatgctaaggcaagaaaagattggaaagttgaa
aacctttattcataagtaagaatattatcttgttcaaaactatgcccact
aaaagaaaacatatatgggcaccttcagctttaatcgttgtaatgcatat
atctttaccagaactttatggctttattattatttatttttttaaaactt
cttttttatgatcattcaactgatctttactctttgcactccatgaaaga
catcacccttccccactgaaataacagaggcaaagagacccagcatttta
ccagaaacaaagccagcagcaccaacaacaactacagccaagaaatctcg
tttggagtcacgcgcttcatgccctccctttaaggtgccctaaggaacat
taaactagacctgattcttgatttccacgttttacaaccttgtatcatgt
ttgggtttgcatcaaacaggttaggaaggagaaactgggagacagaattg
cagctcttcaacaactggtagctccttttggcaaggtaaaagaggaaaga
aacacaataataaacaaccaccagtagctgctatgctgatagagaaaaga
aaaaggaaaacagaagattaatgagagagattaattaatttattagtaat
aatcagtcttagatttaattaattagtgggtaattgatggaaatgacgag
gttacttttttttattgcatgcgttggtggtggtggggaggataccgcag
acagatacagcgtccgtactaatggaggctattggatacatcaaattcct
tcaaaatcaagtcgaggtactatatatatatatatcaatatcacttccca
aacattctccttgaattttgcgatttcttacgttatatattcattttact
attcctattctctgacacatctttaaaatattatttccacctcaatatga
gacccattggaaactgccacttatgggggctactgcaacccccaacctgt
taccttctctagaagtaaaccctaaattattcaggcaaaactagctgcta
gctagggttctttatagcgttttattctatgggtatggagtccaatttaa
aactaaatattagccattgttgatttcccaagaagttctcagcctagcta
gctggagagaaagagagagctcaacatgagctttctttggaatgagttta
agaaatcaaagacttagtcatatcccgttagaatcaatcttggtgtttgg
attttccatgtaaacatgatcagtttacgtatgaatatgtgtatatactg
aataattaccgtatttgttttcgacagacactgagcgttccgtatatgaa
gttatctcgcaataaaacatccaaatccaaacaaggggtaagaaaaaaca
tatctacggtggccaatggaaacaataactttgtcacgtcattttaaggg
acaatgggtattcaaatcatttcaattactgtaacttttgaaaattttgt
gctgatgtttagggttcaacgatggaggacgaaaacgaagaagatgaagc
aaggcgggatctcagaagccgaggtctatgtctagttccattgtcgtgca
tgtcttacatgactagtgagagcggtgggggcggcatttggccgccgccc
cccaacttcaccggatgaagttagaaaacaactgccgctagctggtttgg
aagcgagaagagatattaaatcttgggatatataaatatatatacacata
tatattatgataaaaaaaatactgattagtttctaatcccgtatgttagg
agaaataataagtgctgctagcattggtttcaatggaacaaatttggtca
tcttgtttaaattactctcttacaagacggaccaagcttgatccattaac
aacattaattcttgtactttttttaaaatttaatttatagtttgtaccct
ttagaagagcttcctccacattgtgtttttatcaataattaatttcaata
cttaattagtttgttttcctaacacacattcctttaatctataagactta
aaactcatttaaaatactttaaaaaaataatttaaaaacaattaatgttt
tattttataagaaagaaaaaaatattgaaaagggaaatattttactggct
ttatcttaacttaattattattattacgaatgtaataatttaaatatata
atataaaagggaggataagtaatttaaacatgggatataaaataatagta
aatcttcctatgtttctttcgtaggccacttactcggtaaactatatggt
aaaaattttcttacactttacattataggtatgaaaattagcaatgtaat
ggaatgacgaaaaggatttatagttaagttttcaattatactaattttga
attccatcaattgataatttttatcctattttttataagagaaaaagatc
gagttgatagtacggattaaaataatgtcaacttaattgaagagaataaa
ataactatttttttaaaaaaacaaacttatatgttaatattaataaaatt
atatatgtattttatttatttgagaaagcaatttaaaaaaaaaaaacact
tattatgtctcatacagtttttatcattaaccatatgttaacttccctct
tgttattctaaaaagctacccagtgtccaataatatttaaaaatctaaaa
aaaaggctgctaattatttttaaaaaataaaaaatttcagttaaataaaa
ttattttctcatccaccaaagccaaagaataggtgttcattaattgggcg
gctggggtagagtgtattgtactttgcccgaaatgggcctaaaattaagt
attaaaatcataatctgaacccaatcccaattttagctttggaaaaacag
aaacaaatgcaaactttgtagatggaacaaaatcaattgtgtttactcat
tttcattttctttcgcgcatattcgacaatatcaatgatcaatctcatac
acgtgtgtctttgctttatctagacaattttttttattaaaaataaacag
atgggcaaaggcagatgaagttggaagaaaatacatattgaaccctccac
cgcaaccgcttccatttatataatattcgttggtgcaatttaagacaatc
ctccatcaagtaattaggatttatatagaataacccatcatatagataat
atcaatctccttgcttcccacgtttttccgaccagagacagaacagctct
atatttcagatttcatcaaattcattacttaactattgctaaatttaata
cttgtgtagtatttgattggcattacctttaggggaatgtaactttaact
atgtttaaacctgtttttcttcctgaaaaatattataaaattaaagataa
ataatttttttatatgtcctagattattatatgttataacgactgttgac
atatttgaaatttgaataagattacattaatatttttgtttttctaataa
aaatgaataaaaataaaaataaaaatactaaagcaagatatacacgcgtt
cgaatctcaaaaatccattgtattaaaaaagaacatattgtaccggtttt
aatgaaaaatggcaaatgatgtcgattttaccctcccgtcttatccactt
cccttcaaaaaaggaatttgatattttgaggaagagatcaggaatttgtt
agacagccttatccacatcgttcgagagaatcagtatacacgtggcgatt
acgtagaatcttgaaattttcggccgctggcatcgttgatctgttacaac
ttaaaaacgtggctctgaggctcgggcctcggttcagccgttttttgtcg
ttctatcccaaatctcatttctccccttccatcaaccacaataccaccaa
acatgttgaaaatatctaccaaatgaaattttaataattagaaacaaatc
tatacaattcaggaatactagattaacgacaaaagaagaatccatgcctt
ctacttatttgtaaaacaaaaaaaaatagtaaatatacaatattatttat
ttagtgaaagtttgtagggaagtggatacttattttaaattttaattttt
taggataagttttaaaatattattttatattatcatctttaaaaaattat
ctgatttgatattggattaaagagtttttttatacatagtatagaaaata
taaatcaaagtaagcttaatatattctcgtatttttatatttatagaatt
agacatatttttattcaaatttaaacagtatttttcaaattataatattg
tatattcttttcttaatttttaaaattgtgtataattatcatcaacaaac
actgtaaaattgctaataattttattttatatttactatcaaagcaaata
atttttattgaaaaggaaaactaaaaaaaaaaaatcgaaccacacagaac
agaactacagaagggatacaagcgtaatttgggaaaagagtttttttttt
tttgagataagggaaaagagtttcggatgttgcggtgttttaataatatc
caaaagaaaaaagaaaaaagaaaatctcatgtatatttttgtccaccact
catttgcttactctataaactcttttttctttccatctttcattctccga
ttttcattctatttctttcttttcgaagatcttagatcttcgaaaacctt
attcatattccacattctaatcaatcaggaccgcccttcaacttccgaag
attctccttcttcgcaataactttgttctgatcgttgatcggcttttgat
tctttgatctttgtataggtaatatagttgcctgttttggaaacctttcc
aggtgtaaaattttatctatcgaatttcactttaatttacgctttaattc
tatcatgtctaatttttgaatcgtaggatcatccatcctttttaaatata
gaggatttctttattgttttagtttttaaattcagagctctaactaaaga
aaactaaaatgaactgtaaatttcatttgaatgctttttcatcagtacac
ttcaagttatgaatataagacatctgacattttagttttttttttaattg
tgggtgtaggtagtgatcggagaaagatggtttcgttgcaaggaccggtg
atttgcccttccgttcacagcaaacaggttggggttgacacgctgatgtt
gaataggccttctccttgggcgaggttgcttagaagtgatatatggggac
gtacaagagtgattgatggaatgaagtctcataaactgaaaatacgatat
tgcaagaccatggtgcactgtagtttcagttcatcttcagatgggagtgg
aagcatggctgagagtttcaatgagaaggatgaagattatgttaattcca
ctgtggttgaaactggtatatgggttctcattaagccagtgattgttggt
tggttggatgtttgctgctgccttttaatttcgaaattaacttgtgcctt
ttatatatttcataactgtttcatgtagatcatgtgaagagcggacctga
tggatttataattaaaatgagggatggtaggcatttaagatgtattcaaa
acaatccgcaacctggaaatctgccagattatgcaccgcatcctgcgatt
gttctgaagatggaagatgggactggtcttcttctcccaatcattgtttg
tatgtgatcttacatgatcttagtcttttttggatccatttattaccttc
ccagtcataattgatatggattgtggttttgaatgcagtggagatgccaa
gtgtgttgctcatggcagcaatgagcaatgtccaaattgtatgatatcat
tttcacttccgcgttgagttttatttggatttctcactcggttttgtttt
gaatatggatgctaacatatgttttggctattatctccagcctagaccta
caatgtatcaagttgttaaggacatgattgaaaagatgggctactcggta
tgatttcttttcctgtccgaattcccttatttcaaccaattttattttta
ttatgataaatacctcattcttctgcaggtaaagcttgtcagagttacta
aaagggtgcatgaggcctattttgctcagttgtacctaacaaaggtacgt
atgcacttaagcgtggaacatatgattgctctcttacttactgaaacttt
taactcgggggtagtcttcactgactcatttttggtgttgtcacaggtgg
gtgatgaaacagagtctgttagttttgaccttcggccttctgatgctatc
aacattgctgtgagatgcaaggtaaactttatatgttagtctcttgtatg
atttttggactggatcgaatgtttatgccagtttcatgattaacaatact
tgaagtgtatgctaggacttgttagatttttccctctacagtagtgtata
accttggaaaattggtttttgtgttgttgtcgatctgattgcgggaatgc
tgtatccactgtacagattatagaagcattcatatgctttctcattgacc
tcaggttgcttttcccctttctttcttttggttttcttgtccatttaact
agatattgttatgtgaaatatgggtttacataaagtattatgtgtccctt
ttttttttgttttactttctggactgaatacactctccataagaatgtga
aagccttttggaacgatgacctttgaaccatacctgacctgctatgcagg
tacctatacaagtgaataagtacttggcatatagtgatggaatgcgagtg
attgaatcagggaagctgtccgtacagtccacagcttcagatgttttacc
acatgccgaactggaccagttagtcttggaatccctttggagattgcatt
tgctttctttaccgatagaattagactcattaaaaaattgcgtgagattc
ttgtctctgaatgcggcttaccttaattaattttccaggccaagtggtca
gccttgtctcgattcagaggagttcaaaattgtcggcgacttaaatgagg
ctatttctcaggaacgttacaaggatgccggtactctccctgtgtctttc
tcagacattgcattgctgtttaacataggcttaagccatttgtcttttgt
ccaatagaatatctatctaattatgattaaaaagaagactggagtgtaat
tagaatcgtagcatcgcttggaccttcctcttcatttgtcagattttttt
tttgtttgttaattatcattaatatgtttatcatgattctgatgctctct
gacagctgatttgagagacaaacttgataagttccgggcagcaaggaact
tgaggaaattcacgtgacaggtaatgtttataatatgtgaatcttgaagg
ggctttagttaattgtgtggtagtgtctcctctatcatctctgcctatct
gtttttttttattttttatttaacaaaacttgtaataatttgttgcagtt
gtttatgcttgagttttcaagtgtaaatagcagttattgttgaagctgac
atctatcgatccggccgcaagcaattgtttctcatccttttttattaatt
catatcaatttatatggaatagggaagtcccgtgaatatatatgtatata
aataatctttgtacagatatagttagaatattggtgacaattattattat
tattattgttattattatatgttaaagcacgttggtttatgatgacgctt
aacaatatatggttcttgtttcacctgctaccattaaatccaattttgaa
gtagagatataataaagccgagttgtttaatattaatgaactaacaagaa
atatttataatgttttccatttgtttactgttttgaatatttgaatttat
tttctttatatttaatttaatttttataatattattagtagttttaaatt
gataattaaattaactttttttagaagtattgattctttttttctttcaa
tattcaagttgtatacaaattaaaaatactatatatatatgagatcagtt
aattaattttataaaatacactataaataatgtatattttactattaaaa
ctttataaaatattgaaaattaaaatatattaataaaaacacaatctagt
agttaggagtagaggtgttcatgagtcgagttgggtcgggtttgaataaa
attttaggcctatttattagttttgggtttagttcaaaaaataggcctaa
aattttaccaagtctggtttaaataaaaatgtaaaatttgagccaaatcg
tattaaattttttatattatttttaatttttctaatttttaaatataata
aataaaaaatattaaaaatattaaaataaatatttctcgacaaattgaaa
ataaattaaaaatatgtatacttaaataacacaaagataggaataactta
ataagtaaatgtataaaaaaataataacaacataatagtgagcaaaaaga
aagtaattttttttacatattcaagctaggttaagctcggacaaaaaaag
ctttacttgaggttcgacccgtcttttaaacagattttattttttatcta
agcccatttttttgtttatatttttactcaaattttcctaccttttagag
cagtctttaggccgagcaggtctagttagagcacttaaaatgtaattttt
ttatttagtactttttaaaatttttaaaattttaaattaataaaaataaa
attttattttaatctttttaaaaaataaaaatttaatttaatttttcaaa
attataaaaatataaactattgagaaaaataaaagtttactataataaaa
tttacgatttaaatttgacaccactaaaaatattttttagcttcgccctg
aggcacgacattgatatgattgttttaactgtaaaaatatcctgccctgc
actttgaacataagagagaataaaacagttaaaggcaccgacagaaactc
gttttccgtaagcaaattcccgtgaacaatatctactcactgcagcagtt
tattaacactaacagtttacttttcaaacggagagaaagtcggtcccccc
atcccatctgggtccctttcctgtttgacgtttgctccgccgataattaa
tatataaataatatttttaccttttagttttttgcgatgtatttatgtat
taatttatctctcttttgtttgttttgtccgtctaaacctgagcagccac
gtcattcccgaagatcgatttcttcgaactgccgtttcctttttagatcc
cactggtaaaatcttcagttccttcgctactcccattgatttcggttccc
tttctaaacaatcgtatccacgttctggatcgtgtgttgcacttttccac
gagactgatccttcaaacatgtccggcccgctcgatcgtttcgcaaggcc
ttgtgagtggaacttttctgctgccaagtctatgcttcatgcttattagt
ttttttttctttgatcgttacttgctgcatcgtttgaactaataatattt
ctgaatatcgatgaacttgttgtaggttttgaaggtattgtttgtaatga
tgaaaggaaagacaggaaatcggatttcgaagtctctgaagatgacagga
ggactagaatcgggaatttaaagaagaaagcgataaaggcatcgagtaag
tttaaacgttctcttaagaagaagagtagtaggaggaaaagtggtctctc
tgtttcgattaaggactttcgtgatatcgaggagctgcagactgttgatg
ctttccgtcaggcattaatagccgagcagttgcttcctgctaggcatgac
gattatcatatgctactgaggtacgtttaaaatccactatgctttttatg
taggattgcttcaacgatttttaccgatgcaaaattggtttatttgtact
gtgcttggtggttttcttgcagattcttgaaagcaaggaagttcgacatc
gaaaaagcaaagcacatgtgggataatatgatccaatggaggaaagactt
tggtactgatactattttggaggtgatcccatcttattgcaggaatggtc
ttacttacttactgcattagatatttgcttctatccttagttttaaggac
atgtataactttttttttccaagttgttattcacttgttgcctgcttttt
tgtagagaaacactgacctttttgtttttttttaatgttattatgattta
accaggattttgagttcagtgagttgaatgaagtgttgaagtactaccct
caaggttatcatggggtggataaggaaggaagaccggtttacattgaatt
gctaggaaaagttgaacctgacaagctcatgcgagtcacaactttggaac
gatatgtaagataccatgtgcaggaatttgagaagtgttttgctattaag
tttccggcttgctccattgctgcgaagagacacatagattcaagtacaac
tattttggatgttcaaggcatggtatgttttatgttgcttcttatatttt
agggtcctccctgccatcattttatgatggcctaacaagagtctatcaca
gtatttgcatattgatcacttccagtcatttttgttctcagggatataaa
aactttaccaagactgcacaagatcttgtgaggcggctgcagaagattga
tggtgataactaccctgaggtagcatgttcgtcctattgctaatctgctc
agatattttgtgaatatagcttgtgttatcagcattgatagaaatttgtc
aggaatgtttattatgattgcccttctacagactctttaccgtatgttca
tcattaacgctggtccgggttttaaaatgggcctgaaagctgtcaaatct
tttcttgattctaaaacagctagtaagatcaatgtaagttcaaaatcttt
gtataatttggttttttactagagttgaagtatggactctcggttactgg
aagttacctcatttttgaaatttctctcaggttctgggtagcaactacca
gaataagttgcttgaaattattgaagcaaggtaataaaatgtttttggtt
gctgatatgtgggttaattcacatttagttgtgctggaaagtaaagggtt
ttgatatattgaacttggttagtgagttgccgcaatttcttggaggtagc
tgcatttgttctgaccagggaggttgtatgagatcagacaaaggtccctg
gcaagaccccaacatattaaaggtgtaatatgcactatgtgaataaattt
gggttattttccaatctccttcattttcattgttatcccatacatgtttt
aagcaatatgaatgctatcttaatgtagatgattgccagtggtgaagcac
tatttcccagacagattgtaacagtttcaaacagtgagggaagggtaatt
gcctatgataagccatgttatcctttggtacggttcattatttgtctttt
gcagtgcatattataccttctcagctttgtattttgcattgttagaattt
aatcaaatattctctaatttttatttctgcattaaatgttcatcctgaat
cagataaagagtagtgacacatctgctgctgagtcaggatctgaagtgga
agaacttgcttcccctaagaaaactagaagctatttacatccaatattgg
ctcccgttagtgaagaggtagatagttgcaaattgcttgacagatttaag
tggcataaaaggatttcattcgttacatgctagattcatagtttaaaaga
ccacctaataccagaatagttttcttctattcaagagtgagtatatatgt
ggatgctttgctcactgtataaaataacatggtagcaccctaagaagtgg
aactgcactttcagtgtcagactataaattcttcaatcttgaagttgtaa
caacataccatgatatttgtataggctagaatggctggcaaggtgatctg
tggtggtggttcgtctgagtatggtgagtatgttcccatgattgacaagg
ttgtagatttggaatgtgagaaacaagtgtcacgtcaaactctatatact
tctgaaggttagcaaaatgagctacgttaaaaggtattttatttactcat
cttttcttttttcttttttacttcaatgaagcctactatctttaattgca
gggactcctctgctgctggaaaggcaaactccaaaaggaatctatggtcg
tatcattgctatagttgttgccttcttgacttttttaacatttatccaaa
caatggcattgaatctgatgaaaaagaagagttcaactgatttaacatgt
agcattcctgagcagcatattgaaccaacgtacaaggaggaaactcgtcc
accttctcctgctccaaggtttactgaggcagacgtcctgtcatctgttg
taagaaggctgggtgatctagaagagaagattgagatgctgcaatcaaaa
cgatttgagatgcctcatgagaaagaggagttgttgaatgctgctatgta
tcgtgtggaaatgctagaagcagaactaattgctacaaagaaggtaacca
ttctatgcttccagctccgagtatagattatctcttccatgccgcgttct
taggttgttacttgtgagtagccttaagaagcatttcaagcctgtcttga
tctttgtcccaaactgttctactcctttactaaatgaccggagcctgatg
taagaggaggctacagtggtacagcaccgtttgttatttgatataaggat
tccgtaatgatgcatgttttcttgtttcttgacgactgttgtttacatga
gcaggctctccatgaagctataattcggcaggacgaactccttgcacgca
tacaaagtgaagtagtagtcaaacctggggtaagtcaaaagataatcaaa
ttcaaccgtgaactgatgcaatatgattaaattttcattagttagataaa
tgatttgtacgtttgcatgcatgatgcagagaaggaagctgttttgctgg
tgcaaatgagaatgagatgtatgtaccgaaaagaatcgatcaaatgttca
ataatatttgtggtgtgtgtatgcatgcatattgaagatggatagaaagc
tttgttggggtgatatatcagattatcagagtcgaagggaaatgaggtgt
aaataaaaataccaaacagaagcgtgtaacagtgtcattcggaccggctg
gttttgcagtggtgaatggattattttttttgttgggttagtgcacattt
taatgtagtataaaatgttgttttgttttgtaacacaaatattttgtgtt
attgtttgtgttatatctttttgttcattgtgtttatgctatatatacat
atcaggtttaaagaattatttattaacatattaataatttatgctacata
aataatgcatttattttatttatgttaaaatatattatattaaaaatgtt
tatcactgttaatttatgctatatatacatatcaggtttaaagaattatt
tattaacatattaataattgattaaggtgttaaaaaatagtaaaaaataa
ttacctttttgtgtaaataatattatatttgtgtaatagttttccttttt
tctaaaaaaagaccaaaaagaatgtaaatcgcaatgaaaaaagggtcaat
aatatttgctggactccctccatgaccgtcggtgtttcaaacagaagcag
agcacctgttctggtcggactcttttggtggtttgttccgatgttcaaag
attttggttattggatctcattttcttctcaatgttgacgcgtctgcaga
gtaacaaacttttctccaaggtttgtatagttatatggggtttcctttct
acactttcgcttgcgtcgtattatctgacttattgttctcgcgatctgcg
tttttatttttaggttcttctgagtcgttacaaaaatgggtttcccaatc
ttatctctgggtctcaatttttaagaggttttaacgagattgcaaagcat
gggttttctgtaatgtcgggtgataatctacggagcctatctaacagtgc
ttccccgaggaattaccgagtcgtagtggctgcaactcgtgaaatgggaa
tagggaaagatggcaagttgccatggagattgccttctgatctcaaattc
ttcaaggaacttacagtgacaacatcagatcctgagaagaagaatgctgt
agtaatgggtagaaaaacctgggagagtattccacttgagtttagacctt
tacccggtcgcctgaatgttgtccttactcgttcccagagttctgatatt
acaactggagaaaatgttgtaatatgtgggagcattccatcagctttcga
actattagccaaggatccttattgtttttcaatagagaaggtgtttgtca
ttggcggtggccagatattcaggtagattttttagtaaaagttgttgaat
tttaattgcatatttgttggggaaagataatgttttgatgttttacaatg
cagggaaacactcaatgctccaggttgcgaagccattcacattactgaaa
ttgggacaagcattgaatgcgataccttcattccttcaattgactcgtct
tgtttccagctgttgtactcttcgaagccattggaagaaaataatgtccg
gttttcatttgcaacttatgttcgtgttagatctaggacaactgataatt
atgaggtaaaagacttgagtttcttgcccaggatgattgttgagagacga
gatgaatgagtcgattagtaaatactactgagacttgttcatgaaactat
ctcaagtggcaagcaagatccttgactggttagatgcagaattcatttgc
ctaggtagtcttaaactttggttctctatgactctactgctctttgcctt
acattttattgttgttgctgatgtttaaatgtaaatatgagcatcatccc
cagtccatgttgtgatttggtacaatgtaagtctatctttgcagatcttt
tcatcttcttatataactaaggtacttacttatgttgttgctgtacctta
ggttggttcttctttatcgaattcattcttttttttgtacaaagattatc
ctgtccatagggaatgcaaattttggtgatcaatgagcaaaagaaaagac
tctgcatctttgatccattgggtttttaggatgattgtaaagagaaatag
aaagattcactgcccttttattagcattcaattatatttctctctgaagc
aatgccaatggttgtcttgttgtatagacaattacattttacataaatat
tgtacaaatgtttgagcagcaaaatggcgttaagataatggcacctcact
caaaagagaattgcaggaactgttgtgctttaacttgcatcaaacacatt
caattatatgaatctagtttgtgttagtatattgcctggttgagaagtga
agggacggttttggggttgtgcaggttatttatttatgttttttctactt
gcggtttgagcaatcacaatttaggccttcaaaagcaattttgcctttgc
atggagaacccttttcttttttttggggggttttaggtaggtgctttgcc
acctttcaaggccgaagaggtaatccaatatctcaataaaagcccataag
gatgaaaaagctaaaagcaaggcagcccaatgatctgttattgaagcctg
gtaatgataaaactctcaactagggaaagggtaattaaaatgatcattct
catgctgaatatagtcgggaacggtaggtagaagcaaggaagcagcatta
ataataatagccacctaaaatgttgtaaagtctttttcctactaaaagga
aatggatcaaacgtgttgatatcatccaagtaaaatagacagctttcata
gattaatatttattaaacacatctccatttgtatgaaaactgaccactcc
attaccggcaatgaggatacattttgtgatttatacaaataatccaactg
tcacatcgcttctaattctaatcagaagccaatgtttcttgtgatattac
tactatggctttattgttttttaaaatttatagttaaaaatatttgtgag
ctcatacaagatgcatcaagtttgaaataaaattaattacaacaaacctc
atttaattattgttccattttaattgagcttcaaaatattactatactaa
acaagtgcttctgttagtttagttattaatttagatgtaaaatgctttca
cgatgaaaatgtaaataatgcgttcctatttcatggacaactgattttaa
tttgctaaaagtttaaactacgttaataaagtttgaaagagttttttttt
taacaattaaatctaaactattatatggtaaatacacacgtatttatact
ttaattcatgtaacgtgtggaaaaagttaaataatttaatattaatattt
tttatgtgaagctagagttaaaaagaaaagtaataaacatagccatttct
aaccattaatgggattattccaactaatgggatgaatctctatattcggg
aaatgtgtattttgcagaaaataaaatgattgataaaagaaatataaacc
ttttagacatactaaaagttggccatgaaacatcataaggtttatgatat
acaagggaccgaaaaaggctaaatatgcttatccagagctacttgaaaga
tatgaagttcctctggcacttgtcattttgaaactagaattctagatatg
caacaaaagcttacattgggaatatggggggatcttaattttacagaatg
gaacaatgatggtaaagatcatcatgcacaacgtaccaaacttcacatct
ccggcatgtctttggagagtatatcactacatctttccggctatccttct
tctcatctttcttctcatccttcttctcatccttcttctcctcttttgcg
gcccctatacttacgatcgatgcgtgtttacggaacttcctgactttctt
aatgatcttaaacggatcagcttcgccggtaaccattaccgtatttttcg
atggatcgagggtgatggacgttatccccactagctctgaaattacatgc
attaccttctgcctgcactttggacacagcagctcgactgacaggattgt
tttctgcaacagccaaaacaaagagtcagattctatgttactttgtccct
gctcagaacaataatatcctatgacaaatagaagtactgtaggatgtcag
tgcaggctgcagggagagaatggcagagcaggaattgatgagttcaaaat
taaatgcttccacagaacaaacatcaaattacatatataaaaagcgcaaa
tataggaagcaaaataggtatcaagggaatggaatgaaaccttcgacatg
gtgtttttgaataaagcagacacaataaacaaagttgtataagacttagg
aatgtgaagaagcttttttttttcaatggatccaagcagtcttactctta
tatataaaattattactacatctctctcaaactttcatttcattacatgt
aaattttttgtcttctaaatatgtttgtttttttacttatggctttggat
aaaagaagttttgttgggaagtaaatgaactgacagtattagttggtgag
aagtaaatgccagtcagaagatgtttgattgtttaccaatggcaccttgc
tcattaaatgtggaatgtttacgcacatgaagggaaaaaacagaaacctt
catacttgggagttttcactcatgatgatgttaacaagttttgaatggtt
tccctggctcacaaatgtatgttctttcaattgctaaaactaaatcatac
aaccagtatgacattgacgatttcatgctatgaaaagttcccagtcgact
gagcaaataatcatttgtacagagtacagacagtgggatggtttatccga
gagatatcagaataaccagatggaacaacattttcttgtaattgcagaac
actgtcagacctatgactcaccttgagtttttcactgcaaatttagccgt
gtttctacggttacccacgcgtccctatctcccccattgtggacatgtga
tgtgagaccaagcctgtctgcctacgacccagacgtcctcccttcaatgc
tcccatcccctcgagttatacaaaatattactcaattacacaacttccat
aatgttctgtgtagtcacacaaattataacatttctaatgttttgtatag
ttgcacacatttcttaattatataattttttataaatcttgtaatttttt
taatacatatcgcattacattttccaattatacaaactattacaattttt
ttaatgctttgtgtaacattgaagctgatggaaagctcaaattaaggtct
tttgagaattttagttgttgctctatgagtcttatcacattaaattagga
aaaattacacaaattggtcaggtttagaaacaaatcagagaacaaaattc
attagttggtctttcaaacaaaaattctgctctcatctcatcaactttaa
tgcaatgagtactctttctcatcaccataaattacaatcaagttagccac
acacaaaaaagcagtacttcaatatccagctgtatgattcataatttggc
atgtagaatcgagatgtaacggcagtgagtagttggcacatcactttccc
tgttagcccaaacccttaccttatgttccgtcattttgatatattttttc
accaaggaatgttaaaaagctctccctcttaaacctgatgagacatgcca
atataaacactgaaagatataaaatgcattacctcgttctaagcaaagga
aaaagatgtgaagttcgatggcaagaatagatgattattgacaacttgga
attttacttcaaggggctgagaaatatcatagctttataaaacatgagag
cattcatttatttattcgactaagtataggaatagcagtaacatttttgg
tagattatcaactaaccatactctggaaagaggatgcacatggttatctg
attttatggcggtccatgttgcatggattgtacaacaaattggaaaagga
ttaaatcctttgccaccaagtagtaccttagacatgggtaagtttgatta
taaatccataaatacacagctgctgtgaaagtagaggaattaccagaagg
aaaacaaaaaggatatcaactcaaataaatctttaagcaaaagatacaca
caagagattattttctccaagggaaatccaaaagccccaaaaagtggtga
aaggaagaacttgagcctaatgacgagttaatcatcttggctccttgcaa
cctttacttttacaacaacagttcagggatcatataataagaactacttg
cacttaccagtacaaccttcagtaaacaaactgtcttctaatgcgtatct
ttgatctcgtacacttccattggagtttattgtaacagctttatctgttt
catgctcagttttcaccatctgagaatagcagctaacaattttcttatct
aactcgtaataagcctccattttcttcaagggtttcagatccagatcaat
gaaatacacctagaaatttgcaatttagataagatatgcatgtaaaatga
gaacgaagtaagaaaagctgccatagatgactttgatttcagcccaaaag
aatttcttgttaaacaaagagctatataatgatttttataggtttattta
taaggactgagcaaattatcatggccctaatggaaattatatatgcaaaa
gaatcacaaaaatttgacttcaaaatcaacccatgcatcaaaaacatatt
ttgatggatcaatttcatatgccatgacgatactaatacaatactatagc
aataatgatgtagagtatgagtcaaatgaaaatggcattggaatctacct
tgtactcaaaagcttggttagttgatcctagatatacagtattgtaagaa
gggagtctaccatcttcctttggtctaaaactaatcatcagactacagtc
cttcgcagttgcagctatcagatagtcctttacaatcttcaagctttgat
ccaatggaatggagtgcaaagaggtatagcggcatgataatttatcttta
cacaattctctacagaccatacaaggttgagaaattatgttgtaataagc
atgaatcgccccctcaatgtcataagtatcaagcttctgaacttcaagaa
gttgttctaaagcaccagaaatataaattgtctcagcaacaagctgtaga
aaactagttgtgcgctggccattatctgcctgaatgacattcttaagtat
atcttcaaaggcctcaccaacctgaacagtagtgctgttcgtgccaccac
ccaaacccccaaatacaatagaaccattcagaaatacacggaaattgttc
tgaggagtggcatacagagcttcaatagctttttgtatcccttctctgga
tccagagaataaatccagcggattatattcactatattctgatatctgaa
atatttttgaaatgtcacagatatttcaacaaaatggccatattggccaa
tatatgggtcagaaagtgctacaaagagacacccttcccttgcatgttga
cacagcaacaacttagcacccagaaaaaccccctactaatatgaagatac
ataaagttacctcttgattatgcaacttcagtgcttggtgcattctaaac
cgaactacatttctcttaacagcattttcttcagttatgaatcttgaaaa
tgggagaaatccacatttgggctacttcagcgaaacaattgaagttaaaa
cttggcgaagcaaatgaaaatgaagaacacgccaaaaagacagttgatta
cacaaagaaattgaggaaaaagggcatacgaagaaatctacctttatctc
aacagttatacatggttcacctttaagattacctgaaataaaagaaagta
caaccatataaaaaacaaacggaacctttgctatatttaaactaatttta
atctaggttcatctttacttagatttaactaatactctggcatatgagct
aagttctaggaaaacaaaaatgatgaagactgcaagcatgtcttttagtc
ttcccaaattgttgaatatttcccacatcaattactcagtgagagctact
tcccagtcctttacctacttccagtctgcacaaagtaacataagatctat
aaatttccgaacagattacacactgagagccacttcctaatccttccctt
acttccaaacctatagcaggaaaacattttgtcatctgcattctagtaaa
agtcctctagtagtactttgccctcacaatgataagatggaaggaagcta
taaaactattcaattaagctcagctggataggattacatagtcatgcctt
cctcagtctataagagtgacaaagaagatatcatcccttcacattgataa
gtacaacatgagaccagcagaaggtcaaattaccatcgggaaagatcgaa
tgatcagataagattagcacagaatcacgatttacatcaacctgggatga
gtgaactcgccaagcaggccggtgacaagtcacattcttctcaacggact
taaggaattccttagtaacaagaacacgaatctgccaaagtcaaaagacc
aaaatccaaaagcgattacaaagctcatcgaaccaaattaactaaatcag
aattataataactagaacataaataaataccccaacatcgacatgttttg
gacctaacaatgggatcataacatgtttgacgtaaagctgttctagaatc
tctctgtttgacgacgccgttagctccttattttctcgccaaagaagccg
ttcatgcgttgttaaagctctgccttctttcacgccactgttgccgttcc
gttgcgacttttgtattcgcagcactttcccaatcttataataattattt
tatcaaaaaaaatccaaaaagaaaagaagaagaagaagaagaagaagaag
aagcaagcaagcatgaatattcacaaattgaattttatactccaccccct
tcaaattcgaaatttcaatggactaaatttaaagctccgagaaaaaaaga
atcagttgaagtacttacaaatgcgggagacgatccagtgtaagcgagaa
taagattagcagctccttctcctctatagatccaatcaactgcatccttt
tcctctaaaatcactttctccatttatctacggcggctgctattcattca
ccaaaaacagaagctaaagccaaatagggaaaaaaactacaaaagaaaaa
aaacaagaattgaaaagctctgaataccagatcgggatatcgaagaacaa
tgtagattgtaaattaagttaaaatctctaaagaattgagaaaatcgcag
ccgaaactatcggaaatgtgaaaatggattgagaagtgaaaaaagaaggc
gttggagaaatcttcttcggctttgtattttttataaaaggaaaaaaggt
aggggagagagataaacccacagctggcttttttagtttttacttgtaat
ggaaaagagctagactttctctcggattttcgttgactaaaagacaaaat
taaatttgtaggtgtattgaggtaaagtattgggaaacgcaacgttgtta
cgtatgcgtaaatgagcgagcggggtatacgtgtcattttgtaaaaaaga
agtggtaatttacttccttggaactgttcagatcatgctagtaaaacaac
aaactttacgtttagttatggcgtaaattccggttagtatcgattgtatc
gcctgaaatatagtctaccaatatgtagcaaaatatttcatttttttaat
atttattttgaatttctttaattataaattattatatgcatgctttatca
aataatttttttattattttattttgtgtttatttaatcatattgcattc
gtaaagcttattaaaatttattttatataattaattagtatttttttatc
ttaaaatatacatatggtcagatttgaacttatgccactaatgtttttaa
aatcttttatttaccacctcaaccaaaatttcatttttgatgagtatttt
ttatttgagatttatttaacctcgttatttgatatttgtaaatgcattaa
atattcatatgtctaatgtttttaaaaaatagtaataaacccaaaacgat
acaacaaaaagatcgataccagtacatatcaataccaatagaaaaactat
atacttgtcggtacggtactaactaccttggttcaaatactaaggaacca
cattaaagtgtcacgagtcatagatcaaagcccgtgatgaatgcgcaaag
agcatcccgtgaaggtcaactgatgaaatgtggctcatttcttgaaattt
ttatgaatttgggatcatgggaacttgatttaattagttcatgtatcaat
ttgtaaaactgttaaagttttagaaaattgtcattgataattaggcttga
ataattggtagagggagtagatacctaaaggatgtgtagataattaattg
gtgaagtcacgtgtgatgtggattgaatcaccaatcatcgatcgtgactt
tacagattaattatctacacatccttcatgtatatactccttctaccaac
taaggtgttctcactctatgaacctttgggacttgtcatggagtcagaaa
ataaaacccaaatctcaagacaataactataattgttgggattgtatcaa
ctatccaataaactatactttaaaaaagagtcgattctctgaaataatta
aattaaaatttgtgattgggtacgtaagaataattatgttggtgataggg
tgagagtagtaagattcgaaattccaagtggaaagcagaacctaaaaatt
gattccaaatagttggatattaagaggggattagcccaaaaagatgaatg
attccctcggctaagccaagcagctaaaaggtgtattcttttttgaaaaa
taaaaaaaagaaggaagaacaattaccaaaagtaattggtgtcctccgac
aatagataattatctaactttgggtcaaaaaatagaggaattttgttttt
tatacataaacactttggatgagtaaagagataaaagggaattaagacac
agggttttgagatttagatttatgttttgaaggaagaaagtgaaacatat
ttgtttaggtttgttatacaacagacttctttttggaatcaaaatgataa
gaaatggtacaaatttgggtgtgtattccgagcgtgctataaaatttcct
aaaaactcgtctcattcatttttctattgcaataataataaattacatat
atgcttttactctaattgtgtttcttttttctatttttgaaattacgcat
tcattgtaaagacaaagcaacatgcaacttatattaggacagttttaaaa
attaagattttttaggcatcgatccatctatttttaaagagatgaaatta
ttattgtatactcattcatattcaacctattccctaactttaattgtaat
gcccttaaaacttcgatgtcataaatagcactattttgagaaaacattta
gtgaaattttccctaatagtaaattacatttaatcgataaaatttagagg
aggttgttgaatattgaagaaagccgttagaaatgatatattttagtgta
ttaaaccgagatataaactaaattgtaaagaagtaaaattataaaggtta
aaagtgtaattatatcaaaaagtggtcataggggtgaatataaaaattat
aaaaggtaaaatggacaattgtcaagaatatatattaagagtttaaaata
aaaaaaatagaaaagctagtgtacttttggatgattttggatcaatagaa
taagtggaaaaagaggtttaatttgtattaaatttaatttttttttaaaa
tgttaaggaattaaattatgaaatattattaagtctagtgatcttgattt
tcacattttgctttgagatataaatattttagtaactagtactcaagttg
ataaccattattttgaaagtcaaattgcttaaattgattagatgattgtg
aaaatgtcattttgaaatgctaacatgattcgagattatgaaaattattt
ataattaattatgattttgataaataaaatttaaatcaatcagatatata
tgatatgccattaacaattttatattgcacttattacgcataacacactt
gtgcttttggtctattgcaccaaagatgcaattttatatatacattcatt
atttatataatctcttatgtatttgattcattatttactgtatttttttt
cttttttacgaaaaactaatgaccaccatttcaacaaaagcacaaactaa
attggtgactcaaccgacggtgactgcccctaattaatgaaacgaaacag
aaaccaaaaactagaagaaatacaaaaaaaaagaaaacatctatcaactt
aacaacttcgaaaaacataaccagaaattaaaagaaaaaaaaacaactaa
agcgaccctcttgaaaaacacagcagccttcgtctccatggaactattca
tcagtatagctannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnngaagaagaacgaacgaagattgccgcccccagtcaagg
gagaagactgaagtcaaggggatgatggtatgggtaagaaattgtaatgg
tggctgcttataaagagaaaaactggtgggggttgtgcaagttggcgaat
ttttttttggtttgggccaatacgaagatgttattcgcttgctgaagcaa
ggctttaatggacaagaatccattgtaaaagaactaacactttataaaaa
tctttggtttgtcttctattatatcattaacaagttgtttttattttttt
ttatttttttttgagaatttatcagattggtggggattagatccccaaac
agagtctacccattagcgtagatgcttcaacaataaaatctcagatcatc
cttttgaaacccagcaaaatatacagtaagatatccttccaatttttgag
tgggaggattggattttcttcccttcattattctgtgcacttggtaaaat
atactctatttaaataaaattatttatgtttattcttcttttctcaaagt
agtactatcgagaagattagggtttgaagcagagaccctgcgatcaaatg
tgacctgatactacctcaggatgctattagatggaaggggctgtggttca
gttttactgcctaatatatggtgactaacttgtgaggtcctggaacggtt
aagaaaagctgtatcaaacttgaggaacatttatccatctttttatactt
aactaccggctagttacgtgttctaaagccggcgggaactttagattttt
ggactttctcgactgtgcggtcatcatcgggaatatttttcccttttttt
ggggttaaactttgagcatagaatttagtacgtcatagatgcgggaactt
ggaaattggagatttggcttctgaacaacattccaagccccccttctttt
tcctgccaggcagaactgtttggtgagacgtgcggtgatactctttatct
ttgggttgctaaatgtcaacatatgtagctctatcacaggatcctgtgtc
agtttttgaggagtggcactttacttcatccactgttatgtctctaaaat
ttggatcttagaacatagttcaagaatatggtttactagcacgtctccaa
ctctttccaagaaattcgttcatagctgtggcggcggtcatggccataca
tgaatggtaagacctgatttccccccacagtcattatttcttcttgtttc
ttttttatgcaaaacaacattttctttaatatcaaattcaaacttgtaat
tatagtgtgagaagataaatcctgctactacgaaactgcaaacaaagcta
atgcacaagatgtagcagcagtcatatttcttcctaatgctgtcattaat
agaataattatgatggcgcttttctcacatatttaatattttgttaagag
tacatgatatggacaagatggatgcgcagggaatccacagtaaagtactc
tttaggtctttctatatttagaatcctcatcatccaattccaggttccct
tatgtcagtgggttccttattccattttcctggtggagaccgttgctccg
tagtcccttcatatgattgggactgttaaattgcgtggtatcgtatgatt
aatcgtgtatattgccaaagcctattccaaaattttggaagatataaaag
tttggactttttggcttttctattttgaaattttgtgcacctgttggagg
agtctacgatgtctacttcactgatggtagcttagggtaaaggcatgagg
accactcatccagggaggcaaaaacgtgagtttcttatgtttaacctatt
agacaacttgataaattaaagctcatttcgattcatcttattttcaatgg
gatcaaatatattgaccctctcctatctttaatcggaagggcttcggttg
agaggaaatttgaatttcggagaacatttccatttatcttccattcaata
acttttattttgactgacataataattaattctataattattatttattg
atttcatctgcataaaaataatttatatgtatgaaataaagaatgaagtt
tccaccaagtgttttggatgtctgtgggagaaattattaatgttttaaca
agcacttttcgtcaacttttgctatttcaattgcatttttcattgagagc
ccaaatgttgtatatattatttaaagaaaggcttataagtccaaaacttc
tttacaaaagaaaaaaaaatctatttaattcgcagtcaattcaactcttc
ttattaatccaaaagaataattaaacccattttattagaaaatatcaggt
taactgttggtgtgattaacaaaactcctgaataaaattgatactagtag
aacatattgctacatcagcaaattctttaaaaaaattataaaaggttcta
caaattttgaaaaagtataaatatatatatataatattgcttctcttaaa
caaaatgtacaagccagtctattacaaaatatactactgaccatgctctt
catttccttttgtatttccatgttatattactatggtaaaacaaaagcag
ttttggtgcgattctatacgaagcatgcagggtgcgaatgctgctgccga
cgaaaatggcaaagcgtaaagtgcttccaaccaaaatatttacaaccagg
ctgtagtgaatgaacactaccatgattatgccaacagagggaacacgaga
attgctattcacaaacaggttttgtgtcaaagctgcttaagctgattgca
aatgcttgtaaagctgagagtgggtaacgataatccatggtgaaaatgtc
cttaccgatcttgccgaattgcagaatcactttctcttgttccggtactg
caacattttggcttggctctgctgcggccaccagctggaaattctttacg
gaagctactgtaactcgtcctttaaaatttaggcaccaacactgcaactg
ttcatgccatctaggagctttatttctcaatactaggggtacattttgtg
tcgatttcagagttttgaacccaagtcgtgcctcatcattgcaatttgtg
aacgccgttggagtaggagcggtcccgccttgtccgattgcagaggcagg
gatcgagtacatatcacacttcattctcctcggacctctggtccgaagaa
cattgagctcataagagattttggctgtgataaacataggtttccttgga
gacacctgtctcaaatgagttttctgaagggatcgattagtggatcggac
cagagagtctttcggaggttgactgtcaaaaatgttgaacttggttccca
tgaaattagatctgttgatttaacttttcattcttaaactgcacgacaac
caatccttaaagcaaaaataacacatttaaaatcttacttgagttttcca
acatagttgttgcttgatctagagaaatcattgccaactaatgatatcac
aaaatcattacaggtagcccttctaacttttttagcaaccagtaacagct
tattcaaattacccgagagagctgtaaaattcgtaaatacactaataaat
atcagttagatcgacatatcactaagttgaaacaccataagaagaaaaaa
attaccaggactgagacccatatataatcgatatgttgaagttgcctttt
ccctctgaataaagcattcaatcggagtatcccttgatccaggctatacc
cagaaaaataacctatttatttttacccttttttctacaagggaaattaa
tagtaataaatgaagtttacctgctttaaagagatggggaaagttaagaa
gccacattgttcaggggttttaacaacctctttagtgatttgtctccagg
atctgcaaacagaagcacaagcaaccacatctccccttccaggccaacac
gtttcccttgcttccactctttgaattatatctaaaagtaattcaggagg
taaattagcccatcgtccgtgttccgttaatgcagttgaagaaccagctg
ttgatgataatggtgaagaatcgggagcaatataggctcctcccctccta
cattcatgtttttccttcttggtaaatttctttgacatgtttcctatctc
ccgaacaaagcttttcaacggcatttctcttgacttttgcctaaatacag
ctaaagaaagaggataaagcataataataaattaataatcactaaaaatg
ctagaaaatatatatgagatcttaaagggcttgtttttgtttttcccttt
ttggtttttgatatttacctgaaacaaacaaacaaacaaaaaaagaaaag
ccttcaatatttaaaacttttaggggaggacatagaaaaatgtaagaatt
ttcagaagggagagacaaattcattggaaaacaggaaacggaaagcagag
aacttacacaatctccaatcaaaccttgaaatttgtaacctttattttgt
ttataaaacataaacacaggctgtttgattgttttctttattttcttttt
ctctttctctgtccacctatctccgtcgctaccaccgcctcagacttctc
tgcgttagcgagtaccgcaccggctttctctctgattctaatttgaaaga
ctggtgattttttaaaaaaccgttttcctttttctttttaaatatttttc
aattttgtccgttaattttaattggcgggtttttgtgttgcgaggtggaa
actgcattcgggacgcgtggcagacaaacaaagaataaagtgaataataa
aaccaaattaattacaggattttcatacttcatcgtaaaataaaaatgga
ggttttcctatagctattgttaattacgtttgatgaagccttaacttgtg
gttaatctttgcctcaggaatgtaattaatttaaatatattatatgaaat
gtggactcccttttctttttctttttttgctttcatgcatccatgcattg
tatggcaacttgcaattttgatttgggaatggaaggatatggccatattg
gatatggatttttttttttgtcatggatcgggtcacgaaagtttgtctga
aaagtagaagaatctggataaaaatataggttcgaaaaatgaaattgatt
attttctaaacgggtcaagctttagggtttagggttttttaacttgagct
cggcccgacttggcttgaatttgcctaaatttttttgttgctatttgttg
ttgtttgctgttattttgatattatattgctactattttagaaacatttg
cttactaaattgcaactatcttagttttatttaaatataaagattttttt
ttattattttcaaattattgagaaatatttattttattatttttagtgta
tttgatgtattatatttttaaaatttattcttatataaaaaatttaatat
ggacagaccaaattggactagaatttaatattttttttacttaagccagg
cttggacaaaaatttaggaacttaaaaaatgggtctaaatttttatattg
acccgatacaagattagttttagttctaatgggagaagtagaagggttgc
tcaaccaaaagaggagaacaatgtaagcacgtcatcaggcctgaccttgg
ggttgtctggaggtgcggccgcctagggcccaaggttgaaagaggtcaaa
aatattattttttaatttttaagaggcccaaaaaatttaacttttaaaag
taaaaaaaaaaacaaataccaacttttaaggggtaaaaaaaatagctttt
aagggcccaaaaaaattttttttaccaacttttaaggaaccaaaaactct
attttattgttttgcctaatgcccaaaatgtcaagaacggatttacacgt
cataaccttataaggaattgttattatccaccacaaagtaaaaataataa
gatcaaagtctcaaaacatcgaagaaaagttaagaacaagagaggtcaaa
ttactaagtgaaatcaattttctctctttagaaggaatgttgaaagcaag
aactcctaaaattttctatcgaaacaataagagagatcaaactagtacca
aaaaaacataactccaatgatcaaatgtaaagcaacataaatgtataata
aaaacggctccaaagactggaaaaaacccatgagtaagtcgactaagttg
catggacaacaatagaagtgatctagatgtcttcaattagaaaaggaacc
gccaggctccatgaagcaacaaaagcccaaatttttctctctcaacatca
atcttaagatgactagaatcatagttattagaatcgaaccgaattgattg
attgaatcaattaaatcgaaaatttattattatattggttcagataaaaa
aactgaaccaactttaaattaacttttgagtgaactaagttaaaaaatgt
agagtctgtgtttgaatttaccggttcaattgcatttctttattctttaa
taattctaatttttataaaaattttaataacttatttagctaaattctaa
tccaataattatatctatcaaacctaaaattaatagtccgattggttcaa
ctaattgtctagttttaaaggttttggcaaaaatccaacctgggaaagaa
ttggtaaaaagagaagcaaccgaatagctagacctgaacatggattgggt
cggcttagcttggtgcaaaattttaggtctgctttctatgctcgaacccg
acccaaaaatgagtctaaaatattacccaagctcggcccatttttaaaat
gctaaactcgagctcgacccggtctgaccataataaatttttttatataa
aaataaattttaaaaatataatacattaaatatattacaaatattaaaat
aaatatttttcaacaaattaaaaatacaaaaaaagatatagagatgtgga
tttaggccgggcccaagccataaattctgccgatgcttgacccgtttaga
aaataagtataattttttatgtaaagccttccactttttggtctaacgtt
ggaacagaaaagaaaagagaagccgtggaggataaaagagaggagcggag
gaacaagcaggcgactgggataagatttggagttcagaaaactgtaggct
cccatagaaaaaaaaagaaagtcgacaagttgtgttatttgatatcgtga
tgacttattttttcctaaccatcttatcatatcactcttttacattcctt
ttttagattctgattaatggttaattttttgttgtttccaagtcatccac
tgaggcatgtgtttgagattgggcttgagcaaattcttcttttgactgtg
ggtggactctctttcagcccgtttctcacatttgtaaccagaattaatcc
cttaacaactgacctgaccaacttaaaccttagcccattcctgtaaaaag
gacggtggagacaattagacagccaccaacttagaggtaaaggaaccggc
gaagccatggtcaactcacccattcaaacaaagattacattacatatccg
ccattatatcttaaactgaaagtaacaaagaatttgaaccagaaagttgc
attctttgtgtaggtttcaagctatacccaagacttgcgcaacatgaaat
taataatattcccaaattgttagaacactggatttataacattatccaaa
gcagctggagctcaaataaaaaataaataaattgatggttgaagttctca
agtacaagcctagctagctagaggaaaaatcaaatggcggccatggtctg
tccagttcctccaaaaatttgtactcgccggctacttgtgttaggggcta
ccgttggcattttttaatattaatgcatacacggttgcttgaaattcgtt
gtatacgtcacactttcatggcaagaaaatgacccctgatatgtatataa
aacacgacatccaccataatctatgcataaaccagagatcatagtatact
tcatttcttcatttactgcaacaccttgatcatatcaacaatggctccag
catattctagctacctttgcatgtttgtaatggctttattcatgttcgtg
ttggcaagttctcgtgtagatgctttggtaacttctaccgccatacttgt
aagagtcgaccaatcgggaaaaggagactacaagaagatacaagacgcca
ttgatgcagtgccatccgataacaaagagcctgttttcatattagttaag
cctggcatctatcaagaaaagattgttgtccctgctgacaagcccttcat
taccataagtggcttaaaagcaaatggcacgataataacttggaatgatg
gtggggagatatttgaatctcctacattcactgtgttggcttcagatttt
gttgcccgatatcttactattcaggtatatataacaataaatgatatgat
gcttaatagaataaactaaaattttcaataattcaagaaacagtctaact
tgaaatatttatatttaatctttttgaatttgttttttgataatagaata
cattcggggccagaactaaagcagttgctttaagggtatcaggagataga
gcagctttctttggatgtagaattttagcttatcaagatactttgctaga
tgacaatggaagacattattacaaaaattgttacattgaaggagcagttg
acttcatttgtgggaatgccgcttccctttttgaggtaataaaactcagg
aatataagtaatatataatgattttgccacttgccaatattcctatacat
attgttcgcttgtctagtaggctaaaccattgacatacatatgcattttt
ttttcagaagtgccatttacattcactctcagaaggagatgcatctataa
cagcccaacggagggagtctccttcagaggatacaggcttcactttcttg
ggttgcaagataactggcgtaaggagtgctctactaggaaggccatgggg
tgcatattccagggtggtttttgccctatcttatatgtctggtgcgatac
tgccccaagggtgggatgactggggtgacacatccaagcaaaggtacaag
caaaaaccagacaaagatcaacctgttcttttcttttcttacatgattac
cgaaaggttttgaaactgaactaatggtgttctggtttcttgattctaca
gcacgacgttctatagagaatataaatgttatggacctggagctaatgca
aggaaaagggttgaatggtcgggaaaactaacgacagaagaggcagaagt
tttcatgacaaaaaatatgattggtggcaggagttggatcaggtctacac
ctacccatttcaagaaagcttccactgccatttctaacaacccagctaca
catgcttgatcataaaaaaacatcaaatttaaatgttagctgatatggta
atgtggatgaccaatgttgttacgcgtatgcttttctaccttattatttg
gtttttattactatactgtatttattcaattatttatttgtaattatttc
aaaataataataataagtgaatttcctcatgtgtgagcatgatacaaaac
attaataaagcagtgcaagatattttgaaacatgcattatgtcttatcag
ttaaggttttgaggttaatttgaaggctttagaaattaattaatttatcg
taaaaacctgagatgctaattaaattcatttgtggcaggccaatgactaa
aaaagaaaaggaaaaaaacacacgtgtatcaatatactttttcctacgac
tccatggatttctgcttagaaactggtatgttaatggatgttgaatgtca
agtttggagtagtggaattaggagataagaccaaaacgcgtgccctctgg
gagactatacaaatcaaaagtaattaatcttttttatcagtaccttaata
aatagcccttctgtattcattttattgtgaaaagaaacatggttttgagg
gtaagaacgagtcaaaaggttaacttcccgacagaaaataaaggaaaagt
taagatcccactcacctatatcaaacactttttctcaagatatttgctac
gagacagtacctagttttggtccaagcaattgaaacatcatcatcagtga
aatgggttctctaatggcaggatgggattctcctgtatcggcttctaaat
caggttgtcagcttaatgttttccgtggtgtttttatttatgcttagtct
aatttctggctatttgaaattcttccagcaacaatccaaaggaatcgatc
acttaccaaggaagagattgaagcttactggaaatcaaagaagaaaactg
aggaagatcatcttaaggctatttatagtccatcagatagctccaaccag
ctggtgccaatttcttttcttttttttttaattaaagatttagacatgaa
taaagtttttaatcaagtagttcacatttaaaacaggaaattccatctca
gggctatggaaggagcattatgagatcaagctccatgccttcacctcata
cagaacagggtttccttcacatggacgccgaaacaagcctggaggatatc
gtaaagaaaaatgggtggtaagtagctataaatcttagtcgactcatcaa
gacaaaaaaatggtgacaattttttgttaacgtgggtgactgtatgtagg
tggacacgaagcaattgggcattcttgaatgaaccttccgttcttgatgg
ccctactaatagttacacatcgcagttccacattgccaaccttgctgctt
ccaagcttaacaaagatagaggaatcagtgcttaatctttacctcctaaa
cctatctttttttcagcgtatttgtctacctaatccgcatgtagttatgt
tctacaaagttgtaacagcatttatgtgttgggtgtgtcacctggtcagg
agtcatatgtgatccaggctttcaattctttaatgtatgtatacatccca
cacatattcaggcatatgtatgaaaataaaatctttcaaaaaaaaaataa
aaataatagaacataactattccataaattatagattttcatatttgacg
ctcaactttgataagataattgtactctttggctccaattccatttcttg
tgtaatcaaccggcagaattgtaagttaatcttccctcccctctgctcta
tgcaaagtccagcttaagggcttagctttctgtaaagaatttgcgtagct
aatacttgctgaattggtgttgaaaaatccatccataagcttccctttaa
taaacactaggttgaggtgaaaaaaattgtgtaaccaatatatttattaa
aaaattaattgatatacattggttacaattgcaaagtgaattattttttt
atgcatggtgttacaagttcaaatcttaatattatcaaatttttattgat
ctattatatacaaaaagaaaaaaatactcataaaatataacttaatttat
atatgcaagggtaatttagtaattttataactgagttgatgaccggttga
ccctgacaaaaatgaactttgttgtatggcttctaaaattatttgataga
tttttaaagatttttacaagtaaaaagataattaataattcttgtaaaat
attttttgaaagttatatatttttacatcataagaaataaaaattcaata
aaaatataatttgattaggttcaaataattgcaaattttaagttagtatc
ataaaaaccattcaaacattacggtttaaattgatttttcaaaaaattaa
ttaagtctttacgaagaatttacacccaatcaatgaagccttcaactaac
tggcatgccacgctaacaaaactaagtggattgaattaattaaaaataat
tagaaaatagttcaatggctaaatataggtgttagtagttaagtaactag
tatttacatttataataaattagtaaacaaaagactcacatcaaccttat
taatctaataaactataatagcgaatttactttcttttgaattttttcaa
taagagtttctctttatttgttctcaccttctccacaactacataaatgg
caatacaatgcgacagtctctgggccacatctatcctaacaatcaagttg
taaaataataatccatgagacaagatttataagtacaactttcaaactta
atccgagattagctctcaattactaacaagatcgtccatcgttaaacatc
gaaaaggggttatccattagttgaaacaaaatcgtcataatacacgaatt
atacacacttcgtgttaagtaacatatgattagcattaaacatactaaat
tgagaacttaaagtgcgaatggagacatttgttcttccaactctaagagt
ggcaatgacaaagaagagacagcttaaaaggttattttcattagttttgt
gcattcaacttcttgagattcctgtcgtatacacatatgcactcttcatt
ctataatatttcagaagactatagtatttctttttaaccttgttgtttgt
tttatttatcctcaaatcttatagcaatgtcaagcttaaaaaaggaaagt
aaggaagacaaaaagagattgagatgaagattattgaaaatgaattctcg
aaaccccaatcaattattttaccagaaagcaaatgatctttccactttgt
gttatactgaaattccttttatttgcttctcatctgacaggtaacccatt
ttcatttagtcaccccactatttatcaatttgttgttgtttgctaggctc
gtcattgttgggagccctaatgacaaacatgatcatgttcatgtagagcc
aaccaacttcaagtctatggtttgttatagcattgctgagccttgcctgc
ttagggatagggctattttagttttagttattatgtacactagtgtcaaa
ttattcagtttaaaaaaaattggtgattaataaaagtaccgttgcatcct
tttattggttcaaacataattttacttttttgctaagtaaacatttgagg
ttaagctcattaattttcttatattaataacttgatcaagtttcatttca
tatatggatacattttttactgtcaatatactatcaatgatgaaattaaa
tttttttataagagatgaaattgaattataaaatttttggaggtgttatt
gcggattaatttatttgatatggatgtgtacaatttaaagttttcatttg
atggtaaaattttttcattctaactaaaatatttcaagaaaggatggtat
ccaaagcaaaacattttctatggagagcttgtcataatgctctagctgtt
gttccaatagggtcggaagcgtgtaaattattgtactaaaaaatcacaca
aagttcaattcccagggaagagaggtggatcacatggatctcttaaatac
caagtctttccttagacagaatatcccttctatagtaatttaatagcaca
attaaatactactattataccctcaaatattgaaagaaaaataggacaag
aaagaacacaagagatttaacgaggttcggtaaattatacctacgtcctc
gggcactaacaccagatgataactttactatctccaaagtattacaaaca
aatagaattccttaagaattctcaaatgggagaagagagaaaactaagag
agaaagattggttgggatggttgaaatgagaaatggttaggcctatttat
agttgaagttcagggactaacttgcaaatggcctaaaaaattagggacca
aaattgcaattatccctttcaactttaaacaacttgccaactattttttt
ttctttcggtgccaattgcacctcccaccatttttgacttttcaacccct
ttttaatttaacttatcaacaatctccaccttgaagatttgattaggata
atcacatcttcacacacttctttcaactccccaaattcgataaagctatc
ttttgtagtgcctccaaatgcgctctcgagcgccatacacctaaaggtgc
tcaaattctcaggatgttaatcaagttcaaacaatgattaaacttgattg
ttgttaccaccttggtcatcatatctgcgggattatctgttgtcggaatc
ttctcaagtagaatttttcctttttcaaatacttcccgcacaaagtgata
tcttacgtcgatatgcttggttcttgaatgatagacttgatttttcgcta
aatgaatagcgctttgactgtcacaatatagaccaatgtgactttgaaca
acttccaagtctttcaataatccattaagccaaatagcctccttaacagc
ttctgtaactgccatatattctgcctctgtagtagacacaactactgtag
actgtaaggtagacttccaactcactggggctttcgcaagagtaaacaga
taccccgtagttgaacgacgtttatctaaatcaccagcaaagtcagaatc
aacatatccaactacaaactgaccaagtgcttcatcttgttcaaaaatta
aactaacatctacggtttttcgaagataccgtagaatccatttcacagct
tgccaatgtccttttccaggatcatgcatatacctgctcacaactccaac
agcttgtgaaatgtcaggcctcgtacacaccatcgcatacatcaaactcc
caactgcattagcatatgggactttcgccatatattctctttcttcttca
gttttcggagatagttgagcactaagtttcaaatgagaagcaagtggggt
acttacatgttttgtgttttcatttacaccaaaacattgtaatacctttt
tcagatattgcttctgattcaaacaaagcttgcctctctgtctatctcta
cttatctccatgccgagaatcttcttggcctcacctagatctttcatctc
aaactcttgattcaactgagccttcagcttatctatctcattttggctct
tcgaagcgattaacatatcatcaacatacaagagtagataaatgaaagat
ccgtcatgcagcttctgcaaatacacacaattgtcatatttgcttcttgt
gtacttctgccttctcataaagctatcaaatcgcttgtaccactgcctcg
gggattacttcaatccatatagcgatttgtaagcttacaaacccaatttc
taccaccagcatctgtgtatccttctggctgagtcatatagatctcctct
tctaactcaccatgcaagaaagtcgtcttaacatcaagttgagctagctc
caaattcaactgtgctaccaaggccaacaaaattctaatggaggaatgct
tcacaacaggggaaaatacatcattgtagtcaattccctccttctgagcg
tagcctttagctaccaatcttgccttgtagcgaatatccttcttgctagg
agatccatctttctttgcgaatacccacttgcatccgattgcccttttac
ctttcggtaattgcgccaactcccaagtattgttcttccggagagactgc
atttcttcatccatggcgcttttccatttatcactttctaagctttgcat
tgcttcttgataagtgataggaatatcatcaacaacgggaagggcgtagg
ccaccatatcagtaaatcgagcaggtttacgaatttctctccgtggcctt
gcaactgcaactggttctggtgtacttagtggttcttgggtcagaacctc
ttcaacctctaattcctccattgtggctggagaattagacttattaactg
ggcaaatccccatctgctcaaactccacttgttttggagtacactccacc
tgctgtggagtattgctcgtctgaatatctttatctgctacctttttcaa
tgtggcaggttcatcaaaggtaacatctctactacagatcattttctttg
tgcttaagcaccaaagacgaaatcccttcactccagaagtgattcccata
aagagagctttctttgccctcggatctaactttgactccttcacatggta
atatgcagtggttccaaacacatgtaaggaatcataatctgtagctggtt
ttccagaccatacctccataggagtttttctttctaatgcagatgatggc
aaacgattaacaagatggccagcgtatgtcacagcctcagcccaaaattg
cttgcccaacccagcattggacaacatacatcgaactttctccagcaatg
ttcgattcatacgctctgccactccattctgttgtggtgtatccctaact
gtgaagtgtcgaacaataccatactcttggcacacatcgaagaacgaatc
acttttatattcccctccattgtccgtcctaagccgcttgattttcttgc
cagtctggttttttatcatagttttccatttaagaaaaactccaagcact
tcatctttagttttcatggtatacacccaaactcttctggaaaagtcatc
aacaaaagtaacaaagtagtgttttcctcccaacgaaggtgttttggaag
gcccccacacatctgagtgaatatattccaaaataccttttgtattatgg
atagcagtgccgaatttcactctcttttgctttcccagaacacagtgctc
acaaaattttaatttgcaagcctttgcacctttcaacaatccttgctttg
ccagaatttgcaaggatttttcgctggcatgtcccaatttcatatgccac
aactgcattgagtccaagtctttgttaccggaagctgcagcgactgctcc
aataactgtactaccttggtagtaatacaagttatttttcctgatgccct
tcaatatcataagtgcgccagatgtcactttcaaaatcccatctctcata
gtaacaactgaaccattggattccaaggctcccaatgagatgagattttt
cttcaaactgggcacgtaccgaacatcagtcagaactctggttgatccat
cttgattctttaattggattgaacctatcccaacagttttacagggcatt
gtcattgcccatataaacaactcctccatttagttgtactaaatcagaga
accactcccggttaggggacatatgataggtacaacccgaatccaacatc
cactcatctgaatggaacgacgatgatgatgcaaccagtgatagttcaga
gtcactagtatcatgcttagcaacacaagcatctacagcagcttttccct
tattcttcagctttggacaatttttcttccagtggcctttctcatgacaa
aaagcacattcatctttcccgagtctggactttgactttgatctcccctt
ttgagttttcttccgagtgtatgaacgacctcggactactaaagcttctg
tatctctgattgagtttttctgcttgtccttctttctctgttcataactg
tataaggccgcacagacttcgctcagagatatatcactcctgccatgaag
tagagtagtttctaggaactcaaactcctcaggaagtgaccccaacagca
tcaaagccaaatctttatctttgaatgtctcatccatattcagcaaatca
gtgactaactgattaaatttggtgatgtgatcattcattgtggtacttgg
gacgtatgtgaagcgaaacagtcttttcttcaagtggagcttattttgac
tgtttttcttcaaaaaattttcttcaagtgccacccacaacttatttgca
gaagtctcctttgaaaaagcatacctctgctctcgagaaaggcatgatcg
aattgtgccacatgccaaccgattgatcgccttccaatctttctcctgta
catcatctggtttttcttcatcaatggcaatgtctagaccctgctgaaaa
agggcatctagaacctcactttgccacataccaaaatggcccgtgccatc
aaagatctccacggccaatcttgcatttgcaattgtcggtcttgtccaca
tggacgatgttgaagctcctacaccgaccgttttctccataatctttcaa
tatacctaaggaaatcttttctgatgtggaagatcagtttaaactgcaac
cacagagcatactacgattaaccttcggctcttgataccacttgttgttc
caatagggtcggaagcgtgtaaattattgtactaaaaaatcacacaaagt
tcaattcccagggaagagaggtggatcacatggatctcttaaataccaag
tctttccttagacagaatatcccttctatagtaatttaatagcacaatta
aatactactattataccctcaaatattgaaagaaaaataggacaagaaag
aacacaagagatttaacgaggttcggtaaattatacctacgtcctcgggc
actaacaccagatgataactttactatctccaaagtattacaaacaaata
gaattccttaagaattctcaaatgggagaagagagaaaactaagagagaa
agattggttgggatggttgaaatgagaaatggttaggcctatttatagtt
gaagttcagggactaacttgcaaatggcctaaaaaattagggaccaaaat
tgcaattatccctttcaactttaaacaacttgccaactatttttttttct
ttcggtgccaattgcacctcccaccatttttgacttttcaaccccttttt
aatttaacttatcaacactagcaactaaggaaaacttatgttttcttttt
cgacatggagattcatgttgtctaagatgcggagaggaagtcgagaccgt
ggaacacaccttattcttttgtccctttgctcaagcagtgtggggtgctt
ccggattcaattatatacagactaagacgtgaaggcttttcaagctttga
agattgggggataagtatctccgtttttttcccttcattcagatcctttt
gttctaaaagtttgatggcccatctttgctcatgatcatccccattttat
cttggaaaaaggagatgtcaacagcattcatggtggaaagtagtaccaac
tttcatcggggacaatgttactgttggtgagtcgaatggcattgaccaga
aatattatgtgaattaagttgataaaagttcctgctattcataggctatg
gttgaaacagtgaaacgagtaggtcatagtgctgttttacatggttgtac
tgctgaggatgaagcacttgttggtacttttatatatagtataaatgtaa
agccctattcttcgtatggttagtgattcatttcaattcataaccaaaac
aaaaagaaaagagagagagagagagagagagtaatttggatggctaatgc
tccttgtacctaagatgcttgaaatctcgatggttgtggctttgtaatta
ttaaagtcactcttggccttatatgagtattgcaaatacctaaatctgtg
ggcaagttgcattactgagcaattgggtgctcacgggcaaactctaagac
aactgcacgactatgcttttttgggcctcatgggcaaaattaaaaaaact
acttatttctttgaacccaaccattgtcagttttaactttgaatatttgg
agcaaaaaccaatcaagcttgtgagccgtagctcctacaacatctttgtt
ggaacctaacccatgtgcgaaatttcttaagaaaattttaatgtatttct
gtgtttattaatgccaaagatcccatctctttctgcaataattaatgaaa
aacattgattgatccgagaatctaaataagccaatgacacaaccacccgt
ccccgtaatttcggctggcttctgattggccaccattaaagaagggttgc
taatttatttgcactttggtgctcttgtcatctatttctccttttctaac
attttggtgttaagtgctgttttctttctttattgggttgtacgaatggt
ttgtaattatgcattaggatgtcagtgaagagggtgaagcttaaccgcag
gtcaggtagtgggtgtgtattttatattatattaagtttttggaaatcta
cagcactagggagatgcatagggaagccaatgattaaccaaagcagcccc
cggacggaaatcagacaaaaccattcaagcaagcttaacatggtaaatag
gtcatggctcattcaatattagaaaaaaacattatcattataattaatta
aatttaaaagatgctctaaaagacccattttatataagttggaatattta
tatttgaaatggttattatctttcggctggtgctggggtgtgtaatttta
ttcgtttcatggatatctgaagcctgcaatggaagtatacggccattatt
gtcttatcttacagtctttagcctctaccttttgtttctgtccattgcat
ttttttcccctttttttctgaaatcatgataattaagtataattttaagg
aagggcaagggctacgacaatgccccaccatccactaacaaatttcaagg
ctctctgtaccttttgatctcttccattgatccagtcttggcaaataaac
aagaacgtttctctgctaattaaaaagcttgtgatgtcattaactaagtc
cttgttgttttaagaaagggtcgggaatatgcatgtgcatgagtttctat
gaaaatgcactaccgtaattgatgttcccaaagtcataaagactccttta
ggaaccaaaacacaagttatagaatctcactcaaattggaaattattgga
atcgacacctttttacaagttagaaatacaaggtgaagacaagccagaat
atcattattcattagtactaaccgacaaaccccaaataaacttagctgtc
agaatcatgattcagaatccacaccgttgttgggaccaaaaggctttctt
tttttcttttttttttgtataaataaatagaaataaagtggttatttttt
gatggagagaaataaagggaattgaataggccgaaagtgggagcagaaga
gtgccatatcgtggaccttcaacatctgcttgcagtgcggggtacgcatt
tccgccccctgcctatataataccatatgttctttgcaatttcataggga
gtcttcgaggcagacactacctaaagttatgggagcagaaacattgttaa
agaatggggaggctagggttcagcttgaccctaaggttcctctcatactg
ggactccaaccagctgccctcatcgatcacgtggctcgggtcgacgggtc
cttgttcgatcaaattcccggtgaacgtggtggctctattccggtatttt
cctttcttttttaacccctttaactatactttttaataaatccttaatcg
ttaattttttctcaagatttgtttgctttgaactactcatattcttctga
acatttcgagtcccaatgtgacgggctttttctatcaattcttttttatc
tttgtttttcattccaagttttttggatttcttttttttttttggttgat
atgagaacaaatcatagatatagttggaatgaggttctgttgttattgaa
gactatcattatgtaggtggcggtggaggagcttgagcatatattaagcg
agttgaaaaggcacgtccttgcttcagctgatgattcatctcctatgaaa
actatggctgggggaagtgttgcaaatactattcgagggcttagctcagg
ctttggggttaactgtggtatgattggggcctatggggatgatgaacaag
gtcaattgtttgcatgtaacatgaacactagtggggttaatgtttcaagg
ttgagaaagaagaaagggcctacagctcaggtaaccttcatgaatacagt
ttctatgaaattgaattgtactttaaatggtaagtgctaaaactttcctg
gcaactgtcatggtccagtgtgtatgcctagttgatgcatttggcaatcg
tacaatgcgaccttgcctagcaaccgctgtaaaagttcaggtgaacgtca
cggtccccctttttttcataattagttttctttcttgattttaaggattt
ttgtgtgcagcttactgaatgcaaatttacaatcaatttttcttttccac
ttttcttttcagggggatgaactgaccaaaggggattttagtggttccaa
ggtgagtcctattttatagaattgaaacaacaaatctgcattttgtggat
tcccccccccccattatttataacaaaggagccctgattatcatactctt
tcgatcatggtttgccaatggcataagaatgtagatgggtagaattggta
cttttgaacagattatatatcattcagctctttggagctgttttgattga
ggagcattcagcttaatgatgtatctatcgttgcagtggctggtgatgag
atttggggcattcaatttggaagttattcaagcagctataagaattgcca
aacaacagggtgtctctgtttcgttggatttggcaagttttgaggtaatt
gttacgggttcatgttttgctgaaggttgaatctaatgtttaacatgtaa
gacaagtggtttacttgcatattttgaaagtgacaataaattatttagat
ttacggttgctattctatttaatgtgagtgctggtatttcatctctgaat
ggcatctaactgttcttcaattcacaattctccattataaagtgtgtgac
tttcgtcagatggtgcggaattttagagtacctcttcgacagttactgga
gtcaggggatattgatctctgctttgccaatgaggatgaggcaacagaat
tgctaaggtggctgtcaattgtttttctaataatgaacagagtcctttaa
tgttctttcagaatttcggaaattgctgcagtaactacatgtgttagctg
ctgattctaagttctctgttttacttctttaggggtgaagggaatgcaca
tcccgaagctgcagttgaatatctgtccaaatattgcaggtgggctgtgg
ttacattagggtccaatggatgcattgcgaaacatggggaagaggttggt
caatttcaacttagcaattcctccatttagggatatgccttttgacctag
ttaccattctgaacttggatatggccaaattgtgcccattttcatggaag
ccttggttgatttcgttgtatgacagattgtccaagttccggcaataggg
gaggcaaaagcagttgatgccacaggagctggagacctattcgctagcgg
tttcttatatggattggtgaagggattatctcttgaggaatgttgcaaag
tggggtcatgtagtggtggatcagttattcgttcacttgggggtgaggta
acccctgagaattggcaatggatgtacaagcagatgcagaggaagggcct
ctcacttcctgatattcggaactgaatgtctccataacaaaataactatt
cattttcacagacatcaccgtggcttttgtttttccgaacgaaaagggca
gccttagttgcattttggggctcaattgatttgatcacacgactccttat
ccgcagaagcatcaacatatatgcaatgttgagtcatcatcgggtaattt
ctgtagaaaacttatttgcaaggacctcaaatccttattccgagtattat
caagaggcaaaagccttatgttaccttattccttgcttcgaaattgtcat
ttagcgcaaaaatcatcttccaaactagagctgaaatctcttaaaacgtg
caattcaaaggcagggtgaatttcaattgcagcatcctcgtccatattct
actaaatcaaacaaatatacgcatcaaaatttattgataacacgctgaca
gtagcaatgtacatatactggagttggattgtatcgccgatatagatact
agaattcgttaagtttaaaacccttacacccatcaaagttactcaaaaag
tcacagaagttcgattttgcatctaagatgaaaatggagctctagaaata
acatgcctgccttctaaaattgcagcacttccatgcaattataacccaag
agcatgaagcattatagcattctgtgcatgcatacgattttctgcctgtg
gaaagacgatggaatttggagcctctataacaccgtcagtcacttctact
cctctttcggcaggcaaacagtgcatgaaataagcttttgggcctgctat
cttcataagagcttcatcaacctgcatccgaatatgcaaatcaatcaaga
catacacttgattgagattgataagcaaactaaataatgatggaaattag
gttagaaaaagtaatacagctgatcaggtttcaacacagaagctcgcccc
attctggaactaaattatgcatgcattaaccctatgttcggatacaataa
aaacaagggaaaggaagggaaagcaatatgaactaaatgagtttccttaa
cacccatggtttatacgattatgtcaatatcttgaacgaagaatcttagc
caaacacacctgaaatccttgaaacacttggcgacgatgggcagcttctt
ccttctgccccatactagcccagacatctgaatacacaatatcagcacct
ttaacagcttcctttggatcatttgtgatctcgatcttgctgatcccagc
tttttgtgccttctcaacagtctccttatcaggctcaaaacctttagggc
aggcacagacaaagtggaaaggaacaacagaagccagcaacaaccaagag
tgaacaatgttgtttccatccccgacatagacaacctgaaattcgcattc
aggtcaaaccaaagttaaatcacacaaccagatgagatccacaatataga
agatagcaaagaaggtgcaatggtaagaaaagacaccttcgttccttcca
actgaccgatatgttcaataatagtgagtgcatctgccattatttgacaa
gggtggttgtaatctgtcaagccattaatgacaggtacactggaaaattt
agccaaatcaagaatgtcctgaaacggaacagataataaactgcatcttt
aagcataaaagcttttcaaactaaaaaatgcatcaaacacaaagtatgtg
aaccttttaaagcaatcctcagctctcaatttggcatttgagtaacaaaa
accttgcatataattacataaaaaaaaactcactactatacctgatgacc
aaaaacacgtgccatgataatgtcattatatcgagataaaacacgagcaa
catcacgagtttcctctcgtttacccatctggatatcatctggtcccaaa
tatatagcatgacctccgagtaagaaaaacccagtctcaaatgaaacccg
tgtcctcattgatggctttgcaaaaatcatagccatagtcttccccttaa
atggagcaaaggacctatctcctgattttagctgtgccttgacctctgcg
gccctgtctaatatcttcattatggtggctttatcaaagtcgctaatatg
caaaaaatccttcatccccccttttgctgtaaaagaacaaacaaaaatga
ggaaaagtacaataaactatgtgaaggtaagcaatttgtccattaaacat
tagcttttgatacatttagtattgattaattccatattctaaatgctgcg
taaaccttagaacatctaataatcaacgagaaaaaaaacctaaaaaattt
taaacattaattatagataagcatataaaacctacattatttaaaatgca
gaaaaaaatacttctttctatgaacatttcgattattaggccataactaa
gtaacattcaaaccctaattccaagcacgatctcgaaattaacttcccta
cggaaatgtgagattctgctcatcccaatatcaaaacaaagagaagttat
ctaagagacaaaaggataaaaaaaaaacgaacctgtcccattgacggagg
aagaaggtggtgacgcggcggaggaggcctgacaagatataagggatcgg
tggacagacggaggagaagcgagggaaacgctggaagatcgcagagcttc
gccgtagaaagaggaagaggaggcgacggggacggtgaaagagagaggga
attggtgtgaccggaatgtgcagtggccagaaatcgccgccattgtttgt
agtgagaaagcgaaaatgttaattgctaagtaagtgaagtaccggttctc
aaggggattaagaagggttttattataaggagacgaattgactcaattac
ccaatgcaagcattcattgtttgttttgtctgttttttttctcatcaatc
aagtaatttcaaatacccatacccatatttgatcaatttatttgaacaag
ttctcaagttattttaacattttttattgaatgataaagtgagataataa
atcattttattttatttttattaatattatattcttgtttgaaaggaaat
catatataattaaaatcaagaaaaaaaagtaaagcaaggagcaacaaaca
aaactcatacactcagccctaaatccatccttctctattggtccaataga
aagatacgttaaaacatgagaaatgcaatcacaaatagtctcccactcat
aatgatttgcatgtaataaggttatccgagcaaacgcatgactgctttat
tagagcaccaacgagtctaaagaaatgacagattaaaaatgagaacaaag
ttaaaggcaatttataagtgacaatccaaatttcaagtggtcctcactat
gagatgttaaagctctccaaacttgtaaacagtctatctctaaaaaaagg
ttattcaaatgcaaggaatcaatccaaactaacgcctccctaatggcata
aatttcaaccctttcaagaggcaaagtgactatactacgcccaacaatgc
cctaaataaaatatccccaaagtctcaaataataactaccgaactagtgg
cttgatcggttccaaaacatgttgtgtctatatgaagttgaagtagcagc
agaattatcatgaactagtgtcacgggctgcagttcaaagcccgtgacca
tcacaccaaatgcatccgatggaggtctattgtgtagatggggattattt
ggcccaccaggactagctcgatttggtaacctattggggaagcctgtcag
attgaagcctggttggcccgataataaaaatatggcaacttaggctattt
tggaatagaatcatatcttgtaaagattagatttaatatgacatatcttg
taaatcccatgatttaagggataggatgaagctcgtccatcaatgtattg
taatcctaaccgtcggttttggaggagctcaactataaatagagagcctc
ttcctcatttgtactcactccattcattgtttcattattctttgtgaata
agagaatagagaacatttactcaaacactttgtgtgcgctctttttgttg
ttcttttgttgcttcttttggcataaatcgcttacgctatgcaaattggt
gccttggaggacttctaaaggaatcctcacttgagtaaagactgacttag
gcgagtttggacgaaaggatcgcttaaagctgcacagatcgtgagaccaa
agatctagccccgtgacactagaatatagtcaaaagtttgctaagtgacc
tctccccaatatgctgcaacacaaatataatcgataataatgcggtatgt
tgcaagtgtgacaagtcgagttgtagtattaaatagttcagtgacttaaa
tgaaaatgtttggatagtttggtgatcaaattataattttttatagttaa
atgaccaaaacaaaaaactaacccatagtactagtggtgcagtttacctt
ttatattttgaatttagcctattttcttttcaaatttaaaaattaaggtc
aaatcattaacaccactaaaattattttgttaaatttgttggtgttcgac
caaaaagaattgtttgtgtgatattttgaagaaaaaagtatttacttgat
agttatataatcaataaaatgatattgtaaacataaatttaacaaaaaaa
aatttaacaatgttgtaataaaccgctaaatttcaaaggtaggaaagaca
acatatatttgatagtatctaatgaagtatgttttaactcctttttattt
tttgattaaatataaaattagtacctaagcttgctcacttctcccagatt
gatacttacggatttttttttataccaaaactttttctccgtcaactagt
ttagtacttttttttaatgccattaactttgaaataaatggtagaatagg
gttgtgacacgtggcataatagcatcatgatatgtcataatttaaaatat
atattaaaaatcaataaaaatttaaaaattatttccatttttttcttatt
tccttctttttctctatattcatttattcttccttcttcctattgccatt
ttgcctttttcttctaggttcgtgtaacatttcttagttcctttgaaaag
aaatttaaaaacatttctaccttttaacaacattaccctgcgctattaac
tctcaagtctcaaaactaatttctttaaccattgacaacgtccaattata
ggataactaaacttatgtaccgaaataaaagtaagaaaaattacaaaact
catcaatccattaaaacacaaaactcataaaaaattaatgtaacaaacaa
aacccatcaatccgtaagaacacaaaaccaaacaaaaagaaatttatgag
aagcaaatcaaaatcaagacccattttgggtttttgagattcaggtcacg
gtcggtaaaccaaatggtcaagacgttggaggtggtgaggagaagccatg
gtcaagtttcataatgattcaacggtggtggctcagtttgacgtcgaaga
gtagcgacagtgaagtgacgaccgatggctttgaaaacaaaaaataaagt
agaaaagaagaggagcagaagcaggagagagaaaggaaactcgtttggtg
cttcttcaatcagtgatgacattgaaacaggctgtgacaacattggagca
aagtgaccggcagaggagttctctgtgaaaacaaatcataggaaatgaag
gagcaagaggtaaatgtattatgccatgtgtcataatcttattctgccac
ctgtcccaaacttaacgatgttaaaaaaagtatcaactagttgaggagaa
aaagttcaagtactaatctgggataaaaaaaaacccttaagtaccaattt
gggagaagtaaacaaattcgtgtaccaattttatgtttaacccttttttt
ctttgtttttgccagtaacaaactcattggaagcaagcaaaaataaaagg
atagagaggactaacaattaggcacaagtgtcacgagccacagaccaaag
cccgtgatgaaagcatacagagcgtctcacggaggtcaattgattaaatg
tggttcatttaaatcatttaggactctcattttgtagatagacactaatc
tcaatcgttgatgtaatttaatttgtaccgttaaatttaaggagctcgac
tataaatagagatcttttccctcatttgtaatcaccccatctcttgtatt
ccattcgaagtaaaaaaaaatatttttagagtatttgctcaaacacctaa
tgtactattgctttcttgtaaattttccaatcagtttaagtctctttgtt
ttagtggtgctgagctccttaggacagacttgttagaaatcattagtaac
gctttatttgattattgttgttgggcaaataggattgagctcggtagtaa
aaaatgagcctttgattatcaggaatgctgaaaatatcagataaatcaca
aagttcccaaaatagactccaaattacattaccaatgtttgcaattaaaa
atttttcaataccaggaaacagataatagatttaaatctttattgttttc
accactagaaatgaaagacgggtaggcactcaattgttgaaagttcatat
ttttcagtctatgttgttggtcttcttctcattagaaagaggaagcagtc
ccttttctcggcatgtctcgacagctcctacgaacatgtcttccaagcta
tatttaaactcaaatcccaagtccaagagcttctttgaggagaactccac
actcttcaggttctcatccacatctttgaacctgaccaagaaatggtatc
gttaggacatgaatcaaaatgatggtgatcctgtagaaactttgaatcgt
gtgaagggaattaattacttggtgggaacattatattcagggtatttttc
actgagcattttcgcaagatcgataatggtagcatggtgagaggcgcaaa
tgtagcgaccttccgcttttggattctcgaatagaaagatatgagctctg
cacaagtcatccaaatgaatgaattggccttgttttatgatcgaataatg
agcttcgttccctacattttaagacatctcgtcagaaagtggggtgaaaa
tatatgtggataattgattcaagctgtgaaattacagaagactgtaccgg
tgataggagaaagtgcagttatgaggcttggcggcattgattgcataata
aatggaccgaccaccaaaggtggtattatgctgacaaaatcaatgttatt
ttctttagcgaatttccaggctgcttgctctgccatcgtcttggagacaa
aatacatctatacgacaaagaaaacaagggttagaatttggcaaaatttt
aaccctgattgtgttttggggcgggaatttggaatactaacccaaccagt
catttttttggcctggatgaattcaagatcgctccaacaggtttcatcat
aacagggcttttgttgttctgcaacatcaatagttccagctgatgatgtg
aacactaaccttctaacagttttggctttggcgcaagctttcatgatgct
tagcactccattgattgttggttttatgacttcattctgcaactcagcaa
acagtcatttcaatgttcttatgtaaaagtaaatctatgctactactaga
ttggcttttaattacatttcttaaaccatattccatattaatataatacc
tcagggtcctcggactcgaagtccataggcgtggccacgtggaacacacc
cgtacaaccttgaattgcatcatcaaagcttccctcttcagctaaatctg
ctttccaaagagtcaagtgcgtctctgctttaggtagctccagtaaatgc
ttcaccttcttcgagttgtctgctccattaataaaacaagcaaatatgaa
cgacaacaattaaaactttactatttttcaagtaaaaaagatgcttaaat
catccaatcatgagggacaagaaagtgtttagaaaacaataataaaggga
caaaccagggtcgcgcacagtggctcggacgacataaccgcgttccaaga
gcagcttgatgagccatgaaccaatgaacccagagccgcctgttacgcac
acgatctcgccttcggtgactgacgaccccattatggaattctgtttcat
gtctttcatttgattttcagttggcataaagaaagaccaaaaaatgggga
ataacttgaacactgctctgttctggttttctttcagtttcggctgatga
tgattttatacatatggcgcagtcctccaatatctaacccaggcttctaa
tcacgtggaaagcgatcggtttgcacacgaccagtagttggttgagccgt
taggcgttaactactctttccctccaaagaaacccatgattttattttat
agctttgaggtgctgcttcttcaacgtcggtttgaattttattggctaaa
atccaattcgatttgaaaaattcgataaaaatttaaattttgaattaaat
agttcgagttatttggatcaactcgaataaaaaattaaatttttcgattt
aactctaatatgaattacacaattcgagtttttcaaaaatctgaataaga
aaaaataaaattacgttgttttaattaatatttaccttttctaaaattag
aagtcagaactattaagttaaaaggcgaaactacgttgttttaataaata
tttacccattaagttaaaaggaaaaattattatattgcttatgtagttaa
ataatcttgtacttcgtctactagttaaataatcagttcatgtaaacgca
acattgagtataaataataaaatttgttaactcggctctactcgaacttt
tttaactcgattcaattcaattcgaaaaaaattaaaaatgaattcgattg
ctaaaataagattcttcaactcgactaactcaaaatttttaactccatta
gactctatttgatcaaatactcacccttagtcaaagcttccgcctgttag
aaagaaattcagttggctaaagaaacttgatgaagtgggctggcatagct
cgtagctttttatagattttgggctccgttatgatatgaaatccagttca
agcacccctatttccttcttgggcccaaataaacactttcccctcccact
caacattaatttaagtagtctagaacttgttcacgtctgtaaaaacattt
tataagataatgatagttggaggaagcattgtagtttttcgtaggatgaa
aggttatatgagagtcgatggtcttagaggaattgtcaaaaaatttaaat
cacataattacttgtataatttttgtatttctattcatttacaatcacat
cgtaatatcaaattaaatcaatctttttatatagtaaacgtatccaaagt
acagtctcgatgtgaacattaaaaaagaaaaagatgcaagctagtgaagt
aaaaaaatatttggggatagggcgtcggtcatgtccctgtatgaacaatc
tttagcatagtccaatatcaatgcattttgggttagttagggtgcaaagt
ttccccatatgaatcccccaaagacgagtaggcagtaggcaacatccaca
aatgggtactccactcgatctgtcacatcaaagaattggatcccattgtt
caatatcaactgaacatcgacaggctccaatcctgtgctaattaacctat
gcagtaagcaacgacttgaataatggcaaaacgaaaaacttttgctgtta
aaaacattgggcgagaatgacaccggttgtaaaggaatataaaagtttct
ggaccgaaagaaaagcagacaaagagcacgaggcgccggcacctccatcc
cgtcactgtgagccattaatccactattcaccacattacgccgctatgtt
cgtaatacgaaatcgcgctgcgtgccgcgtcggtgcttgcctgctcgata
ccttgaacgatcaaactattctttcattattttaaggattccaagttcct
aggactgaatgcttatagattaatgggtaaatcctttaattagctactcg
attattaaaaagttatcattttaattatttttatttgttaaaatcaaata
aggtatatagtgcactcactttaatttttatgtataagtttcaacctttc
aaataaaatagtcatccagaatctacacttttcgagctcaaatataattt
gagtaactaaattactttgaaaatgactaaaaattaatgaataaaacgtt
ggtggagtcaaaatctaaagaaaaaatttccatcaatcaaacaatactta
tgaatatatgaggtggaccgcgtaaggagtggttttatcatggaaattga
cgtcctaagggaatttgttttaaaaaaattacataaataaaaattatcgt
caataatatgtaataatctctctgtaatatgagatcaatcggcttaatcc
agacatatacataattacaacattgttggaattcacatccacattcttaa
tttttttgtttttttggtataaaagtacttaaaattagagtggagcaaaa
ccggaaaatatcattcatcatctttacaaaaaagtagtatttgggttaag
aatagcatacatatcaaagaaagtagactaacgtaagaagaagaaaaaaa
gattcatttttcaggaagcgtgacatcgtgaatctgtgataaaggctcta
acaccaaacaattttaaaggagcgttgagtggggaaatgaaaaaaaagaa
aagaggacccacaaaagtgaacgcatccctgttcctttacctttattttt
tcaacaatggaagctattgcttttcccctctattctttgcctttggcttt
gggtcctcatagtgactttgaatcttttcatttttgtcctcatttacatg
tttaagaaaatagaagttaattccacctcttgatgccgaatccaaatgcc
gccgtgatggacgctaaattaggtgatgctgatatttaggcactttgaag
ttcccgaattgggggagtgtgggtaagccaacaaggtctcaccatacccc
attatcattacatttttattataacattgaggaaattaatcatatggttt
gattttgtgtcatttgaatatcatatgtaaggttttttttgatgaattat
aacagggtaaaatttgaataaacacgactcgaactcagaccacatttgga
gtgataaacacccttaatcatcaagccatcacaagaaattcaataccata
tataagttttagtcattgttaaaaattatatatttatcattatgtttatt
tagataaaatttgacctgattaatattaattgattttaatcagcaccaat
agactttaactgatataacccaatgttgatcaagcattgattagatatta
actagcatttatcgtcaatcaatcaatattcgtcaatgcttgattagagt
ttatcaacggtaaatcaagttttaatttaatttttaatttttttataata
tttagtttatttgaatttttctaaaagtttttaattttgtaaaaaaatta
atttttgtaattgtgtaaaatgtataactacttttttttatacttctgaa
ttttttatgtgcattttggattttacgtttagcaaaaatatatatatttt
attaattttaaaaatgttaaatatattataaaagtttaaaattcttagaa
tgtattgataattttttatggctttttatgggttttttacttaaataata
taaaataattcaataaatactaaaataggataaatgcagtaatatttatg
aatataggtaggagttatagtaaaaaaatcggtgctgcctaaccaattgg
cagtacccctctccgcagccaccggtcacattaaggtttaaaagttaata
aattttaaatgatttaaaatatttagggatttgatatataaatttaccat
tttgattgaaaagctttaagagtgcggcttgatagcttgacagcaccaaa
cttcaaaagcgtaaatttcttaacaaccccttcttatttatttattttta
tttccctacaagaccaaaaataaagaggtctattaccaattagtccaaaa
aggttttttctgctaaaaagtatttttgtaaaaaatcatttcaattggaa
ataaattttatttatttttcaaaaaatatttttttcaaattattttattc
ccgttcgaataattttttgaaaaataattttataaaaaagattatttgaa
caaatatttttttgaaaaataaattttagttggaatacacttttttacaa
aaatactttttaataaaaaatatttaaactaattggtaagaggttttttt
gtattgaagggaaataaataataataataataaacaagagggtttatgaa
acaatttacactatttgaagtttgataccaccaagctgctaggtcacacc
tttaaggcttatcaatcaaaatggcaaatttatttctaaatattttaagt
tatcacattttagtttaatgtcgtcaattgaccagcctatacttataact
ttcttcaaaaaaatttgatgtgaccagtggctagagagagtagtgccgcc
aattagtcagacaattctaaattttttactatattacatttatcccattt
caatatttatttaattattttatattatttgagtgaaaaaaaaaaccctt
ttaatgcatgtgaatacccacgatcgcttatagatctcattaaaaaaact
aacatgctaagaagatgaacaatacagtacacggtttccttgttgagaac
aagtgacgtgggccgtggctgatgtgtcaggatgcaggggaagacaaatt
tgtactgaaacagaggtaaaagaatttcacggatgttccgttcccatgtg
ggttgaattactacagtagtatatttacctgcataggtaattcagcagtg
gaatcaataagacattcaaatcccatctttattgttttgaggaaccgccc
cagaaaagggcattaaagggttttcagttcttgtaagaaaccattgcatc
ggtttccttttctagatgaagcaaaatatagtgaccactacttccgctgc
tatataaaccaccaaagtctgtttttttgagttcatttgttttttttctt
tatttgatcctttgctgcttttggagagaaactaagggggagaaagagaa
atgaagcattggggtctgattttgcttcctttttttgtttatttcaacaa
ggaaattttctcctgcgtgtcaaagctgatgacgggtttatcaaaactaa
aggactgcagctaatgttgcatggaagtcctttctatgcaaatgggttca
atgcttattggctcatgtacatggccgctgattcatctcagagaagcaaa
gtctcatctgcgtttcaacaagctaaagagcacggtctcaccatagccag
aacttgggctttcagtgatggtggagacaggcctcttcagtactcgcctg
gctcctacaatgaacaaatgttccaggttcgaatcaaaatacttgtcagg
ttaaaaatctggtccgtgatctggttctcatcatttgtttttttgatttc
cttgaagggattggattttgtagtatctgaggccaagagatatgggatta
agctggttttaagcttcgcgaataactatgatcaatttggagggaagaaa
cagtatgtgagctgggcaagaaatgaaggacaatccattggctctgatga
tgatttctttaccaactctgttgttaaagaatactacaagaaccacatca
aggtcagtctctgttttctcccccttctctctctttctctaatagtttaa
tttaacattttaaacggttgcccttccatcttttctgacacttatagaaa
tggcagcgataagattttatattgaataattaatttattgtactaattta
gacataggttgatgaacatttccggggcataatataactggtaatagtag
atatgtaattaatacaagagtaaactctcttatttattttgggcgtacca
ggctgttcttacaagacgtaacaccctgactggagtggcttacaaagatg
aaccaacaataatggcgtgggagcttatgaatgagcctaggtgcctctcg
gatccatcgggaaagaccatgcaggtcagtcagcaacatctcatcttcaa
gctcttttgcttcattgcttcactgctactctgttctggtttcactttta
tgaaacgtatttttacacactgtggaatttaatgccaatggtttgagttg
gtgctttttgccgacccatgcatgattagtggcgttggaagttgtaactg
cacacaactttaatattaattttttttgagtggatttaacctttacctgc
ctccaatattcaaagatgcggtggtggtctaatgggactgggaacctaca
taacctagtccattgtttgtgttaggttccacaaattaggtgaagattag
atatgtttgcattatcaacaaaaacattactttttttatccaccctacac
attttactttgattgtgtttgctgaacaggcctggattacagagatggcc
tctcatgtaaagtccattgatggaaatcacttactagaagctggtttaga
agggttttatggaccatcatcatctcaaaaacagcaatataaccctaact
ttcaagtaggaactgatttcattgcaaataatcagatccctggcattgac
tttgcgacagttcattcatatcctgatcaatggtaattatatatatgttc
agtagaaactatcccctttttaagtaaaaattgtaaaagccaatgtatcc
aaaattttgctggttgagcaggttacaaagctcaagtgatgaaagccaaa
ttgcctttttgaataattggctgtacaatcacatccaagatgctcagaac
atccttcagaaaccattgctctttgccgagttcggaaaatctttgaaaat
tgcgggtcctaaccaaagagacgagctgtacaacactgtttatacagcga
tttactcatcagccaggggtggaggtgcagccatcggtgggctattctgg
caactgttagccgaaggaatggactcttacggggatgggtatgaggtaat
catgagccaaggcacctcaactgtcgacctcatcactcaagaatctcaga
aacttaatcgtattcgaaagatgtacgtaaggttgagagacatcgagaaa
tggaacaaagcaagggaaatcagaagagcacaatggtggtccggaaatgg
tgtcagcaacacgggaaattgagaaaataaagatacatgatggtcttata
gtaatatagaagtgttgaagataaagtttcaagatgatgtccttagtttt
tttattttttttatttagggtttacaacgagatgaactcttctaaaaatg
agttgttcttaactaaagagtgatacattctgtgattgtgtactaatctg
atgaaccagcttattttctgctgtaagcttgtgtttgtgctactaagaga
tgaataaaacaaatggtgtttgaacttatttgaaaagtacttaggaactt
cagaattttacatatgcaaagcataagtcctagatatatttttcacttgc
aaagggcaacagactatgggcgctcggctttccatcacccgttcagcaca
gaacagaatcagcctctggaaggattcaaagttaaaatgttttatatgac
agttccatctcggatggttgcattcttcattatcactgtgatcccagacc
taatgtaaaacccatcttctggtctctcagcttcttcaacagcctgggcg
gattaaagtaaattaaagttatcaagggaacattccacatttatagaagc
aagcaaggtaacactcacatcagtgtttgatatgattacatcttttccta
tcttggcattcttgtcaattatgcaattccttcaaaatcagaatgcaaaa
agtgtttagttgacgatgtaaggagctgttttaaagacaaatattttctt
atatgtggagatttatcaggtacaatgttatagattaaaaaaagttcagt
tggtctagagacggttttttcgatctaaaatcttacttgatcttggtatt
ctgtccgacaccgataggaaccttcccttctgctagcagagatgctattt
cggactcggtttggtagtagtctgctcccatcatcatggtatcctgcaaa
agaaaacatgtatgaagataatttctcacaccagatacagtttattatcg
aaaacaactacttctaatccttgtcagatgcttttctaagggaaagagaa
gatgttgaatcacctgaagatcaacgctggactccaaacgtgagcgcaca
ccgactatagagtgttgaacactacattctcgcaagaaacaaccatgtga
aattatggagtcaacaatctgcagtaagcaattagccatgagataagacg
atcaaattattattcacagcatagattaaagctttatggcataccttgca
ttcatcaactttggtaggaggcaagaatcttggagatgtatagaaaggtg
tctttggatcataaaattcaaactttggtggctgcatggggaacatggat
aatcagttttcacgagataaacaccaaatattatgcttaggcttatgaga
ggtacactagtggaatgagtgaggtgtctcgtagtgcaacatactgaatg
ataaggcaaatgatttctttgtctatatacaaacatgatgacatgacaga
atcttaatcagaggatctatacacaaaaatgcacaagtgtttgttaccgc
agccagttctttaagatcatatacttggtaggttattgcaagcagataat
tcataaaaggagatttagtatcattgttgatcggtaaatcacaaaaaaga
ttagaacttatacagaaaagtgcgagtaacctgttctgtgagggctaaat
tagcatcaaagaaagattttattgttccaatgtcttcccaatagtcattg
aacaaatatgcctgcaaaacatccgaacagccagaaattcagcagtttga
tcactagatttgaagtccacattattgcaaatagtaacagattactactg
aaaaatacacagcaaaaactacaggtaataattcatgtgaaagtcaacgt
gcctggacattgtgttccttcacagcagacggaataatctcagagccaaa
atcattgcatgagggatagcttcgagttagaagctttaacaagacactag
ttttaaacacatacacacccattgatgcaatgtacggatatcttgcagca
tcttgaactgatagtcctaatatggaggtatcaacttgctgtagtacacg
tgaaacaaacaagatcactaattagaggaaattatatttgaaattacaag
aatgcggggtacgagtacaagcacataccattgctttaagattagggccc
tttggtttctcggcaaactggacaattcgtcctgttccatctatcttcat
caatccataatccgatgcacggctgcagaaagagtgaagttaattcccga
attccaagcaaccattagtatatactcatatataaaaacttgatacacta
agagaatcatatataaaaagatatagccattatactcatcttataatatt
caaaatgatttaacataacatgataattaataagtacctgtcatccattg
gtaaacatgagactgtgatatcagcatttgagtcaatatgcttctgcaag
aaagatatatctgatgtttagccagatgatttttcaaggaacaatcttcc
ttcatgaggaagtagaaaagaagagtcttcgaatgatatttttccactct
tagtaatctagccacgtgcctgaacaaaatccatatagtctgctcggtaa
agatgatctccggacaatatcaatacatgctccacatccttggctttggc
atcctggtggtagtgaaacaaatcatttttggtcaactttcatgatgaag
gcggatgatttcagctcaagtacaaaatctattaactaacctcaaaaacc
cacacaaattgcctcacagcatcagcagttccttggaaccacttcttccc
agcttctcctggtgtttgagtggccgccagaacctatgcaaagcaaacgt
agcttcatcaaaactttcagaaaagataattacatttcatgagaatggaa
attgtaaaacatcatgatccacgcattaacatggatttctaaataatatg
catagtaaggctaaatcagtatggccttacctcaacaaaaccatctccaa
aatttacaccattcccaaagttgtaagtacgagctaagtgacgattgagg
gagaaggagttaaactgagttaagataaatatcttctttatcccactgtt
gatacagttgctcattggaatatcaatcagcctgtaacaccctccaattg
gaacctgcaaaccaaataatatcatggaaaaagttcaaatcctaccaatc
tgagacttgaaatttaataattgggtttcaccttcaaaatgaaaaatgtt
tactttcaaaacataaaattagtttttctactctcttaggaaaacggttt
cttacggctggcttggctctttggctagtaagagggaagaggcgcgtccc
agcaccgccgccgagtatgatggaagccacattctttgggtctgcttgtg
gagcctcaaactttggtgtctcaaatttctgacaatcaaaagtttcaaaa
gcccactttaaaaagatctgaacagctattactagaagaaatcttgtact
agttgtttaatccttggatgaaacataacattagaaatactttttcttat
tttcctacttaccatagtctccttgttaatttctgggggtgataacagag
taagcaacgcccggtttagcttttttgacaccattttcagctctccaact
cttccataactgtgttccaaaatcccgacctcctctgatagtctcacccc
agaaaacagtgcctccattactacgaccttggctgatattaaccggactg
gcggttgcagtagcctttagcgatatgcagatggattccattgctgaatt
tattaaccaatagaccaaaatatcaggaaaaactaaagaaaagcaataaa
ttaaaaaatattaaaagaccatacctcggctaaaaaatactcttagtcta
caatgaaataaaatcatacaaaaagcaaattactttgttagtggtccaaa
gatttcatggccacaatatgcaactagtattaagaacaatgatcaaagac
agattaaaaggctgcgacggctttaaactctgcctaagtcaaaaaaaaaa
aactggaaactgacagagatccaagaaaaactggaacaacccatatgcaa
aatataccttttaaaaagaagttgattttagtgcttggatcactcaaatc
tgtggggaactgagaaatgagcaactaagaagtgtgataaaagtttaaaa
aaaagaaatctttgatggttggaatgcaagggggaagagcttaatcagca
gtgatatctaagttcaaatagtaaaggagtaaattgtgatccatccgtca
cgagaagcctcaaaattgggtctttgtcttctcttttctaatacagcatt
taattaaaagtataattacgtttagttatgtaatgcgctttgatttttcc
agagtcgctagctgcgcaaacttccaggacacttggcagaaatatgattt
ccttttcatttgtaacctttctgtatttctttttactagacaatcatcgc
atgagactagggtggagggttggactatttttaccttccatctcaatatt
ttactccaaaaatgtaagaataatttaatttttgttaattcgtagttaag
ggcaattaattacaatggtcaattatattttttttttttgtataatcata
aatttagcttgtaaagcttacaaattattgtcaatttgatattgatttaa
caaatttatacaaaatctaactctaaaacctaaattaaatattaaaaagt
gagcattattatcttcaaatactaaaatatatcaaaaaaataatatagat
accacattagaaaaaaatgatataatatttattattttttaaataattaa
atgtaaaatgtatcaacagatatagtataaatagataaatatttatctat
attttaataaaaaagagtaaatatcattttatctaaaatcactttcaact
gaaattgattttttaaagaaactcaaattgttttgctgtaaatcggctgg
gctcaaaatcaaaggaatgaatcggtgctccttttgcaaccctttccatt
catctatatttaaattcattcactgtatttaataacctactcataattta
cctcatttattttcgattgggttaactgattttttttttgtcattttgga
gaaatatatattaattatgcttaaaattttaaatagataaattcaaaggt
aaaattagagattgtaaaatttaaatggagcaaatatttttgtttgaata
atagatgtaaggtgaggtagatttttttcttctgcattgttggaatacag
cggttatattaatcttttgccccttttatgtttattaaaagggcaaaatg
taataacatgtttaaataattttttaaaaaattatgtttaaatatctact
aactttaaaaaaatttaaaaataaaaaataaaaaataattgtaactgaag
atgaatatatctaatattcatataaatttagatttaataatatccaccca
tcccattgactaatatgtggcagtcctatttccaactttgttctattcct
agtcatagtaaatgatgatgacatttttaaagattttccttttaaagtaa
acatttcacgtcagtcctgccaaacatcttgcctcaacttcaaatttttc
cttatattaaataagtggccgagtggtaatttttatataattatatatat
atgattttttttattaaatacatcaaattacttttgtattgaataaataa
aattatttgtatatgtaatataaaatataaaataatattatattaataat
tgtgttaataatttgtaaaaaagaataaaaaaagttaatgtataccaaaa
ttcattatccttcatttatttcacatgattcaattctaatgttatcaaat
actaaaatataaaaatattcatagtgacaaatttatacaataattaattt
gttgtttaaattttaaaataatttgattaaattaggtgatttatattaat
ttatatttgtgttgaatcaaatgtggaaacttttaaaaactaataattta
ttttaattataaaagatgtatttaaaggtttccagggcaaaaagttatca
actactttaaacaattaatatgtatttaattttaataattaacaatatat
catttgtatcaaaattaagattttgcatcaacaactattgcttaatgaat
tttaatttaattttaaattttaaattatttttaattaattaaaaaattta
atttataccaataaataaaagttgtctcctatataattgatcaattgtga
actgagaagacttgattttgagttttaggtactcagtaattcgccatcta
caattattttctagatcaattttcaattaaaagggtaaactatacagata
gccgcttaattataaaatttttattttagatattcaaaataaaatattta
ctatttaaacatctgcattacattgttcagtaattttggttagtctcgtt
aaaaaacacaaatgatgagctaatgcggcaatttaaaaatcgatataata
ataaatttaaccatcaacttttacatattgtatcaatttagtcataattt
taagaattaaccttcaaaatttacaaatgatactaattccaagaaattca
aataaatatataaaagacgtaaatatttttaaaaaatataatactaaatt
taaattttatattaatcccacccccagcacctatgaagagcaaagggttg
tctgttttagccattgttggaatcggagcttagttttgccagggtttgta
tttggttgaagattacagaggaaaagatggctaccaaaagaaggcaagtt
ttgtcaatacatgcctgattattgaaaccttgaatctgggtttaacatct
tattcaacatcattcaacacaaatgataaaaacatagcttcaaaaattcc
aggtatctctaagttagttagggaagctgttcttttttttcctttttttt
ttttttgtaattattttgagatttaattttctgtaatttctacataatat
gtaaaagctgatggctaaaatattataccgatttttttaactgccatgtt
aacatgtgattttaatggagtgataaaaaagatcgaatatataacctgag
tgaattataatttttttatttattttgaatacctaaaataaaaatttgtg
atagtttagtatataatttatcctaattaaaaattgatgattagatcatt
gttacaattttttttaatgttgggttagtttttttttttccgaacaaaaa
ttggattagtatcgcttctttattcaatttatattatgtataatttgtca
tcataaattattctaagaaaaaaatgtatatatttaaatttatgagatat
tttgaatactttatttaagtgaaaaaatttgtcggcaatgtgttaatgtt
atttctttgtgttcaaagtattataaaattataagttaatagttattatc
tatagattttaacttcttgtttatatgaattatattcatattattgtcgt
ggcatgctctatattaatcatgtatatgggtaaactttacgttcctgttc
tggtcactcattttattcaatttgtataataacacttttagttatcaata
cttattttctatcaacttaatcttaattctgaataattcaataaatttaa
tcatttatatttataaattctatcaatttgatcctcgagcttctttataa
agaaggaaaacaattgacattggaatactggacgggtgtcatgtaaaatg
tagggggattaggactactatttggccattagtttctcatgtcaaaaaga
aacaattaacattggagtattggataggtgtcatatgcaaaacgtagagg
gattaaaattgatatttgaccattaacttctcatgtccaaaggaaaagaa
aaaaggaaaacaattatattggacagatgtcatgcaaggaaggtcttagg
gccttcattttatatatagaagcacagatatcggggtcaaattctaaaaa
agtcctttcaacatatactttttgcaggtttagtctatctattataattg
gatcatatttaatctttctattcttttaaaagaatcttttagttttaaca
ttttttattaattctataaaattattttttcatatttacaaaaagagaaa
atacatgataattgtctaactatataaaaactagtcatatatatgtatat
gccacattacaatatgtctacaaatataaatcacgttaaattatttaata
aagttaaaaggaaaaataatgaagaaactcaaattatcatcttgaactgt
gtttagtgtttcagtcttatgttgcaatttgctttgttttattgcatttt
aatttaaaaaattaaataaattcggtaaaaatatataatacaaattaact
tacgagctctgcttataatatatctattagtagcacagacttaattttgt
gaaactgatatgaagcccaataactttgggcattgaggtaggcccatcaa
agaaaaacaacccttggggctctcttgtaaattcaaaaacttgggaaagc
caatcccaaaatcaccaccacgaaactcccatccatctcctcatttcatc
ccctttggaaacaaccccccagtactgccagagcagaaatggcgctaact
ctccccaacacatttctccaaatcaagccttctcctcccccttcactccc
ccagaaaggtaaattcaacaaaaccccaaaaccatttaccccatcttata
tccttaatcatcctacttaaccggttccttttttttttcttcttcttcgt
taataggtggtgactgcaaggggagggggctataggccgcaagttacttg
ccggaagaaggacatccacccggaattccacgaggatgctaaagtctact
gcaatggagaattggtgatgacaacaggtgggacgcagaaggagtacgtg
gtggatgtttggtcggggaaccatcctttttacctcgggaacaggtcggc
cgtccttgtggacgctgaccaggtcgagaagttccgtaagaagttcgggc
agttgtctgagattatggagattccggtgcttaagggtgagattattttg
cccactaagcgtaaggctggtaaaggcggcaagaagaagtagattaatcc
ctagtaatttaattttgttccatttttcaaatttgttcaagatacggtgt
tgaaatgcttggtttgtgtttgatattatgcttaatcgtggatgtgaatg
gacttggctaacgacaactgggtatataaaaaaaaaattggtatttaaaa
tctgtcgaagagaacgcccaaatcgctaatcatggctttaatttgcttat
ttcaacttttgattctggaagtgtcaaactgtcaaatgtgtcatgaaggt
tccatctttgctaatattcttgttctgggtggtcattgttatttgggatg
taattatagcgtttgcttgtctgcttcagtgatgccattgttctctttgg
ttcccttgtttcttgagacatgtagagtttgtgttgattgatatgtccga
acgaggggacattcgggttgcatttggacagcattatactaattgttagt
ttagttaatactcttctttggttgaattgaatctctattatcaaatcatt
tgggtgctcagggaaatgcatcgtgaagtcaattttgttggtaaacaatc
atctcgtttcttgcttgtcatccaacttggatatttttcaatgcattttg
atgtttggccccctccatggccaggtccagttactcttttatcacaaatt
gatattttcatttctcgcttcaaatcttgccggtttcatctttgccaaaa
agacccgagtttttaggctgagttgtaggtttagcattgacttaagggtg
aagagtattcacttaagcatccttatgcatattgtgtggttggatgggat
cacactgcaaccaggagtagtataactatatctaaatactatgaaggttt
tggtgcaatacaagtaactattatcttcatgcaaaaacatgcaaatccta
agaacacggaggctctatgaacttcctgcattgacggctgcaatggccga
gtgttcccacaaaagccttaccaagttgaactcctctggcaaatatttgc
ttccgccagttgcatctctgcatcatcactgtattcattcaagcgttaca
tatttagactcttgaaatgagtaaccgattataaataaagatacacataa
tgtagtgccagagtaaagcaggaggaggaaaaaggaaggtatacattggt
agacgaccaaataacttagccacatcgaccgatctgatatctgtaaatgt
gagtacagcaacagagcgtgtcaattatagtgcaatgacagttgcttcaa
tttccagctccaccgaacaggagatgcttcttttagaaacaaaacaaaca
aacaaacacgaagcatggatgtattttagcaagtttgggtgcaaatccaa
cttttggagccgcttgaaatactttaggttactcgaaaatagtgtaaatt
gagtaataaattatttaaaaatatagcattcatgatattttttaaattta
cggatttttagaagcgtatttagtaatgaatttaaaattttaaaaatatt
tttgaatttaataaatttctgcttttgtacttttctaatatatgttatgt
tacattaaatctgttgatccaaattcaactcatgaagaaaaacagttagg
ctcaaatataaagaattccttctttaaaagatacaatcccaaagcttttt
tcccatctgaaattgccacgacgtgaagaattctaaaaggccacaaacca
gtaaaagtactaggaagccactgtattcatgaggaaaattattttttata
ggtaaattataaaaatgtcacccaagcatttcattctattttggtcactc
aactattaattttttcgatttagtcattaaaattttctagattaaatatt
ttcgtcactctgagctgatttggatttttttatcggtctaataacaaaat
tagccctctaatgtttgcacattctatcaatttaatcctaaatattaaaa
aaatcaataaatttagccctcaatatttataaaatttgtcaagttagtcc
taactctaaatttttttttaaattcacttttagctctttataactcatcg
gctaacccatgtgagatattaaaatacgaaaaaaaaatcctctttcaagt
cacttgcaaaataactctaaaaacttgggataaaacacaataaaattaaa
aatccaaaagaaaatagaaaggcattaaaaacattatctgttcaagtagt
aatgcaaccagttattccagatatgttccaaatcaattggtttggtccag
tgtaaagcctaaattatagtaaaagaaattattgtaagtgacttgaaaga
gagtactctttttcttattttaatatctcacacggttagccggtgggtta
taaagggctaaaaatatatttttaaaatttttagagttcggactattttg
atagtttttgtaaatattgagggcaaaatttattgaattttttagactta
aaactaaatgacaaaatttgtaaatcctgagggctaaatttgttaaattt
tttatatttaggatcaaattgatagaatgtgtaaacattagagggctaat
tttattactagaccaataaaaaaacctacaacaacttagagtgactaaaa
tatttaattttaaaaagtttagtggctaaataaaaaaattaatagttggg
tgatcaaaatagaacaaaagccatagttaggtgaccatttttatagttca
cccataaaaaaataattcccaatcatcatttaacatataaaatttaacag
agggctaatttgtacgttttgaaatggataaaagctaatttacctatttt
cagtaaaggggttgaaatataattctcccctatctacaagagtgcataaa
attatcattatgccttaactaatgaaaagtactatagaagcctttgtaat
aatagttgggttgcattttattctctctaaacaaaatatggataaattag
tctctatatgttagattaaagaggaaacatgtcttgttaaaaattacaca
tattttcctattaaaatttgatcacgtcaatttttaatgaggataacaaa
tggaatcaaaaatttatctttaatttaatgctttaataaaaggatgtgga
taatatttgtagcgttaactaattcttttgggatgcattaattataccgt
aatcgaacttagcattgtctgctatatataatatgttatctcttctataa
gtcggtgtgaggttggtgtattactctaaagttagaaaagatgtaaaact
attggttagcgtggattggatgactctgtttttaaagactcagttaggct
ctattccccatttttcaactagcacactcacctctatttcgccctttcaa
gcttaaatttctttttacaacattaggagataatttatgattctagttga
aatatttttttaaaaaaatctaaaaataatcacaaaatcagtatttccac
cgctagagtcgttgcgttctttcaagccatgctttaaggataagcttata
tatatttacactgaaagggtgattcaattttatttgcttttggaaatgaa
attgtaattacataaaaagccaaaagaagacggcaggaaacaaaagcaaa
aggcaaaagcaatatcccccaacgccgaatcttgactcggattgtccccc
tagtggatacaattgcaaatgacccttttgtccttgtattaattccaaat
taaacccaaaaattattttattaatcctctaatgttaaaaaaaaatctca
tgcatactcctccgctcaatcttggacttgttaagttgggaccgagttgc
ggacggtctgattgtgcttaatgcaacaccccacaaaatggttcctctgc
atgggtcaggcttacaacgtcgggtacctgtgcaggcctttaatgatatt
tctattttatctatcaaaaaaaaaaaaagcaaaaaagaaaaatccataca
tggtgagtaatataaaatgttttattttgacaaatatttgtaaccaaacc
gacgattcttcaaaaaagaattaagtaagttttggtaagagcatgaatag
atgtatgttgtgttttttaatacctttaacaatgattgacaaccgacacc
ctaactggcatccatacttcctaaactacctcctgaatttatattataga
tacttttcaaacttatgctactttcttgatggacatgatcccttgggcag
tctatataatacgctccattatttcattaatattagcattcgttattttg
taaggtatttacgaatgggattaaaaatttcgaaatattggatcgaatca
tctcaaccttataattaaactaaaaccccattcataattttatacttaat
attataacgtatcccccatttttttctgagatgttgcaatttaagtcaaa
ccaacttattgcatgtgtggactgtggaggaatgtacctaagacgtgtaa
ggcaattatttcttttctcccttacatgccgtaaattgaagggaccttca
tctttaaatttaaaagtgagatagctttgaacttatccacatgcttttct
tcttcttcttcttcattttttttttttacaattgtagtcctctcattgct
tgtattgtctacaaggaagcaatccacgaaactattcttagtgttttgtc
caaaagagggtttccttagtaaataagggaaactaaaacatcaaattatt
ttgcatcagagtcagcatttaggtggatgagtaattagctagcgttgggc
aaaaagttgagatgactcccctcttcttatccaaattttttccatccaat
tttcagagtcatctgtaaaaaaatattttaatttcaacaaaaaaaaaaga
ataagaatctatctaatgctctataactttttcttcttcttcttctcaat
tttataataatcttaagagatattcataatcctataatttatctttaaaa
aactttcactgatatggataaacaaattatatatgttgaaaaattttaat
tacgtactttttcttgttaaagggtgcaaacctttaagttggctcaaaat
gtctaaaatacataaatggataagatttgcttgatcaaccaaatttgtat
gtgtaaacaatccattgatatagtgacatggcatgacattgccatttaac
acagatatgagtatcatttatagtttactaactggagtagtctcgcttga
tgttaaacataaatagaatgatatgtgatgacatttattaactaagctaa
aagatgcaatgaaatcatccaggagcaaagaactggatcaacttcaaaac
tgcctaatttctaaccggtgtgccttcaaaggaggtaagaagggagcccc
tggtaaatagggatagccatgggatgggatttttctttttgcctcacctt
catctaaataggaagcctttaaggttttgcttaatagaatccaaaaaaat
taaaaagatgaacaattaaaaagggtaaaaaagtagtaaaattaaaaata
tgagtattcttttgataagcatatgtttggcaagaaatatataaaaattg
aaaaaagaaaaacaaagggtatcttttccatccttttctcattaattaga
gtgaaaaataaaagaaagaaaatacataattttaaattaatatatccact
tctcccgctttctctcttctaatcatctcaacttggagtggatgattttt
acgtattagaacagaaaatgatcatatctcctattttcttttctctcgtt
tttctttcataacaaacacacgaattttttttccacttttccactcatgt
tcatctctacacttttccatcaaatcaaacacacattaaatcttctttat
ttgtaccgaagtattaaataatttttatattatattaatttatataatat
taaatggaatatgtattaagaacatcataaaaaaataaaatatctagtga
aaatatatgaaaaagatagtaaaaatcttataaaatttgaaaacaaaatt
tcaaaggtatgaaattaattaaaaaaaattaaaaagaaaggaatttcggt
aagtttttgaggcatggcaattcgaattcaaaagatttaataaaaaattg
cctcaccatagaatttaaaggaaaaaaaatggatttaattgaaatcagtc
gagtttggcctaaatttacttgaaaacatcgtaacctctaaacaaggcta
gatatagaggtgggtaggtagacaataaaattctttgtattatatttaca
ttgttatcgttaaattctaaaaaagctattatttaatcattaaattataa
ataataaattgataatattattaaagttggatgattaatgatttactatt
tttcaggggtgagagtggaggcatcaaattctaagcgtcgatgaaaaggt
atggtaagaggtattattatctattgatttccgggtcccattttggaggt
aacttttctaacaaaggcagctatatgttaatattatttatgaaaatttt
taacaatcaaacatcacctttacctaatcttaatcactcattaatcatgg
aacccccaaaaggaaaaggtgcgtctcctgaattaatgatcctttttgcc
ttctcaactttccattccctacgctctattttcaaagcatcattcacatt
cgtatataaatataatggcatgaaattcttctatctgtttcggctttcaa
cacacttactttttactaacatactcacccatttggattttgagttcagg
catagacaaaggaaggagccttttgctcttgacttggcatcttacttcta
ttttgaatttacattagaattattccgagttaagtggaaaaacattattg
cttttgttttcagtcaactaagatagtagtaatcaaatatagagtaggct
tgagtaccatagtcatcaagttcctatcttgaatcaacaccgtctcttca
atgacagaattaaacaagtttaacttgactaaggggacaaaaagaaaaaa
aagaaaaggttatcctcaatcaattattgacctctttggctttttcagtt
tattgtcctttgcttggctactcagagttaagtagttgaattgaaacaag
aaatggaaaatcaccctgaattcttctggtaatattaggttgaattgaag
tgaacaaaaataattaaaaaaaaatgttgaattgcaatatgaacgccttc
cttgttcaacaactacagtagacaaaacaaattaagaaatggaatgtggg
agtgggagtgggagtgggagtgggagtgggagaggttgaaacattggcgt
gtctgacgggattgcctgctccatatctcacggttggtatcgtctgcaac
caacataagctgagcctcaaatggccttcctttcttacaaagccaaaatc
caactgttttctttctttctttctttttttttgaataatcttagcctttg
tcaggtggctttcgtacactgttagttcaggcctcacgtgattttcatat
accttttgcttttctaatttttttctcccctctggttttctattttggac
gattcaactctctacttgggtcacgaatgctttctttctttctttttttt
ttttttttgttgttcgagaaaaccgcgcgtgattttcaaacccgagcctc
cctttttttagtttttaatgggagagtgacaggttgaaccaatcaatatt
tcatggatttcatcaccttcccacggacaaaacctcgagttcccattgtc
ctgtttcacaactcatgaatttcccatgcaaaaaaagctcattttaaata
gaaaatttcacgcttacttggagcttttctttttgtctactttccatttt
cctttaaaacattgctttcatttaatttgattgtgttataacagctagag
gtcacagtagttacattcaattcgattaaatttaaacattatgttatagg
ttaacaacctcttgcttggtgataaaaatattacgatgtagaaatgaaag
ttgggtttaatctcattccccttttccaattatcaaaaaaaaaaaaaaag
aaagattttgggcacaaataagattggttaattgtgaaggggtgtgacca
atacaatgccaaaggatgctacttcttcagctttacaaatgtactaaaga
gaattaaatgagtcacagggttccaactcgaagaaaaaaaaggtaagaat
agcccatgtgatgacttaacctttgcttttaccaaaacaaaaaggtcact
tcctctatgatccattagttcatgcgtgattatattaattaatgaaccta
actcaaatgtttttttttaaagaacctctcaattgtatgataattaacca
cagggatatttacaaaaaagaatgtaatcaaacccaccacaaattcagca
tctggtcattgtcaatcaattttaagatgttcatattcacttaaacatgc
atcacatccccccccccaatatttttaatcttttctcttatagataacgg
caaaaagttcccccaatattatttgtcttgttggaatgacatgcaggaaa
tttggactttttctgggttcctcataacttaattgttttttctgaagttg
aaatataagatgggcttcatcttctacttaattctatatttggctacata
attacatcaattcctaagcaactaatttgttaattgttgcttttgctatg
tttggaaattattttgaaattggaactataattaaatgtaaattattagg
attatctatcatctttatcaaacaatttcagacactagaagcattctaag
acttttgtttttcttgagcatataaatccctccaattcaatgcaaaggca
tatgactatcaaacaagttgcacataaatccccttatttcccagctctaa
agtactagtgagtatattctaaaaaaaaaggggtactagtcagaataaaa
ttattcatgccttgcatgcattatttgaacgttcctaaacaaaacagcac
acatcattaataatcaaacattagaatgtgataaccagaatgattgttca
cttcaccttaatcacataataataaaatacattttatgaccaactgtcta
ttttttcaaaaggcagtcgcaaccatgtatgttaccgtaacacaaaaaca
tataataagtaaacttcttacattaatgtttcttaattaatttcagaaaa
ttatacaaagaaatgaagaggcgaggacccacatttactttagataatgg
gaagacagacatgcgacacagcaataaacaataaattaaaaataggttaa
ttggtgcaacactgggacccttccaaagtaacccgtccgtttccctctgg
tgtactgcagactgcgcaccacctaacctaattcaagcttcctcccccca
cgcgtgggtctgccatggttcggtccgggttctatttttcagtctccctt
ggttcactacctcttccatgctcctatattaatattcaataatcattata
tttcccatctgttatttttaatacagaagcggacaattctcttatatata
atggccttggaatctattcaaatcattcagtttccaagtacctcaaaaaa
caaaaaacactaccagcttcgaacttattttctcttttaataaactctga
aagctaccttaaaccttctcttccctcaattccttctttctcttattaat
caattatgccttcctttgaatttgataatgttaaggcagagaagcaagat
gctttgtggagatacaagatggagaggaagttgaggatgggtcttagctt
catcgggtttctcttggttttgtttttgctgtcgtggcccttgttcccaa
ctttgattcctgacaccgtcgaggttgccggagattttctccgatattta
gtttccacttttaataagccgctcttcacttttgtcctcctaaacatcat
catcctcgctgtttttgttttgtctacccaaaaccagacccagaaactaa
ccaccactcccgacatctacgacgagtacgttagctctcgccggtgtatg
caaacatcggcagtctccacctccgctcctgtcacggaagagaccacggt
ggacaagcaaatcattctggtggaaaatgcggctgctctaaattctcgag
ccaagccgcaacgtacgactactggcactggccgtgatactgttacagag
acgaaacgttccctctcaccagttaaagaacaacatcaacctacggagaa
ccggacagtgacacgtacaaagcctctctgttcttcaaccgaaatgatga
atcaaaaggagtaccgaagaactcgatcaatggtttcagaatcccgaagc
caacgaccacgggagtttcggaggtcggagacggctatgttcagccgaga
actggtggttacagatgctgagccgccgaggaaatcaatggacgagatga
gcagcgaagagtttcggtcgatagtagacagtttcatcgctgagaaaaag
aaaactctgatgcaagaaaacaccgctcattacactaggagaaaagacaa
gtgcatgtcaattgtggttaagaattaaaagattagacagaaatgagtga
gttaaaacataatctatctcgatcttcgtattagtaggctgatcaggtcc
tatgttattaattagtatgggatagatgtacagcgataaaatttcccggg
ttttgtgggagtaaattttaagatgatcaaactttatgggttattgtgct
tcttcctttctcatctatgaaatggatattcgtttaaagctctctggatc
tatgtgtttcagatttactgatttccgtttgacccagaatcatgtgtgca
attgtgggtatattcttttctgggtaaaagaaaaaaaggggaagtgaagt
tgtaatgaaaggatatataattttacgagggcctaaaacaagaactagca
gccacggaattcagattttttggaatatttgggttttccttttaagaagc
aaaaggaactttgattctattccgttttctcagttttttgttttcctccc
tgacatgagaattcatttcaactctttttacattcagatcatttgcttct
ttctgagagaaacccttgtcatctatgccaacttcagatatgcttcatgc
aaactttggttatagcttggaatcattattctacatgatcatagcatagt
ttctatctcggcttcatgcaaactttggttatagcttgaaatcattattc
tacatgatcatagcatagttttagcatcccattttgagtcaacttttttt
ttttgagtactccattcaccaactcttgtctgactgtttcttttttctct
gtgctaatcagtacccaaaaatccaaagggtccaatgatgaaaggtaaac
agtgtaaaaaggctatgaaatacagtaaaagcgcacgcacacacacacac
acacacaaaaggtgagccggtggatgttttgcttaatgaatacccaatca
tgaaaattacactgttattctgattattataacatttttgttaatagtgg
tgtctataaaaagttctttttatacctgcataatggagtaattaaatgta
tagagtgttggatgaatttactatcaaaagcttgaaaatcttccacggga
aagtcaataacttttactctactttagccacgcccactaccattaaacta
aactggctttgtcttaattttcattttaactttgcttatcatcatcatta
cctacactaactagtgggggctttgaggaactttagacatgtatcatctt
aacagctttgtctttaatttcagtttttctgcgattccagacaaagttcc
caccaccaccttttttcttccttaattctctgtattgtcccttgaaagtg
acatcccaattcttcttctagtaattcctttttcttttaaatgattacaa
aaatcagtcaagtacaataaccccaagaagaattttaagttaacctttaa
aaaataaaaaatacaacttggtttttttatttgcttgacaaggggaccat
ttgggattaatccatcaacaaattcattttaattacaaggctgagcatcg
gcatcattgtgttatcttagaaccattccatccatatgcttcaccgcatt
gtttaagagcaaattcactatgttttatactaatatgtattccccttatt
tggctttcctatcaaaattactgattttgaccttagctgacaacttacat
tgtttgtgatctttgcaactctataagtaacctcagaaacaggaaaacta
accatgggttttcgtttgactgacaactttaaactaactatgggttttca
ttacttaatagagacaaccaaacatcagttcccatggaaatgaaagatcc
caatttcttgaaagaaggctggttgcttgttacacttagattcatgtttt
gatagcagtaatatatatatatattacatatatatatatttgtcttcatg
gataaatatattgaagcaataggagggattcttttgtatgtaattaaaga
ttgtcatttcatttctattatagggttgacgggtgtcgcaggatgagaag
tccaatcattaatggatgatcaggattgaggcagctgccacaaaactctc
ctcgactactattctttttagtgcttttttgagtttgagtttttatcttt
ggatttttgtaaaagaataagcaatctgtgagagggatggtaagtccgga
acctgcagctatttcaataataacatctttttacatataaatgttgagaa
caacaatagtcaagtaaaggaataaaatgatatattatattttgcaaaaa
ttggaaaaacaaattgtttcacccttcattgccccattgattaaattata
ggcttaaaagggagtcatggcttgcttagtagctaatataattgtgaggc
tatggtcggattctaagggcatgcagagcagtggagtgagtcgataataa
tctaattttttttttaaaaatggaggattttatggatcgatgaattagtc
aacatcaacatcgctataaaataattaatcagtgttctcttttaggatat
cagtctttgccaagtcttttatttggttaaaatttaaaacataattgcct
tcactccaaacccttttatcatcaccctggtgggggatatctttgctctt
attgatattaattcagtaactaaatttgaaagtgggttggaatgaaaaag
gcaggcaggcaggcaggcaggcagggggtgtgcaaaatggggaaaaccaa
atacataattataatggtacaaaaatagcaaagccaaagccgaactggca
ggcaatagggaatcggcatgcagaaagtgcaagtaaagacccaatcagat
gtcaacaccaaatctgcttagattggaaagaaacaacacaagtgaaaatt
gatggaggtgtctaaattgggaaccctgtcctttgcccttatttcaagcc
tcggcctctccaatttgggtgataaggtcgtgggacaagttgttgccttc
attctgcctggcagctttaccctctctacaattatttttgttcacttttt
cagtcctttgagattttagtaaattcaaaatcgaaaattttaatttaata
acaacatggcattcaatgtgtttctttatccacaaaatttaaatctaaaa
tttatggaaacaacactaaacagttgaatactggataatttcctattctt
ttcaatccttaagggttatggctatcatagatgatagattcattgaaatg
gtatattatgatttttattgaaaccaactgctgtacgcctcagacctcgt
gattgagctacgctttcttttctttttttcaaaaaaaaatgggataagtg
tcacgacagcacccacatcacatgtgtctctaatcttaaggttatttcta
tgggatttcaatttaaatgttaattttagtttttatgagaaaaactagca
tatatttggacttggtgccacagaaattggatcgtctcacattggaaagg
ccctaaagcatttagcattgggccaaatgtaaatgtccggaaatctttag
gtaaaattaatatcaaaatataatgaatgcatttctcctttcgtgctttc
ccagttccaactttcataacaaatgatattcttccttttatttcaaatta
acaataaaaatgcacaggaatccatcctgccccacctcattttgaacaat
atagtttactccttcatttcgctcaaatcaaatttaattcaattaatatt
taaatctaattactaaaactattactaatttatatatgtgaatagtgaaa
atgattcctcattatataatctctagtccacaatagtcattgaatttgac
aacttttctgaatttgctcattttgagtttatgtgatttaccataatttg
atatgtcaaattcggctctctacaacagttaatcaatttgtttgcaagca
atttacgagtcttttctatatttttcctagtttttagttcttatttctaa
tacgattttacctcttttgaaacctaaattgacaaaactatccccttggg
agactaatgattgatttgagcttgtgtagggaaacaacgacagtcaaacc
ttgaagaaagttgcatctaacgtagttgtcgcggcacccaatcctttcac
cctgagcttgcaaaacttcaacggaaaatcaacatggaacttactatcat
gggagtcatgacacggagcctacaaagccgtcatacccttgaaggtgttg
aagtgaaaaaattgaggccaaatctagtgggtgtcacaacaccgagaccc
ctaagacctacaagtttgccattattttgggtgtcgtgacatcaaagtct
gggtgtcacgatactgttgcctaacggcttaaaagctgtagacgcaattt
catgtccaaataagcctaagtcatttttcatttaaggacataattgtcaa
tgttagattaaatataagtggactataaataccactttataagctttcga
ggtagattttggttggcttaacatctttcgttagtttcatagttttacgt
taagtttcttttcttttttgtttattttctttttatttttagattaggtt
tttcttttcctttttagaatatattttctttttgttgtttcatttcttat
ttattattgaagactatgtaaaagagagatgatcaaactctcgggcttca
tttgatttccctcaatgaaatgagcattttcttaaactcttcacttctat
tttatgcctaccatgtgtttaataaaatgcttatttggaatttaagtttg
attatgtgctaaattggttgatggtttatttgtaagtttaagttaatgtt
tattcttaattaattgattgtttgattatatcgaaatgcttaatatgtta
gaattgacgcctctagtgaaaaatctagataaacgagatcgagatgaggg
cctatcattagatcgttcgatataattgtgttgaatagtgagactgaaag
gagaacctagttggtatatcttttagtctaggatgggacttggaggagat
tcttagctaagaataacaaataatctaattgatataggtttattagctta
gttagagattaacgaatcaatcgacctatcattttatcattttctttgtc
taaagtaatagagaagaagattagattagtttgtttagttgataatttaa
atttagtttataaacaatttattttgaaatttgcactaataattttcgac
tcgattagattagtaattgtttaacttgtaattagcttgataaatacatt
taccggtttagcaaccttttgggttcaatccttgaaattctttgtgtttc
gttgtaacacatataaaattacaacttacaatataagtgtttttttgtgt
cgattcataacccacccaacattaactttttttgtgtgtgtggtaaaaga
aattaaattaaattatttaattatttttgggtcaaacttggccataaaat
aaatagctctcagcgataagaaggaaaacctaaagcaggttgaaggattt
tagcattgaaaaaattgaaggtgtcatcgtttttcatttattttagtttt
aatctcaattgtttcatctttttgtttattcatctgaaaaccaaacacat
aactgctccaatctaatttttattttattttaattcctattctattcttg
attccaatacattcattaaaccctcaccaaaataccgttacaaatcattc
aatatatctacatttctttataaatttcttcatacttaaagtagctatcc
ggaacgctataatttctcataattaaagctagaactgagcctacccgttt
gtcaactctcgcgactttatctttcaatcactttcaatattaaagaagga
gagaaaatgattttcataagaaaaaaaaaatcctattttcagatcacaag
cacaattccttcaattgtaaggtggcttgattaaaggattacaattaaat
gatgcataattgtaaaattgaagtgaactgaggaaattcaaacttggata
tggtatttgattgaatgtttgaactcaaatgagttggagagagggccttc
ccatcacattaaatcattcggcctacccatcacttatatagatttggcaa
cctagctaagcagctagccacgttttaaatgttgtattcaaaaaaaattt
tgtccacggacgagaccttgtcatgtacacatttcaaatgaatggttcct
tgtttggatccaacacgtgaaatgtgcacgaaataaacactctttaggag
ctgcagttctgtttaattataaacttgattattgagtctgaaaagtgaac
aacttcgtgttgtaaaaaacgaaggttaccaaattaatcactctatactc
tcccttgacattggttgatgtttaatctaaatgatttatgcgaaaaattt
catcactagtcatttaactattaataagtctatattttttcgtttaatta
tgaaaaattacaatttaatatttaaattaatcgaaattgatcatttaagt
cacttcactgttaaaatgacagcagatatcaacggggcggttaagtcacc
attcatcaagtaactaaagttttttttttttttgtttattggtaaaaatc
actcaataattagtaagtttttatcatcacccaactataaaaaagttata
ataatcactaacaaattgatgacataatacattttctcataggcttaata
gctaatttggtgtctgaattataactaaagtatcggtttggtacttttag
attttttgacggtaaaacaataaaaaatctgaaaattcataatttataat
tttgaaattataaaaaaacttgttaaaattacaattatgcagtagttaat
agaagaaaaaaataattctttttttagtttttttaaaattttaggcaaat
tttaaagcatttaaattgttttagattttaggtatattttaaaatttaaa
gaattttcttataatagtaattttaaaaatgtttttacaatttcataaaa
taaattatgaaatttaagatttttattgatgtttttagattttctgttaa
aaaaagtctaaaagtgtgaatttttttttttggttatagttcaaggaaga
aattaattattaattaattcaatgaattgatatgctacgtaattaatcta
ttactaaaagcttgataacacattgaaaaaattaaataaacttaaaatta
atattttcactcacttaatttttttataataaaaataatgtagacgtaac
tggcaaagatttggcccaatgggaagccaggttttggaccaatcatatcc
actgattttacttcaaaaaagaaaaacatccataggctgagcttccaagt
tgatatgactagcctttctaaccagtgaaatcacgaaattgatgtacttg
gttctagtctttgacaagtgattcccaacaatctctgcgaacttgctgaa
taaaacatccatcgtatcttgtcccagtcggaagtgggattccaacatcg
attctaccaccgctctgatggttttagccactcgctctcccaccatcatt
ttcccttgttcattatgggtgtcagcaaccgcgcctccatcccagtccac
ttcaaaagcttccagccgatcaattatgaatgatccttcctttagaatct
ccacctttagttcctccgcacacggagcatagtacggtgcattgaatgac
gctactttgtcctcttcaattaaaccctgcaacaatatgtgttaaaaaaa
gttgaaattaacctcaattcccactttcgccaatcacttaatcaatgctt
gaagtaatgtttgtacctctttgaccaggctcatcaatgcttcagataac
aactcccactgatagcacccatcttcggttgtgggatcaatggatttcct
gcccaggaaagaaaggaccatgcggccacctgggaccaactcctgggaac
gtgactttatgaactgtgaaaaatcagcctggaactgcgatgaataagca
ttcaccatgctttgcgggctgctctttgagatatacacttttcctttatt
taaatgcttcacggcatagctctccagccccaccggaacctgaagatatt
aaattcagcatttattatttccttagccacatccaagcacccccaccaaa
tttttatatattcaccagagctatgtttaattaacacttacatcaaaata
taaaacctataagtactcacttaatcaacaataatactaggattttcttc
aatgttgccagaagcttttggtgcaattccatattttgatgtaaatccat
ggtttcattgctttgctatattacatattttggttgttactaactagatt
gcaacaggggtgaagcccaaatttcttttttaaagtggctgaatttgaat
tataaatttttgaaagagctataaagatataatttcattattgtattgat
gtaaaattttacagttttcaagggattaaactataattttttatttttgg
agaaggtataatttaattttaaatattaggagaggtcaaaatataatttt
atcattaaattaactaaaaactttataaatattcgagggattaaaaaagc
aattttgcatttttgagcctgcttacgacagatccttttaccggtgaaaa
aagttaaaaaaaaaaaaaaacaagagagcgaaaatcagtgatatttcggg
gatattcatccctaggggtcatattgaaaattgtggtcactaggaaaagt
tgtcccacaaactgtacgatgaggggcgaaaaccccctaaaaaaaacctt
taaaaagtaaaagtaaaatatgcttttaaccccttttagtaatataaaaa
tttaatttaatcttttaaaaattattaaaataataaaattatattttaat
atcatacaaattataatttaattttggacacttaaaatttttatagtttc
gccctgtataagatgatgcaacaatgatcgaatttgcaggtatatgtgga
tgatggatctcattacttatccagtaatctaatttcttcatttttggtat
aatatgataaatcactataacagttttgttaatctatccaacattgagtt
tgatgagaacaagcattgttgtacaacgtgcatgagagttttaagtgaaa
attttaccttcattttaggattatcatggcactaacctgggagagccaat
ggagactggaaaaagagtagacgaagtggaggctgttgctagggaacaat
ctgccatagaaagaacctgggacacccgatatgaagcactgggagggtgc
caatccaatacccttctcttctttcagcatcttgtagaatgccggtaaca
acatgaataaggaattgaaatcgttgctataaaggtcgttaaagaaaagc
ctaaactccggcacccggcgcctgaggtgaccgctcgtcgctcgtactat
gtccattatctgcgagataaccgacaaggtgttgggtcgtggagcaaccc
aagtctgcgattcccatgctatctatatcatagttgcttgagagttctag
taatgcttcttcaatgatggttttcccgaaagatatgattttcctctaac
aaatcaaaagaagcaaagacatatagagagttaagggaaaaaaggaatta
atggggaaaacatgtaaatcatggtgttttaatggcgaaaaaaaaccaga
acagtggagttctttgcataactagtatcgccattccctttgttcatgtg
aagcacttgcactacttccatgatataatttctgtgtcttaattttattg
tatactgtatataacatgcagaaggagaaagcagaatgaatagaacggag
cacaaatggatgccctatatatagacttactgagtaattagtgaggacga
ggaaacctttgatttgtttccaaagttgtggttgtaataaggtaatgtat
attttaaagaaaaccaattgcaaaaaatatatatataattttaatactgt
taataacacaaattctattattaatgtatcaatacgataacatttccgca
ttttactaatatggtgctaattaacattttagcatgttataaaaaattga
taatacgagttacaaagtaatttaactaaatggattcataaggatgatcc
taaaaattaaggcttttaggcaccaataaaaacttgccacatcattaaat
tttaaagatatgaaattattattatacacccatccataaaaaaatatttt
atgaacccttcccaccacagtattcatggtcccttttcaattatttaatt
acatttagacaaattttttttatgtcattgacacgtgattttgataattt
tgaaccctgaacccaaaatatagaaccataaacccgaacttgtaacccaa
acccttaaacctaaacctaatctccaaatccttgaaccttgaaccttaaa
ccttaaatctcacacccaagccctgaacctcggggttcatggttcaaggt
tcgaggtgaaataattaccaaaattatgtgtcaattacatggaaaaaatt
acacaaaaattattttttttaaaaattggttacacaaaaataaaaaaata
ttaacttatggaaaaataataattaaaatttgtaaaagaagaaaagattt
gttttaattttaaaaaaataattattttaagtaatttaattaaggttaaa
ttaagttgtaaaagatattagttatagatgagtgcataataatactttgt
tatctttaaaatttaatgaggtggcactattttattgttgcctaaaaact
atactttttaaaatgattctaatataatttattcccgatataatttatct
atttagatttattttcgcttaccatttaaattaaattattttattttatt
tttaattcgtatatgtttatggaatactttttgatgccttaaatttataa
cttactcgttttaaaatatggggcttcagttagtgcagtgttttagtaca
agtataaattcgttggcatattttagattaacacgaaataaaaaaagtca
aacttagaaaatgaggtgagacgaatttaaaccagtcatgccagggagcc
tcaggagtaacccaaggagagggtgtaggggcgaggaccactctaacttc
cgcctaaatttaaaccactcgtgctaataaggttaagaatatgaatcgat
ttcatgttttagtttttgagtaaccctacgtttaaacgcgtttggtattg
tggtcttggatcatttatctttgcttttaattttaagattttttttcttt
tcgttaaaagtacattcgatgaatttcataccattagtaaggatgttgag
aactatagataagtaaaaagatgtatgaaacgttgtttgcgcttaaaata
agtcatgaaatgaaaatacctcacccaccatgaaaatttaaggatttgtg
catgttgaggtttgaatcattgacatacaacatatatgccatttccgagt
aagtatgtacaatccccattgcatgtgaggtacttttactgtatgaacct
cagtcttgtaattttaaaaatgacaaaaatttattaactttcaacaaaca
agatttcgatattgttgagaatcctccatatttccaatacaaagttacct
attctaactatcttacttgatacatacaaacttttttcaatattgttgag
ttccctatactaactatctacctagttcataaaaaaaatttggtaagctc
tttctctcctatcatcaatactcttcccaatttctagatataatcttaaa
ttaaatttaattgtagatgttagatgtgaaattcaactatttaatctatg
ggtctaaagttagacttttgagtgtttatttttacattaaattcaattgt
agattcaactatttaatgtatgggtctaaagttagacttttgagtgttgg
gatttcgaacaaaatgacgaggatggtcataaagaatttcttcattttca
aggattgcgagcagaggcgaattcaagtcaccccaccctgacttttgtaa
aatttctttcaattttatttacttggcctccaaagtttttcaaacattct
ttaatttgatttctttcatagaatttataaatttagtcaaatttttagtt
taatttagtctagtatataaatattatttggtaaaaataaaatttaataa
ttacaatatctaagtgtaaatagtatctaaatattaattagataaaaata
aacttaaataattataatatataatacaaattgagcatttaatttaattt
atttttgtaattaagattatcccaaattaagaacatgtatgttgtatata
aatatttcggcccctttaatcaacaattttaacttcgccccatctcaaat
acattgatgggcggatcttgtttattactttttctaagagaaatatttag
atgaaaaaagaggggggggatttgcttatgtggtaagaagagtttctcct
attatttttatacgtattataaaatacgtatttaattgagttagatctta
ggaatgaactaaatatcaattaagtatttattatttaagtttagaaggtg
gtgcccattttttaattaatctactcatccaatttttttaattaatcacg
ctatgaataaatccagtttactcggaaaccattgtttttatcttcctttt
ggaaagagaaatttatacttggatggattggtggttgttttcggtgtgtt
aggtaaagaccttttggaggaaaagagcacaaatcattaaccaactttgc
cacattctacaagtttgactaaagattaacacccaatctgcggtagcaga
tccaacacgagaaacctttgccaccaaattaggagtacgaggaataagag
gaagggtgctgagtttgtgggttaaagatggcttcacattactttcttta
gaaacatatttattgaattagcagttgtctaaaaacaagaaaattatttt
gaaaaaggcgtatcactttgttattcctccacattatacatgcattgaaa
ttggtttttccccacaaggttgaaatacgagtgtgtttgtcgtgcatgcc
acattttcccccccaatcaaaacgtggatttcttgcctggtcggtttaca
gtcaatccatgcccctaccggctcgccactccaatcccaaaatatgattt
ctccccctctacaacgtgtaagttatgtttcatttccgacatagccacta
aatgatccccacgtcaattacatctaaatccaaccatttaattttatcaa
atatgtccaatttgaactaggaaattaatttaaattcaaaacaactcaag
ttctaatgtttatctagttggcggatattcagaatatcttatcattttgg
atttattggtaatttaaaatattatataaaaattatttcaagcatcaagt
ttaatgcattttcaactatggatatctaaaaaatagagtcaatatataat
ataaattgttgttgttgaaaattaatgtaaaaaatgtaatttgtattttt
aagtgtttagtaatgttgttaaaatttacaatgaaaggttaaaatactta
tcttagatatgatgctgaaaaattaaaaaaatgatattaaaagaaaatat
aatataaactattttacaattaattatacatcagttatattaaaattgta
aaataatatttaaataatttaatataatgatacatgaaatacaaattaat
ttaattttaaataatttcacctaggatataacattagttttcaagttgag
aagtgctaccgatatcataaaagcaagaccattcaatacctttttatttt
tcaaacaaaaggagtttagttttggcctcaagcacctaggagatccctat
atcacattaatttctctacttgtaataaattaagaaaaatgaaggggcct
aactaatatcagatgacttgtgttcatgcatttgtataaaataattttta
tatcaatttatattgaaacgtcaaaaaatagtttatattgtaaggaaaat
aatataagtttggatgagtgaaaatcttagcagcttaaaggattgattaa
gatttaagattgtttcaaattgaagatgatttgatagttaaaaatatatt
ttaataatctgtaatatttaaattaaataattaaaattttaaaaatttaa
gtttttaggcactaataaaatttaatcacatcaatttttaaacataaaaa
attattattatacacccatccgtattcaacttattttttactctaattaa
attattttaaatataattaattaaaataaaaatatcaataaactatttgc
gacattagcttacttgaattatcaataagtattgtaaaggtttaattaga
tcaaccaacaattctttcatctactagtggagcatgtttcttattgcttt
ggtttagggttttttgagttttggtttggcctggggagatcggtggtgat
ggagacaaattagcaaatccaagccttgtggatgaggaggaggtgttgat
tcagttccatggggattcggtagcagtagaggaagattattgattctgtt
tggtgggaaaagccttgacggatagtgtggttcatttcccttctttgagg
aggattttgtctgatctatggcccccgttgggaggagtctcaatcacgaa
cactggggataagaggtatttgttctggttttactatgcaattgatatga
aaaagggtaatggagagtatgccttggtcatttaagaggcatcttattat
ttttcatcggttggggcaaggtgaagatccgttacaagtccctttagttt
atacagatttctgggttcatgttcacaatctcccgattggggtagttttg
gagggactggcacgttagttcggacacttcattggacagtttgatcaata
tgacgcaactttggtaacaagggaaataatgaggtatatgcatatcaatg
ttaaaatttatgtgtgaatgcctttgaagcagaagaagcaactgacattg
gatcagagacgggagtatgaaaggttaacattattttgttttttgtgcgg
gaagttaggccatggagagggtttctgtccgttgaggatgacaatcggag
tacatgtagtagagtttggttgggatgcttccttgagggcaccatcaaga
agggaggtgatgatgagtagaaagtggctccatgagaattgttcgggcat
taaccaagcaggtggcaactcgtttgacatggatgtggatgagcatggtg
agggaaaagttttggtgatatccaatttgttaatccttatctaaacagtt
ggagtagggatggagtcatgactaggtagggagataatggatagatggaa
ataggctctaattcagaggaataaacccattgaacagattgatgggaaaa
agagacaacgaatgtagggtattcagaattattggtatccatatattaaa
acagaatcatccgagaacatttgggaaacattaaaaactttatatttttc
taaaaacaattataactaccatgtttcaatgtttgaccaaaatcttaatt
ataataattaattataataattccgataaactatatcctattgaaatttt
atatgaatcaaattcatatattaattttaacatgttctctatttgtatac
aacaagtttgtacatttaattagtttaatatttaactgtcaaattaattt
aattcatgtgacagctaaacacaataccaactgtgtttggattttgttcg
ttttaaccatagggtgtgaccttgtaggttcttgtaacatgagaagtaat
actagaacatttctaataatacaaacaatgagtgacatctagcaatgcat
cattgctacctaagttataagaagtcgtaatttgacataacctttctatg
ataaacctttcatgtattacatccttttgttctttatatctagattggac
acaagtaatggaatagtcacacttgcataatccaatctcatgtgtcttaa
tatcttgagtagactacaataaacaaataagtatgacatatcatatcatc
ttattcgagcatggccatgcatttctagtctcactcaattaagtggccta
tattgatcaatcaaatattactcccattatgtaggagagacaaatcatat
attgattaattatatcccactacatagattgtgacatattcaacatcaat
ctttttagtacaacttgttacgaagacgtttgactgcatcaaaatatatg
acttacgatgttggataatgatgatctcaagtttgagaactgtgtacata
gttatcattatgagtaatgttgtgaccattacataataattcaagaaaca
tactcatagcaggttagtccagtatgttgttctccagcacatactcatgt
attgtttttgacatccctatgtcaatgacaacaatttgtcatcaatcaac
cacacattagtctcaatgcattattgttgtctaagcccacaataatactt
gactaaggaccttttaaaaataataatatattttcttaagactttattac
aattcaatttatttatatacaccgaaaaaagaaactaaaataataatgac
aatgccttatattaataaataaggtaaaacaagtatgtaattacaattat
ctcatgattggtgtcgaaaaaaaatagaagaaacatgatgtgaagaagat
gaatgaggcagaggaaaaggctatccaggacacggtttagatccacaaga
ttccatcgtgatgtcttcaacgttgctgatctgttgggagtaagacgatg
gtatagttgttgggaagaaaccgaacaaccgaaacaaagcgaaagcacaa
ccggtgttctttctctccttataactcctgtaaaaattatggcaagcaca
atagcacaagatatgttctctagcaaccttaatcaaccacaaatcaacta
atgcaaccacaacaaaaataaatagagacaccgatatttttacgtggaaa
acccctctaaattaagggtaaaaaccacgggactttagagtccgataaag
agctccactatcatcaaatgttcaactacaagatcacaatatcaagccta
caacaagcattcaactccgacaaggctaacaacatgtaatctttagcaaa
agagagaaaaatgagagaacatcaccaaaaacgtagctgctgaaaaatgg
gtatttccgacgctacaagactcggatgaaaaatccgaccgtacaaagtc
aagaacaccttatcacctagctgctgtccaaaaatcagctcaatcgaacc
acggatggaccttcgatcgaagagttgatcactgctgcaccaagcttgaa
aatctgattttttctattctctttctctctattttttctttagctctctg
ctaaaatttttgcccaacacccgttaaaaacccaaaatggctttttttga
caaaaccaaagaagggacaaaacattatggcataaaatatgggtttccca
catagtgggacccatacccaacaaatctccccctccaactatgtggggaa
tgcctccatatcggaggtcaaacaacatgcttcaaattttcctcttggta
aggccttcgtcaacatatcagcaccattatcattagtgtgtatcttctca
agctctaacagcttagcttcaagaacatctcgtatccaatggtacctcac
atcaatatgcttagatctagcatgaaaagttgagttcttaccaagatgaa
tagcactctggctatcacagtacaggacatacttctcctgagtaaaacca
agctcatgcacaaacttcttcatccaaagcatctccttacacgcttcggt
tgctgcaatgaactctgattcggtggtggacaatgcaacacacttttgca
gtctcgattgccatgccacagctccccctgcataagtgattaagtaacct
gaagtagatctcctcgagtcaatgtctccggccatgtctgaatctgtata
cccaacaagaacaggtttctcattgccgaaacaaagtttcatgttggaag
tgccacgaagatatctcataatccacttcactgcattccaatgctctctg
cctggattagaaagaaaccgactaactgtaccaacggcataagccaagtc
tggtctcgtgcaaaccattgcgtacatcaaactacccacggctgaagagt
aaggaattttctgcatctcttccttctccttttctgtggaaggactatgc
ttaacactcaatctaaagtgcatagcaaatggagtattcaccgctttagc
tttgtccatactaaacctttgaagtactttctcaatgtacctctcttgtg
ataaccataatttcttggcctttctatcacgtgtcagtcttatgccaaga
atttgctttgctggccccaaatccttcattgcaaaggatttactcaactc
ttgtttcaacttctcaattctagaagcattctgaccaacaataagcatat
catcaacatagagcaaaagaataataaaatcatcaccagagaatctctta
acaaacacacaatgatcagaagtagtcttcttgtagccttgctcccccat
aacagactcaaacttcttgtaccattgccttggagcttgcttcaaaccat
acaagctcttcttcaatctgcacacatagtcctctttcccttgtgcaaca
aaaccctctggctgctccatgtaaagctcttcttccaagtcaccatgaag
aaaagcagttttcacatccatttgttcaacctttaggtcataacaagctg
ccaaactcagtatagttctgatagaggacatcttcacaaccggagaaaat
atttcttcaaaatcaaccccctttttctgagtataacccttgacgaccaa
tctagctttgtatcgtggagatgaagacttctcttcttgcttcaacctgt
aaacccaccgattcttcaaagctcttttgcctttaggcagtttcaccaat
tcaaaagtatggttctcatgcaaggattgaagttcgtctttcatcgcttc
aacccactgatctttgcattcactctccatagcctcttcataacattcag
gttctcccccgtcagtcaaaagaacatattcatcaggagaatacctgaca
gaagatcgtcgatctctgaaagaccttcgaagtggaactgctggtggagc
tataggtgcttgttgttgatcattcacaacatcatccatgggagtatcaa
agtcacctatagtctgatggtcaccactaacatcaccatgcacatcatcc
tggataggatctggtgaagagtctaggggaaccggattcacatcgatcaa
gtcaccactaccttgtgaatccactttctccgtcttatcaatgtcatcaa
tggtctgatcctcaatgaagacaacatctctgcttctcacgagtttcttc
tgaactggatcatagagtctataaccaaactcaccatctagaccataacc
aataaaaatgcattgtcgagccttggcatccaacttggatctttcatcct
ttggaacatgaacaaatgctttacaaccgaacacacgtaggtgatcatat
gacacgtctttaccaaaccaaactctatctggcacatcacctttcaaagg
aacactaggagacagatttatcacatgtgtcactgtattcaaagcttcag
cccaaaacgatcttggtaactttgcatctgacaacaaacatctgactctc
tcaatcaatgttcggttcattctttcagctaacccatttaactgtggagt
ctttggtggtgttctctgatgtctgattccctgtcgcagacaatactcat
gaaacgaccctgtgtactcgccaccattatcagtacgaatgcacttcaac
ttcttcccagtttccctttcaactgatgcttgaaactgtttaaacacctc
aaagacttgatttttagacttcaaagtgtaaacccatagctttcttgaac
aatcatcaatgaaagtcacaaagtaaagtgcaccaccatgtgatcttact
tttatcggaccacaaacatctgaatggaccaactctagcaactctgattt
cctatgaggaggatggcttctaaatgaaactcttttctgctttcctgcta
gacaatgagcacaattcttcagtgtagcattctttaaacccgaaagttga
ttcttcttcgctaaacagctaagccccttctcactcatgtgactgagtcg
tttatgccacaactcagttgagttgtcattcagtgtcacattcaccgtct
ctcgagaagtcaaaagcttgcatcaagtacaaatttgagctcttctttcc
tcgagccacaaccaaggagcctttagtcagcttccactgcccttcactga
aagtgttacagaatccctcatcatcaagttttcctacagaaatcaaattc
aaacggacatccggtgcatgtctgacatccttgagagttaactttgttcc
attgttacttaccaagctaacatctcccataccaataaccgaaaccaaac
catcattacccatcttcaataccccaaaatcaccaggagtataagatgtg
aagaattccttcctcgacgtgacatgaagtgatgcaccagtatcaatcac
ccaactagtctcgtcgcatgctaggttgaccaaattctgatcacaaataa
ctaacaaatcttcacgagtaacagtagcaacacgctcggatttttcattg
tcattccggtcgtgtttatcaccaccacttttgttctctttcttccactt
gaagcaatatttcttgatatggcctttcttaccacaatgatgacactcaa
gattcttgtatctcgatcttgacttgcttcggcttttatctctacccttt
ccatctttgtctctgtttctccccctgttctcgataaccaacacctcgga
ctgtgatgtagaaccctgagatcttcttctaacctcttcattcaacacac
cactcttagccaaatccaaagtaataataccctgtggggcagaattaatg
agtgagactcgaaaggtctcccaagagtctggtagagtagcaagcaacca
aagtcctaaaatctcgtcatcaaatttgacacccataccaagcaactgat
tcatcatactctgaaattcactaacatggtcagctatagacattccttct
ttatatttcagcgccatcattttcttcagcaaaaataacttgttattgcc
cgacctcgaagcatacaagctttcaagcttctcccacaatgttcgagcat
gtgtctcctgatcaatgtgattgtaaacattttcttcaacaaattgccga
ataaagccacacacttgttgatgctcaaattcccattcttcatcactttt
cgaatcgggtttttgagtagtaaagaccggaagatgcaaagccttcacaa
acaacaagtccttcattttattccgccaaagttgataatttgtgccattc
aacataatcatcttgctcgtattaatttccataattatctgacacaataa
ccaagctctggtaccagt
back to top