AC245641

Overview
NCBI AccessionAC245641
VersionAC245641.1
Typeregion
SpeciesGossypium hirsutum
LibraryCotton BAC Library
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Libraries
Library NameType
Cotton BAC Librarygenomic
Sequences
The following sequences are available for this feature:

region sequence

>AC245641.1 ID=AC245641.1|Name=AC245641|organism=Gossypium hirsutum|type=region|length=102054bp
tgccttttgaaggcttaagtatatctgcaaaaggggttataggtacaagt
tgaaaaaggtaaagaaaaatagcttgtaaaatgacctatcttcgtccaca
tgggcagagacatgagcgtgtgtctcagctgtgtgtgacacacagccagg
tagcatgaccgtgtgtccctgtagttttcaaagggttgcaagtcaggttt
tacacggcttggcacacggacgtgtagtttggctgtgtgacccaagtcag
taagttacacgggcacagacacgagctgggacacggccgtgtgtccctat
ttcgaatgcctacacggtctaagacacgggcgtgtctctttgccgtgtga
gttacacgatctggccacacggccgtgtgacccttgcagtttgtaaattt
ttatcttttccctaaaatttctatatgttttttatttagtcccgatttgt
ttctaatgtgtttttagggcctcgagggctcatataagggacaatatata
tgctattgattggttttgctgtgattgatgatatgaattaaatgttttga
aatttttgatagttttgaaatgtaaactccggtaatgcttcgtaaccctg
ttccggcaacggatatgtgttaggggtgttataattttataaagtgattt
tggttagttttaagtttaaagactaaattgataaaataaataaacttggc
atgaaaactcttgtgatgttttaataatcatgggttgtaatggcataaag
gaaaattcaactagcatgaaattgatgaaattgtggtagatttgaaagtt
tcgggtttatggattaaattgaataaaaggtaaaaatcagggtaaaagta
taaaatattgattaaagggtcaattatgtgaattttagcatttaaaacta
ttttaattaaataatttaatgaaattattatatatagatcaataaacgga
tcaatcaatagacaaataatgaaaaaaaaattaattgattagtccttgga
gtcgtgtttgctacagaatcaattttagtaagttcatatagcgtataaat
tgagttaattgttgtttgtgtaatataatatcatttgtgtttgcttgtga
tttaattaatggtgttatgattttaaatcattgaattgttcaaattgaaa
tgaaattataattaagggccgtggtttaattggaggaatatatagttgaa
ttcatgtgacaaagaaatacttaatcatttatatgacatgaatgtgaatc
acaacccgtatgaacctcgtgaatgcttaagattacaaaatggcatgtca
ttatagtatttatcattcgagtgctggtcttggatgtcctaccgatggct
gagatcttgcatttgttgtggattatccacagctcgtgtgagcagcatcg
tgtagcctaacatcttgacccagagcttatgtgagcagacccatttcata
gcttgtgtgagcatttaccgtcacagtttgtgtgagcattgttcccgtgt
tcccaatgctatttctattttggtttatcgggtggaaaatgagtaaacga
aaatggtattatgaaatggatatacaaaatgtttatatggaaatagatat
atgaaatggttatatgaagtgcttatacaaaatatttatatgaatataga
tatgtgaaagggacatttaaaacgaattattgaaataaagatgttaaatt
ttaaatgaatatgtgatggttggtttatgtactaaatatgttttgggtat
atgtttgataacatgataaagttacatgttttatatatgaactcattaat
cttgtgagatttgtgatgtgtataggtaattcatgaccaagatattgaat
tatcttgtaaaatgtttaaattgtatcctttacggccagttaaagttaaa
atttattacaaacttactaagttttacgcaagcttacctcgttttggttt
ttcttccttgtagatcgtcgatttcgagctgtcgatttggttgcttttgg
agatcacagtattcgacaacttgttcggtaattaattattcactttggtt
cggttataagtggcaggtaaataagtgttggtatatatatgttatgagta
tttggttatgttttagtccttttggtatatgaaataatgtaaaaatggta
agttttaatgattgtgttgataaatataatgttgtaaatctatttggtgt
tgttcatgctatttaagtaaagaaatgtgcataagttttggttatttggt
gagcttagtttatgaatatgaacatgatattatgacaataaatttggtag
ttgaataagtaaggaatgattattttgtatgcttgtcttgtgctttggtg
atgaaatggtcattttgctttaggtaacttggtgaactttggatgatgtt
atgttaacaatgtgggcaatggtgttatgtgtttaattaggtattgaatt
catgaaatggaaggtatggttaactaatggttgatgtttgaatgatctat
ttttaaacgtttgaattgtggtgccaatggttaacttaggttgaatgttt
ttggtatgtttaaatgtgttttaaataggtaaaaatggattggaaatggt
ttgtgtaacaccccttacccgtatccaacaccggaatagggtacgaggta
ttaccaaaacacatacacttgtaagcgtatttaaccgagttataaaattt
catctaaataaaaaactttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnaagaataaactgtactattttgctgaaccaa
aaattctgaaaattttatgatatgaagatatgtgagtctaatttcaggaa
aaattaacggatcttaatttggagctctgtagctccggataaaaataatt
tagtgactctgactcggataaacagttttgaatatacatgttagtgaata
ttgaaattatggttaatgttgtttaagtgtgttatacatattaaggatgt
ggaatggagaggaggaggaggaaaattgggaaatatatgaatgattcgtg
tataaatggtcatatgtttgattataactgataaacgatgaaatatgaat
gatgcttatatttgtgcattattggtcatgtttaagctcatgtgtgaaaa
taaggtttcatagtatgtgtgtatggtatattcagtatatgatttggcat
gaaataatatcatgaatggtttatgaattaacacatgttggtaagcctga
tatatgaataaatgatcaaattgagcggaacgccggatttgagtacttct
gatcaagtgacaaagtgataagtggtagctttagctacacttatctgatc
aagtgacaagtggaaagtgataagtaatagcttcggctatacttatctga
tcaagtgacaaagtgataagtgatagcttcagctacacttatctgatcaa
gtgacaagtggaaagtgataagtgatagcttcggttacacttatctgatc
aagtgacaagtgaaaagtgataagtgatagcttcggctatacttatctga
tcaagagacaaagtgataagtgatagctttagctacacttatctgatcaa
gagacaaagtgataagtgatagctttagctacacttatctgatcaagaga
caaagtgataagtggctacacttatctgatcaagaaacaaagtgataagt
ggctacacttatctgatacacttatctgatcaagaaataaagtgataagt
ggctacacttatctgatcagggacaagtgataagtgatcatacgtaagac
catagttatactatggcaaagtgaaagtgaagtactcaattttccgtaac
cgttccttaatttgattaaggatggtaagtgacaaatgggcccaaaagaa
ttaaagcaattggataagtggtactgtatttataccaggatgatgttgtt
atttaagctaaagtgatatcttcattgcaaaattgagaatttcataaatg
tgttagtgaatggtataatcgataaacgttgagttaaatggtaaatatgt
attagtgttaaacttagtgacattgaattgtacgtgaattaaatggaaat
tgctagtgatatgatctaaattgtgagcatgagaaattgcaaattgaatg
aaatggaaatgaagcattgaattgcatgagaatgtgatgggtttcgtacg
ccctaattattatgattataatatttcgaggatatattgtgaaaagttat
aaacacatgttattatttcgaaagttttcatttacaggaactttatcacg
cggttcactccccctaccagtgtttgtggtatggttaaccctccttccct
atcccgttgtttggatccgtaacggcgtgtccccccaccatttcccaccc
ttctctcctatttgtaccgccgcttccccccccgacaccgccccccacct
cccccggcgcccccctctcccgctgttccttccaccccccccgacccccg
cctagccacctcaccgtcgctgccccactcctccctccacgccccctctc
ctccctggcctcggtcgactcgccaccccgccccaccctcccactgcccc
atctcacctcgcacccttcaccccctctccttcctcctagttctgtggct
tgccctccggagtctcccccacctcgcctccgccgtcccgtcccacgctc
cccactcccacccgctagctagcaccacctctctcacgcagtcgcccctc
accatcctcccgtcctgttgtattcggactccgccgtctgcctcctcccc
cgcctccaagtctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnaaaatataatttactatttactattatataatttata
aattgaaggggacccaaaataatatttttaccattttagtttcccggcca
tgccgagcccgttggcgccgcctctgttcaaaatctgacctttaaaacag
cctgtttgaccatcattctttatttcctgtttcattatatcttagtatat
atgttttccccagcttcaccgggaaatcctttaatattttttgcttaaac
ttttataaataataatgataagtacccgaaagtaattaatatcaataata
aagattaataaatttcattcaaacatatttttttatcatttgtcaatgca
tatacttctataattttattatttttggtaatttcgtttttgtataaaca
tataatcatttgttacaattaaattaaaattaaacaacaattcattttaa
taaaaaaattcaaactttttattttattaaataaaaattattgtgttaaa
catagattgttttagatcaaataatggttatggcctctttaccatgttta
gatttagaattcaatatctattctttaatttaatataattctgttcatct
acaaaatgccattagttagttgaaatagttaatacccttaattattttgg
ttagaatgttgtgcttgatttttttttcttaaaaatatctatttcaactt
catgaaaatgtacatatgttgtgttagataggtgtttctaagaaaaatgc
acacaataattttaatctatatggttaaagattctaattatttggactaa
aaatgctattataaaagtagatgatagattatatcaaattaaaatataat
gattaaatctgattgaaatataatttcaccattataatataatgacaaaa
aaaattgtcattagtaagcccaaatatttagcactcttgatatttttggt
ggccaacataaatttcttttaataacatttatttcaattcattatgttaa
aataaaattttattagaataatattttttgaaaaaatcaatataaaattt
aatcaaaatagctaactaatttcattgtaaaatttgagaactatgtcgaa
ttaaaatataaaaactaaatctcaaatgttattataataaaaaaactaat
taaaattttaccattataattatactagaaaaataaataaacaaaaggtg
attggacgcgtgttttatagattccccctagtacacttcgtgtgtagcct
ttctcgttagatagggcatttgggcttggattttggaccaatggaaataa
aaaacaatcctaagctcacaaaaattgaatttagctcaaaataatcaggc
cctgatgtggttaaaaattgaatttgggcttggattctaaacctaaatat
aaaaaacattcgggttaaatggaaaaattttacaatcaaatctaatgctc
aatgctaaaccatttttctccctaaggttaataaatgtgttaaatacatg
gatcgaaataagtaagttaatatttgatgcatagagtataattttatgta
tttcaagtgaattaaatgatgtaaaacaaatttttgatgatgtgtcatca
tttggtacattgatagtgcataaaattatatatctcattggatttataaa
tagatactccaaagcccccctttaacggagcttctccgagccagaagcat
aagtgagcatttgagaatcaccagcaggtcaaaattcaactgccaacaag
caaacaggttttccttccataaatattacactgctcataatagtagttct
cgatgtctaagcttagtaatttacatgtacaaacacaagctctcggagtt
aaacgacttaagacacatacaacagtagccttatacacaggtttgtaaag
gaaacagagcttctacagtacagagctccagcactaaacaaagcttaagc
tctagatacaacaacatatctcgtatgtctctccaacattattagaaaca
taacaggagttgcgaagacataaatatagcatctaatatcaccaagaaaa
aaacacaataccaggctcttcagtggtaagacaacatcgtttggcttgat
tcctgaaccatgaagtggaaaatgattagaggcacaccccgccattggct
gtagcagcttcgggatggtaatgaagcatttccttccacatcttctctct
gatcatctcttcccctaaatcctcatctatgtcaagatcgagtggcacct
gggctgaagggttgctgttcggatcatacaatggtgccatgtaagggtgt
tggagtgcttcagttacactaatcctttttgaagggtcaaaaacaagcat
cttttgcaacaaatcaattgccaaaggatgggcattcggataaagatggg
aaaaggggcttccaagggaatatggaagtgatttgatgtatttccttgcc
ttagggttatctataaattcaagatcctcctccttctggctgccaaggat
gttgatgatcagcttaagttgattgagacattctgtaccagggaagatgg
gtttccggccaagaagctccgcaaagatgcatccaacagaccaaacatca
atagacgttccatagttgtcacagcagaggagaagctcaggggccctgta
ccaacgagtgacaacatactctgtcatgaattgacccttggcattgctag
tgcgtgccagtccaaagtcacaaattttaaggtcacaatttgcattgata
agaaggtttccaggcttcagatctctgtgaagaatatttgccgagtgaag
atatttcaggcctcggagcaactgcaaaaagaagaacaatgaatatttga
tcatttcctgtcacagtagaagctttaaagcagaactacagaaccacaac
cccacgtatgtatctcaactgaattattatatagagttgatgtctatatt
tgcgggatatctctttacatccaaatgactttgtaaagtggcagtcagac
agaccacagatgcaagctactaggaataggattcctaaggaaataattta
tgaagaatgataggtcaatattaattcgtataaaagcttgttgaggtgta
atcggactggatccattagtgatgaagtaactatactccaaaaattaggc
cagtgcattaatatgcctagaacatgtttctccctagacctaccatgaac
taacactcataaattctggtcctcactgttatcttgtcatgttaaaacac
aggagatcaattagctgaagcaaacacttttctccatcaataattcaata
tggtgctaagaattaatataacaagcagaaactgcccctattcagtgaac
agaaaattgccgaaaaggaaagcacataaaatatcttaacaaatagttac
atgctagtaaaacataaatcatcaaaagatattctagtagaaccacaaac
atatacaacatagatccaggatgctaatattcagatccaaattcgaccat
ttaatttctagcttctttgtctaagctgcatttttatatttcaactcaaa
gtagataacaacaaacgatctgttaatgcatccacaacacgcatttgaaa
ttggagactttcattcaagtaatgccacgtagaaagagcaattatgcata
ttgaagaaatctaataatgatcattggtaagatacctggaagaggaaata
ctgacagtgatcattggtaagcacttgagaagacttaatgatttgatgca
aatcggtatccataagttcgtaaaccagataaacatccttgaagcttctc
ctatgagtcggcatcatgacatctttcaaagcaatcacattcccatgtct
aagatgcctgagaagcttcaattcacgcaaagttctgagagcatcaacac
ggttctcaaaggcgttgtttattctttttaatggcaactttttcattggt
ttcgcgattcacagaagagcaaacgatcccatacgcccctcttccaatag
gttttttttctgatcggcacatatttggtgtcgatttcgaacgtcgtttg
ccacatcgaatagtaatgttttccttggtaatgaataccgttaggaggct
caactggagttgccattttcctgccttaaccaaaatttttaaacccccca
aaaaagagaagaaaattaactgaataactaacttaattcgagaataaaca
aaacagttctgaataagcagaaaacaagttcctatttttggtttgtactt
ttttttaataattactacttaattagtgggagccggttcactttatcgta
caattaaaggaattaacaaaaagaaaaaaaggaaaagaaataaacagaga
gagatctttaaagttttaccttgtttttggttaaattttctttattgagt
ctaatttattccaaaagaactgagcttcaaaatttcccgcgatacaggag
cttcacatctgatactgctggctaatccacgtcctgattcacttcaaatt
tctcagaaacaaaaagggaaaactaaagctccattcgcttcgatgaaacc
ctaatttaaacaacgtcaaggttggattttgaatgatcccgacgccgtaa
agtatcaagccaagctcgaaacagaaactttcacggtgccgaacattcag
aaagaaaaaaggaaaaaactttaggaatgtaattattttgtgtcaacgat
gaggttggatgggatctactcataagagtaagaagagaaagattcgttat
ctcatcgccatccgatcataacaacaacgacgaaacaaaaccaattacta
ggtttttttatttttataatacacacccctttaattgatatattaaattt
tttgggggggatatatttatttactacggtctggatttttggatatttgt
ttttctgtttcacgtagcgttagggacccccgtatcagtagcaaagcgga
cgatctttttattagagtatacataggttacggcgtcgtttcgaatcccc
ggttgaagcggacgtcaaacgacgtttaattatttttctaaatattttga
ctagacgctttttgtggataaaccaagaatattcgcctattcgggacgac
catggcgcggaaataacggatgagtccttcgaaagttaagtctacgagta
tgcaattttttatatatttttaaaatatgtattttacatttatataaaat
taaacacgagaaaaggtttttactaaaaaaattacaaatattataaactc
aatttgacttaataataagcattttcaatagttattgatgaatcggactg
aaagttaattcttgatttgtcaaatctgaaagaaagaaaaaaaaattaat
aacaatatcccatcaatctctgccttttaggtgatcacacagttgtttaa
tgttttatcctctctccttcaaacaacaacacacggataagaagagttaa
aaagaaaatcgccaaattcctattttaattttactaatttcctcgaaaat
cgcaaagagagagagagagagagatcggagatatttgtttggcaggtaaa
agttgtggatagttgatgcgcatcctgcatttgcagatacaaatcagtga
ttctgaatgtatgtgctgagttctcccaaagcatttttaaatcagatgag
atgagagcgtcaacctatgcaaataggtatttcttgctgcttcttttagg
ttactatttctcaatggaataagttaattgggttttaatataatatattt
tctttctttctttgcttgaatcaaattttcgtttaacctgttggcttcat
tgttgaaatcattagcaatgagatagcagataaatggaagttctgtttgg
gcatgctggggtaggtttgagtctcttttgtcttttaagctggtgctttc
aatttggatgctctgagcaccttgctggtggctgacacacggtatatagc
actaagtagaacaacatgggaatcaaaaattagttgaaatcttaaaaatt
tacgcaccaactcaaactatgtgaaccagaaagttaaaatgtattctcat
ttacacgtatcatttataacactgtataatacctgcataaaagacaaact
ccaactaacttgtagaagtgtccctatttatagaaaacctcccgatgaac
atagcatataatttggaactggattctctattttttcccatttctaattc
gtaattttttcttaaaacgaatcgaatgccaataagaatgcgtgtgcgga
acaagattgtaagtttctccaattcgcaaatttagtttagggctctagac
aataaaggaaaacttagagtttgacacaatctaaattacaaacaaattca
aatagatttataaatttaaaaaaaacacagcaattaaaatgaataatgaa
gatagaaaaaaaaaacaacaaataaataaatgaaagatttgaacaattaa
taagataaaataaagaaatagatagaaaagatggaaagtggctagtaaaa
ctctcaaggagccttgaaaactagataatccaaaatcccttttaacataa
aactcttaaataatctaaaatatttaaaattattcaaaatttggaataaa
taaataataatataatataacttaataagtatagcattaaattcatatat
aataaaaattaagcttaaaaatcgaacccaatatgatttaaatttgaatt
aaaagtctgaaactcataatttcagtaataatcctattcaaaaattctgc
tcgtgcagtcttttactaaaacgtcataacttgagtttccaaactcaaaa
tcaagtgattcaaagtgcattgcgaatataagagataaatcttcgatcga
tataaagccatattgacccagaaatacctagatcccttctaaaaatgcct
agaaatcggttctaattttttgcactagcccaacctatgatcaactttat
ttattagttgcttgtttgatttaatttaattgttttatcgattcaattat
ttaagactctgactaagttaaactcaggagttaattgggcaccaattaat
tagaaaaattatgtaaatgttgttccgtaattaaaataaattatagtttt
aagggtatttaatcttttaatttaaataataatcaaaatatgcatatagt
gaaattcgaatccgtaccaattgcattagtaaaaccttaaatttatcact
taatcaaagttttattatacttttttatatttattatatattattttcaa
acacaactctatattttaaatacttaatttctaaacatatatatgttata
gtaatttttaattaattattatatggatgtaaatgttgattattgattat
gaattctttcttgaagttatacacttggaatattgcctttaaacaacata
gtggcagttaaaatttttgatttacaggatattacaatacgtttatgatg
ccttcactatcgacaataggaaacgtattcaatcaactaattaaactgga
agccaaacacagggtgtttttttggacaaacaaagcaagagtataatact
aacacaatgtttggttaggagaatgaaatagcattccacctttatttatt
gaatagtaatttatttatttatttagttaaacgtaatatttatttaataa
aatgactattattttcctattatttatctttctgtaatagctattcttta
gtatcaccaaagaatgactatttcatgcaacattgaataacaaaaaaaat
taattttcaaattagtcctttaaaacttggacttagtaaatataaaaata
aaatatttgaaatattttaatataatttaatataaaatatttaatttcaa
agtataatttaaaataaagtattttaaaaattttaatataatttaatata
aaaataattatattaaaaatattatttttattaaattatttttaataata
atcctattaaaatttaataacaataataatcatctacctaaaaaataata
gattgatcagttccaaatatgaaaattcttctagatagtcatataataga
ggcgggtgcttcagaagagacccaagacataactaataagtaaaacttta
gaagtgatttaggtacttgaaactgaattttaaaataatgaaaataagag
atcttaataagttatgtcaatttgagaaaatgtggaaccaattaataaaa
gtggtcgacaatgattttgtatgtaatattattattgaaataatgaaata
aaaggaagatcttgaataaatctattgagaaatatatatatgaaataaat
tgatcaaaatagaaagacgcatctcaagtacaactaaatttgtaaaattt
tttgaccagtagtccaaatatctaaaggtataaagccagtgagggtgcaa
attaagtagtcttgtaaaaacagaataaaaatatgaagtttttcgctaag
tactgatattgattatgaaaagatataataacgtggatgcaataaccttt
agacatataattttgatatttccataaaagatttaacttgcgcccaatga
tggttgttacaacctttataaatcactatatagtaaagtttatattaaat
cctagaaggatttagaatgctagaaacatattgaaattctcaagaaatta
ttcatttatatgaattgaaataattgaacatatgtggtaaatttaactta
gtcaatagtagttgaaagaagattataaaatgatccaaaatacctttttt
ttatagaaggatcatgattaaagtttactatgattattgttgaaactctt
aaagagatcgaaatagtttcccctaaactttttcctcactcatgattttc
aaaagaatagtgatataaatgcctagcaatacatttaaatagccatttga
aaaactagtattcaaaattaaattcgtagaatacgaaaaagtatgtaatt
ttttggtaggattcacttatttgactttacaaaaaaaagaannnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttacctgta
atacatattacatcatcattttgctaatggattaataaccgttaatagac
gagtgacaaaaatattataaatcaataaatttagagattatttttaactt
ttcatagtttagtgaccaaaacgataacttacaaacagttgaatgacctt
aatgtaacctacccttcctttttctataaaagggagaaaatttgagttgt
ccaattgaaactctagacttaattaaagtgtaacctcgagtccaaaatca
agtaataaaaatctaacatttgagggaagctcaattgggtttggttacta
aattaaaaaaagaatcaattcctataatttcatactcaattatttgtact
tgagcttaaacatttgttcaatactaattataataattataataagaaca
cttcatcaagtttgtaacaaaccgagcaaagcattatgatagccgaatct
caaaagctaaaactcatctcaacaacaacgatttatgttgaattctagca
tttcgattagcaagaagaataatttatgggcaaaaatgtgttgtttgcac
cttattgtaaccatttatcccagtatgctgccacaaataacttcgttttg
ttctcaactctttaaccattcatcttgtttaagaacgtaaaaataaaatc
gattaaattgttaattctgagaaacgagtttctaatgcagagaactagta
atgcagcttctttatcctagttataaatacaaattacagagcataattga
ccaaatgctgaatgcagcaatgcgaaccttaggttctgaaaatcgagaaa
ctaacagtgctcttttgaagacattaaggtcccgcaccctccataaactc
cacccgacagacacaacacgcggcatgagcacaatttactgtgtcataaa
ttacagcaaagaagagttaaaaaggtaaaatacagtgaagttcttagtaa
gtcacttttcctaatcaattcaatgcttcattgaggacagatgcctgaag
gtctaagttcctcagtatcagtcattcataatgggatgtaaaacctacaa
agaacaaccatacttgccatccggaaatcaagaaaaataactttcatttc
ttgagaaatatgaactcccaaaaccccaccatcggatatcttggttccta
ctgaattccaaaactaagcgtttaaatttgatccaattcaaagttcatca
cactcatgccctaccctccccaaagcaaatgggcaaacagaagtaaaagg
gctagagttataaggtggtcgttatcggaaattttctgcctatcctgttg
atggtattagcttgaaaagggaaaacctctgacttaataagctcagacta
ggttgcattaaaacttggaagcctgactcgtacaaaccctttgaagtaag
gggaacaaacacatatttactgaccgtaatgaactttcatgatgaaacag
acaggctcctcacctgatgccagtagaagagggaattcaatcttttcgat
atcttacccaaaaccccttcttcctagcagagtcgttctctgatagcaat
ctaccccacctagacccaattgacaagtggcgtttcaagaaaggctttgc
caaggagcttctccggcttgaactgggttccagctttggagtttttcctt
ctcgtttggtgttttctaggtgttcaatatcactacaaccaccatcaaca
gaattatctataactctattctttaacaacttaagatgttttgctttcaa
ctctgcttcagcttttaaagcttttctgcacatctttgagacctgctttt
ctccaaccatacaaattgggcaggctgggtcaaatctgtcagcctccggt
gtcatcaactccaagcattcagcatgataaacatgtccacagacaagcac
agaaaccactgaaatctcattgctactccatgaggatctctcagctaaaa
gcttcgagcaagcaccacaagttcgtgaatctatggaaggagagtatgag
aatctgctgctacatccacttatcttgccataaccagaacctaagtgttc
gctgtcaaaagaccacctttctctttgagaagaggccacaagctctgaaa
atgtgcgcatggaccaaccatcagaagaaccaccatgagatccagctgtt
aagtcattgctacatcgggaaaggacaaaagaggaccttgcttcagacat
tgaataattatttggcgacttcaatcctaggattcgactatcagaaacct
gcctcaatagctgttgcccaggtgaacggtgagcccgtcgtaatgaggtt
gagtttggaggaagcaaatgagcatggctagagaacgtgtctgttactgg
tggtgagaaagatgaaggtatataaaatgaaagctttggtgtagatgaat
caatgatatcgggcaattctaccaaactctttatctgaaatataatcaga
aaggtatattaaacatcagtagaagaggctagtgtattacccaaagacac
agaaaatacacaagcatagaaagctatccaactaaagtcaatatcaacta
aatcaaacttacatcaaccgaataattgcttcctcttgatatgtctgcac
caacaacataaaacaatgtcaaacacaacacaaacaaattacaaaataga
gggaacagactagtagctatattactcaaaacagtattgggaaaaaaagg
atagaagtagacaataacgtaatgcctgcaacttgaatatataaaacatg
ctgttttatttagattctaacatgctactctgcacgttaaaggttaggca
ttatcagtcgcctagttgttagcagtaaatgggataagaagaccactaga
gccttttgcatttccagactagtagctatattaataaaatagaacagaat
tctagaaaaaatttcctaaaccccccatgtatagtcaagatagtgatacc
aaaagctatccttttaggctctttcaattaacatgtgatttacctgaagg
aggggtcatcatattcccacccatttcttcatggactggtgatttttgag
aagtgggtgttccataggtctcaatctcaagaggacttccttgatcagaa
aaattacctctatcagagcctaatgtcccttttatctccatgctaacatt
tcggctagctccattagatacctgataagaaggctcatcaatttcaccag
ctacacgccttcgattatctcggcagaagctccatgatggtgaacacctc
aaatttctatgagaagtctcacctcctgttctgtttgcaatggttctgtc
ccttgcagcaacacaacaagcggaccccatggtcacacaaatacccaaga
gagaatttattacgaatttgcaacaccgattcaagctacgaactcaaggc
aaataccgcatagatgataaaagaggatatttcctgtttaaaaaaaagcg
caaagtttgaacttcacaattaaaaattgcaaagatcgattcaacagaca
gcttaaactaacttaacaaacttaaaagatgctaaatttcgttttctaag
agcatttttttctgttttatttcatttctctctaaactccaagatcaaaa
cctaggataaaaattatttaataaaaggaatcccatgaacatcagtttta
agaaaaataaataagcagtttataagagtacattacttgggagtaatata
caggttaatgtatattctcagtttgaactgattttggagatcaagaacaa
aaataaataaaattattttttaaaaataattattaatagcagatagcata
gttgagtaaagtaaaacagtagcgaaaaattccagacagtggaaagcatc
ctactcaattaattaagcactacccggctttccccgaaacaagaataaga
ataatgtaaactaaaacatttaagtaacgaatatttgcagaattaaattc
tcaaagttcacaactcgaaagcatagttttattttatttttttcacaaag
aaaaaggcacaaactcaaaacagtaaaaataaagaatcattggttcggaa
catttactgtggtactaaagaaaaatcgctcacaagttatcgaaaatcca
gggaaaaaaaataaaagaagctcaagcaagggcgcgaaaacgatatcctt
ttctactccattctcagaactgatttcaagctttcaacgtcccaacaata
tcatccacacaaacaaaaataataacattaatttttctttttttgtttgt
aaaaaaaagggaagaaaactcacgaattgaataattagagaagcatggag
ctgaagaaaaaagagaaataatagattcgaacggagtcgaatatttcaaa
acggcggttggtgaggaagacgacggtcgccacgggaacgagggaaaaga
aattgatgcgtgaaaaagaaagtgagagagtcaaggggtgaacgtatggg
gaattgtgtctcgtctgaatgtagtgctgctactttttccgctccctctc
tcctttttgttttccttttcttaattaattctccttaaattttatttccc
actataaaacgacaaataagaattaatataaagatgctgcagcatttttt
tatttttacggttactttttttttgtataattatatttccattatatttt
atattttaaggttttttatatatgttggataataccaaatctggattttc
ttattctttaatagtcagttaattttttaaaaaataccttttagctagaa
ttatagtcacatcttttttcttgtatcaaattatatatatagccacatgt
ttttttttcccttactatttacgatttatatgaaatatatattaataaaa
gaaatgaagaatgaagatgaataattgaacaagagttgctgaccactatt
tcctatcatcccctctggtgggtccgagacattgtgagcttttgtaaatg
aaagttgataccgacctttgactcactttcacttacacattttcaatcct
cttccctttccttcttgtgaagtatcatttctccgcaaagtgtaatgggg
tgtttttagtaatttaggacgtataaaataacataaataaattcatattc
caaaatttatgtaatacaaattacttttatcatctattactaaagttttt
aaattctacaagtttgtttcgctaaacacaggcaaaaaggatactcacac
agaaattggcatgcaactttcaaggcaaaaatctctaatgaaacctctag
atagcatacccttgcattggatatatcaaaatttgaaatcctctcattaa
agggtaaaagtataattttactatattttaaaaatccctctactacttcg
aaaaactcacgtacaggtggtggaattgttagcccttcttttagctttgc
tctcaaatcaaacgctctaactgtcagggaaggaagacatacgattgtga
tgagtagagaagagaatgaaaaagtcaagccagagaacgaaaaatacgca
ataaagcaggagggggagagaccaattgcccaggccataaaatccactaa
atgcactttcctcaaccactccgatgatgatgatggtacctcaacaagat
catctccagaagcctcaattgtttccctggcagaagattcaattccatct
aaggaaataaggaccaaaaaccccatgaagaggaggaagcgacctgttgc
ctagctacacaggttgttcatctactaacccttataattctaaacgcatt
gtcattcctccactaaactcatcaccctccaacctaatggatacatatca
acaaataactagacaaactagaatggaccagaaccatcccgatgaatatc
ctaaagtacaggttgatggaagttcactacaaaaactttagttgatagcc
accgtaataaaagtgaaggattcaatctataagcttcacattttgtctca
attccctgttgctcatgggtacgaacatagtgctccacaagataaaattg
aatccaagcaaggaacatatgagggaatgggaaccgaacaggttcgcaag
gtatttgacttcaccaccctttaaaggacttatgacgatccctgtatgaa
attgtaggggtgcatggtactatgattttgtttgaacaatgcaggaaatg
gttcaaattcacaacctgcaaattttaatcattatcaaaactagagtcca
agcctcgaaagtgcttgacattgtggattgacttcaatttgatggctact
ttgaaaccaaatatggttattgtatcacttagattgtcttcataattgtc
gaactctgcaagatcaaacaagagttacatgtaaccatcaaggtacattc
tacctaacttttattgtatttttatctactatatatgcaagccctagaat
tagaaaacataaacttctttaggaaaatctttaaaatgtagctagacacc
atagcatgccttggctagtcactagagattttaatgaaattctaacttcg
aaggataaatggcgagcttgaccaccatcacatagaagaatgacataatt
tcataactgcctaaataaacgaaatctcattatatatgggttccaaggga
cctagatcacatggtccaatttaagggaaatgagtaaacttatctcatta
tataatgaagcatctatgactcaacttcctcgaataagatcaagtcattg
cccctgttgatctcccttgtaacacccctcgcccgatccgatcgtcaagt
ccaagttataagatgcttcagtcgttgtcggagcaactataaacatttga
taatcaatttactctataatacatgcattcatattcaagtcatctcataa
ttacattatacgatctttttcgggacttattcgagcttacaaaagctcat
ttactaacccgaccttaaaaaataaccaaattgtaatattttcaaagttt
tcaaattagacattgataccccataaaggtactgataccattttggcctt
cgatgttttagaaaattttaaataaaaataaatgtatcgataccggacgt
aaagtactgatacccttgtcaaggtatcaatacattatctctgtatcgat
tctatttttaagtttgatgtttgaaaatttaaggaaaatcactaatgtat
tgaaacccttttttaaggtatcgatacttttatgtcaaaaatatcaaaaa
ctcactttttggtacctttttcatgccaacttaacattttcatctaaccc
cttaaggtttcttccccatagttatcatttagaacatgcacatattgtca
tccaagataataacatggaatacaacgaaccctcaaatcatatcatgact
atttcatgcattttaacatgcaatgacgattactcatactaccatgcata
catgtcatacaatcccattatgaatcagactagccagattggagattaga
atctcacctcaactctttattcttggtagctcagcttgtcattttgccag
agttttccttcatcctagctacagttccttattcctctaatgccagactt
ggctcctcgcgatagtaacgccatgcaaatccttccacaactacctcatc
ttcctaaaggagaagatacttggttcaaaggaggaaaagatggtgaatag
aattatgaataattatgtttccaactcgtcctatttatacccctttgcca
cgacctctacaaaccgtcattaccactcagtcctaattattctgtcttcc
actatagaaccaggcggttctaatccagcaaaactagttttgagagtcaa
ctcttccccaaccagccacttaagtttctaattgtcttattagtgcccat
gaatttctactcctatttaattaaatccccgactcttccttgagttcagg
tatttggatatccaggtgtggcagacataaagaaggaataagagttaaaa
gaatcgaaattcacatcactcaaaaccttaaaaagaatccttgaaacctt
cataagcatttcaactttttttataggtggaggtcacgatgaactttgtt
ggaattttactaaatcagatcaattttcactagcaagtgtatatgagtta
gtcgatagccaattaactcggtcactacccttggataatttagaacaaca
ctggcaatatatttggaaaaccaaattcctatacaaaatcgaaatgttca
tccgggaatgcttcaagaaaaatactcccaaccaaagatctatttattca
ttatgtcttcaaactacaagatacaagggatttcccttttttttataaaa
accaacccgaaacaataaaatgcattctccgtaaatgcccttttctagaa
attagtgaaacactttaagaaacaacttatcattatggcataactagaac
aataactggtagtatagttggattcaaacattaatgcaaataaatggttt
ctcaaacctaaaatcccttggttaatatttttttgcttttacactaagaa
attttgctattgagaaatgccattctctttcaaaagaatcccaaacctga
tctcatgttcgtaaagcttatggaaaaggcaacaaaatacttcacatttt
ttgtcaaagtaaagaaaatcagtgagcccttatgcgtccctataagatag
caaaaattgaaacttggatttgttaaaatcaataccaatggcttaacatt
aggaattctggggcatagtgaagttggatcaattattagagatcacgatg
gaaagcatgtgcttggattgtttaggcacattctaagagctttgagtgta
gaagtggaattgtaggctttacgttacggtcttaatatcacattatcaac
aaacttgctaaaaattaaagtagaattgatgcatttattgttattagctt
cattgaaaattctttacatgttaagcatttgttgcgaactttaattgatg
gttgcaggactctccaatattgtttccaacaattgacattgaagcatatt
atatatatagggaggctaatcatggagcgaatgccatggtatgagaggaa
caattctaacttgtcgtcttactcaaattttattttgttagaaacttttt
gtgaatttataatgaatcacttgatgaactttctcctattttgatggttg
atgccaatgatgttataatgtatcgtgtaacacctcttacccggtccggt
tgtcggacccgagcaataaagagttaccggtaattatgaaacattcacaa
gcatcttataattcaaaacctcaattattaatcatagaactcataaacaa
tcaaattaacatatgtttcaatcaatttcagattaatattgagcttatga
aagtttaaaatcaacttggtaacatacaaggatcaatttgaagcttaaac
aaaaagtcgagaaaattttgaaaacaggggtcacatgatcgtatccactg
actgtgtgagataggtcagcaggctatatcactgggttgtataacaaact
atgattgtgtgcaccaaaatcgcttaaaaacttacagaccacactactgt
aacacctctaactcgtcttcattgtcggattaaggtttcgagatattacg
acaattaacaagatcgataatacagtaacacaacttaaagattaatttaa
acatcataaattaaataacaatcatcattcatagcatacatttaaaaacg
agacttaaattgagcatttggaaccctaaaatcagtttagaaacaaatgc
ggactaatttgaaataaaacaaaaaatatggaaaaaaaactgaaaacaat
gttcacatggccgtgtgacagagcccaaattgtgtggcttaaagacatga
ctgtgtggccaaaccgtgtaacttagggccatacggccgtgtcgttaggc
cgtgtaactctttgagaccatgtggacaaacttgtatcaaaaatcaataa
gacacacgaccgtgtgaagtaactgtgtgtggcacacagccgtgtggtag
accgtgtcctaggccatgtgcacctaaaataacttcaaaaataagtcatt
tcaacaaccatttcttagatatcaagccaaactgtaatagcccgatttta
ggcctagtcggaacagtggtttcgggaccacaaatctgacgagaaaaaaa
atgtaatggcctgcattttcagaggtgtcggaacggtgattcgagatcac
taaattcgacaaatgggtagaaaatattattaatttagtaagtataagtt
aaatgtgaagttaggaaaatttttgaaatagtgaatagtgcactagaaat
aaatattaaaataattagaatcgaaatgaggtatcaagacctcggggatt
ttaaactgagccataaatatttttataaatatttatggagtgttaaaaag
ttagtatgaaagtttcggtaagaaactttaaagttccgataattaattga
acaaaaaggactaaattgtaataaatgtaaaattttggaaaatgattaaa
tagcttaatgataaaaggaagagggcttaaaaggcaaatagacccaaggt
ctatttgggctggacggcagaggcatgaaatcagcaagaaagtaaggaga
attaagggcaaaattggaaaattgcaaaatttgcttaataaagttaggac
ccaagtggaattatctagatttctcttcatttttctgaattctcatcagc
aaaaacaccatggaagggcttcttcaagctgtttcttcatatttttacta
caagtaagttcaattcttgactacttcttgaaatttttgtatttttatga
cttttacaactaggcccacttgttaaattcattagtttttgattttatga
aagaagttgaaagttgatatgaatatgtgctggaattatatgatgattta
tcatgaaattagagctttaaattgttcatatgctgattttattgaaagaa
ttgaatagaaagtgaatgtttgggacctaatagtaaaagagtttgaagat
agagttatatgtggaaattctggatttcaatagttgagtaacaacttata
atgtctaggtaaagtattaattgagaaaattagattaattgaggggttaa
ttgagaaaggaccgaattgtataaactgtgaaatttggggcaaaatggaa
atcaacattttgcactaaagcagttttggacagcagcagtagtgtaactt
tgaaaaatcaccaaaaattgtagagattgaattagaggatgaataaaata
tgaaactaaagcttattgagtctagtttcttataaaagaaatggtgtgag
caatggaattgtaagtcatgagatataatagattttgtgagacaaggtca
gaatgaatttgggttccctgttctgaatttggaaaatcattaaaaatcgt
aaaaaaattattatgagttataatttatatggttagaatccttaatgagt
ctatttttataagaaacaaacgaaaacatcatccaaattctttacattga
gataattaatttttagtgaagagtggtcggaactctcagacagcgaaata
ggggaaactttaaagaataaacttactatttggtaaaccaaaggacgagc
tcgatttatatcaaaaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnaataaaattacatataataacattaaatttaa
tcaacaatatacatattatagttcatacgaacttacctagctaaattgca
gcaataccaaagtttaggggcattttggttatttttttattttccttgat
tttccacccgatcttgatctaaattaataatttcattcaatatattaatt
tagataataaaacaattcatttcacataatttggtcatgtttgaaatttt
tacaaaattgctcctaaagttttacttttattcaatttagtccctaagcc
aaaaacatgcaaattaaccatttttacccagaattgagcttagctgaatg
ttcatggtatccaaaacagcccatttatgcaacaatttcacattaaatcc
atatacttttattaatttaataaatttgtccctaattaaaaattttcatt
aaaatcacttaacaaaatacttttaaatataaatcaacattccaaattca
tcatctaacatcaaatatcacaagattcatcaatggaaacatccaaaatt
tttaacaatttcaaaatcgaaggtacaagctagttggacctagttgcaac
gatctcaaaaatataaaaattacaagaaactggtagtttaagggcttaca
agggatttattttgctgcaattttcaagcttccatggctctttcttgctt
gtataatcggttggtgaagagaaaataacaaagatgaaagctttgtcttt
tgttttatttattttatctttaattacctaattacctaattaccaaatta
cccttacttaactttaaaaattacactaatgtcaagccatgcacatccac
tatcacctttaatggtctatttaccatataaggacttccactttaaagtt
ctatagctatttaatgcctttagtgatagaacacaacttttgcactttac
gcgatttagtcctttttgcttaattaactatcgaaacgataaaattttcc
aacaaaacttgactactaccttaattaaactctgaaaatatttataaaaa
tatttttgactcggtttatagaaacgagatcccgatacttgaccttagag
ccataccactttaacttaataaactgcttataaaacaaaaatcacaatat
caaaaacttttttaaaatcacaattaactcgtaaatattaaatgtaatat
ttacaaacttactcgtcggatctggtggccccgaaaccactgtttccgac
accactaaaaaactggttattacaaaaatagtcctatttaattattaagc
ttaataatccatcatcaaacttcaaaaatatcacaagattcatccatgta
ataattcaaaatatttaacacttttacaaattagtgttagggttagctag
attaagctataacaatctcaaaaacataaatatcactaaaaatgggtaaa
gaaaacatttacatgcaatcaaaataggcttcgtcgaaccttgtgttctc
catcaatggtgtttcgtgaaagaaggtaaaagcaaaagaaaaataaaatg
gttgtcttttgtttttatgttttaatcatttttaaattattaaacaattt
tatattaacataatattacaccaaatttgtatggtaactggccattatat
tccaacatggtcaaattgtctcataaaaccctctaaacatgattttataa
ccattaagcacatataaactaatagcgattaagttttatgatttttatga
tttagtcatttttacttaattaactatccaaacgtcaaaatttttggacc
aaatttcaataaaattttataatcactccgtaaatatttaataataatat
ttacgggcttggtttatagaaacgagattctaaaacctcatttttcaaaa
ccacttggacttaactatttgtttaatttgcaaaaattattaaaccaaaa
atctaatataatattatcattgactcgtaaatattaaataataatattta
caaactcgcttgtcggatttgtgatcccgaatctgctattttcgacacca
ctggaaaatgagctgttacaatggcctgccatatacacatgtatggcgca
ctatcgtacgctaggtcgtgtctcaaaccgtgtgtgcctgaaatttcctt
tcaaattaagtcattcaacataacttcacttaagcaacaagcaaccattc
ataccatattcatgccaattcaaaagcaccaaaatcataccaaaatcatc
atttataacattcaacctaagtgcctaaccaatatgccacaatttacacc
tcaattcacaattcaaaaccaaccaaatatcatatataagtaccatttta
aataagccttcattggcatctcaactttcaactagctatgcttcaaaata
atcattcaaacaatctcatatttgcctaaatttaaccctatgatatacac
atcaaacctaccaaacatttcaatcataacataagcacgtcattcatcat
tcccatagctattatagcagccaaaataggtttccaagcatgttattttc
tcatccattacaccgttatgaatatagtaataactaccttatcaagataa
aatcaacatgaccattctcaatacaaatatatacatttataaacatgaac
cttaaataccaacaagagttcaaaaccaaaaattataaccacaagatatc
ctaggtacatgctaagaccaaaatgaacacatctccaacacttgagtttg
ggaatgtcgctagatactggtttgatgatcgaatctttagatacctaacc
tacgcatggaaaataaaaccatacgctgagtataactcagtggtatttct
ataatcgaacattaaaatatactataaagtttatagtgcattttaacatg
tcaatctacaagtcctaatacatcacctaaatattaaatctatttacata
tcttaaatcaagttgtcatagttgaaatatatacattttccctatctcaa
tcgaattgattaaatcgtacaatatcaaatccataatttcgagcttataa
actgaaacccactatccacccttatttcaatttcaattatacttgatttc
tcaattccacaacataatttcatcaaccaatcatcaaatcacatatgtga
cagcataattcagcaccaactgaattcaattgtacaattataacgataaa
tcatattttcaaatctattcaatttagtcattatcacagccaactaattc
aactcgattcaattaagctcattcaatcattttcaacttagcttatatta
ttactatgcaatgcaattcgaaatttcaacaattgaaaaggtttgggtta
tagaagtacaaactgtaactgcgagctatttgtcgatgactttatctttt
cctttctattttgagaaatccgagtcaacgttagatatagattaacataa
atacaccaaatcatcaatgcacaattattttcacattcaattgctaattt
atgtgaatttagcattttattcaatttagaatttttaatgttttaatatt
taaaaataattttatattttttttgaatttttaaaatttaaaaaattaat
taaatgctgacgtattttttacgtaacaatccatatatatgcaacatcaa
taaagttaaacaatgttaactttctatttattttggggtgatttgataaa
aatgcaagtttaaaaataaaataaaagcgaaaaattaaatgaatgactaa
aatgtctttttcgtaaatttagagaaccaaataaattattatgccaaaat
aaaaagataaaaatattagttaatgtacaattcatttttttaaaatttta
tttcaaaaatatttaacctacatctacatcaaatacaatgacataggcag
aataattgggccaacttggccatcttcaatccattatttactgacatcaa
gtcagtgtagactgaatttatttattcatggccgagcccacgcgactgac
gttctcctttttatagcaattttccgacatcggatactgagccgcaaagg
ccattcacgggagttaaataaaactaaaaaataccagccccccccccccc
actttcgcagtagaaagagtgagaactgcaattctcgtaacaatgtccaa
acttggcagcatgcaagctaaccactaccatttcaagccactttacttca
ttgctttcagtttcctttgatattagaaattgcaacaatattgaaactca
aatgcaaacgatcatattgatattagaaatttgttgttacagaggatgtc
ttgttttactaataggaaatttcaatgtgggtattccttagtgcctaaca
tgtgcttgaatttccctgatatttgttggaaatgctaactttttatgttg
tttcatgcctgttatgtttagaatgtttgaatgggtgggataagatagtt
tactttgattgtttcctgaacaattttccattttactcaacgtgtggcaa
caaaatttcatacattattttcattggtcttcaacaaggtagatgccatg
attctgttggttctggtgaatgtgtcaaatctaaaatccttcttatttcg
ctgatatatgaaccgtccaatctcgcagacgttcgttgcacctttctgct
gcatcaactccattgcttagtgggatcaaggtagtttcttacagcaggct
ttaccttcattactaaggtatcgtaaatgtaattctgtgcctcaagcatc
aaaggatcttcaatacagttttcactatcttccatgattgacaagcccag
acggtggtggagggctttagcatgccttgctaaggaaagaatgacctgac
ttttttagatttcatgtgttgatgggcgtgttactggggattcccttgca
ggtatgccacttggactctatcggggtaagttcagaatgcaattttggga
gacctaagccatttgcttatctctttactgttttggatgtgcacttgctg
gtatgtacgctgacattctacttgtttatgaaattctgatgctgcatata
tccatattcagtataattaaaggaaaactgagagctcaaacttttctata
tttccatcatgtgttgtttcttttccatgggaaactttccaagcagatat
gaatgttttaggttgaatattgccttgggtcggcttttgtaatatatagg
aatcttttaagttttatctggtgttggatatccatccaagcaccttgtcc
ctactttccgtctccttacccctccaagtgggccttcattcccctccctt
tctttagttaatgatgattatgtgaacactgttttaagttttggataaca
ttagtgctatcctgattacccccttccaataattgtgatcctttctgata
aatattactataattcatggtaatgtttttttgatatgttaatcttaatg
ttggaacctgttattttgtctatttgctttcaatctaatggttcctacat
gtaatcatagctctctgcatatatcctggagaagcaaatcatggctgttt
ttcatttttgtattatttttcattgccaacttggctttcggaagtcaaat
ccctctttttttatatggccccccaatcaaaaaaaattatagacctccaa
cttacatggtaaataagatgatgttatgcttgttttttactcggatcttt
atatgataaaagcgaaaaattcgattttatttaggaatcaatggcagggt
atattcttttgtttttggtttggcaatcagtaggattgccattaacaacc
taggaagttcaatgttggcaaaatactgctatcaaaaggaagctctagat
atcaacagattatagctaaattgacatctttttctgcttgaatctcaagt
gaaatgagcatggaagattttgtggcttactttttaccttttctcttaag
ttccattgcatagatacaagtcatcataacttgaatccttctctgaagca
gcaacagggaaaagatcaagttcctgtcccgaacagcttctaaccaaacc
agagttcctgaaatgcttttcctagtgaatctaaaatatttcccttcttt
aattgcaatccccgtgactattgaactccgggtttagatcagttagctca
ttaagaggtgaaattcaactagtagtattggggttcgaattccacccctt
aaacctgtgtttgtgtttttaaatgattccatgaagcctgccatacaact
tgcaaccggatcatttgatatgatgaaactgtgacctagctaaactttgg
atgaaattaacactatgttgctgcattgcactcaattatttggatttgtt
tacgatatgtaggtgggaatgtcattttagtcctacatcttttggctgtt
cctttcatattacttgccctaccatcaaaagcaaaaggaaaaggaaaaca
aaatagaaagggcttaaaatatatgaactgactgcccatttattgttgat
tgaatgtctataatcaaagcaaacaggaaaagtaactgctgaggaattaa
ataaactagcaacagcaaaagctagcaggttaaaatcatgacggactatg
ccttttggaaaaggaataatgataattgggcttataaatctgaggtcaca
tcctcgaaaataaatttaaaaagaaaaatcaattctagaaagatgaacgg
aattagataattctggaagtaatcatgctttgctggcctgtcttcctctt
ctaatttggaatgtgtgttttcccaccacaaaaggtaaaacatatcaaag
tcaccattgcttatgtcttgcaaatatcaacccaagtattaataaatgtg
taaaaaattccactttttcaataaatcagagtaattcaattcgtatcaat
tttaaaagtaaatatctaaagataatcattcgcgttattaatattttctt
atcaagtgctataataataaattaatctttcaaagtttacctattccgtc
ctttatgtatatatttgaaactaaggttttttacatattctttttgaatt
tttttagattttttattaagatcaaattgacaaaatatataaatattaac
agaaaaaatatcaattattatgaataattatttttagttgttcactttca
aaattaacggtgattaaattgtttcaattaatgtacttttgcatgtaaac
aaatgaaaacgactccatctcttcaaatggaacccattttattaatgctc
ttgcttttaattctagcacacaacaaagccaccaaagagaagctaattgg
acttaaatcagaaatttttagcttggatcaacttaaaggaattatgtgtt
ccctttttcattccttaactcacccacttccatggctgtcttttggtggc
tccaatttagttggtataatgtccactagcatttcatattgcaacataaa
aataaaaagcaacaatatatcctatttataggtcgacattcaatcaataa
acgcaagtatatttaattccctttggctacttaattagtttaacccaaac
ccatgtatgtatattcacttcagttcttgttttccttcccttatacgttt
ttttttaatgccaattaactctccttatataacgttgttgattagattat
aatagaaaaattgttgacgtgggtgagagacaacatttgcatataaaaat
agaaattcaagctatcaacatattatacgtgaaaactaagtttttttatt
tatgaaagatgggtttcaaaagatataaaaagtatgattaactaagttag
gttagatgcatgattgttatacataataaaagcatcaattgaaacacgca
tgtgatttaagttgtataaaaaaattgatggtggaagcagattaaccggt
tcagtcggcccttcaagtaatattttggtatagtggaaaaataaatgaga
gggacaagaaaagagaaatattatcacttgcatagaattataacatttgg
aaggaaggaaaagagtcctaacaggtgaaggaaattcttatataaaaacg
taggagaccatactacatacatccagaaaacccgtcaaacatcaaaccct
attttatatctcaaatccccatttacaagaagaaaattgaaaataaaaaa
ttgcatcccctgccaagcagctttcacttgctacttgccaattctctcac
aatcatcatcccttacatcatcttcctagacctatagctgccaataacac
taatatttcattaaattaattaaccataacaataatattaataccctcgt
tttatcagtaaatgagggatgatgatggtgaggattattatggatcagta
gtactggaacatgtctggagaggccatgatgggttggttaaggtaaggta
gattgaaagggttggtgaaaccgtggtcacaagtacttgtttcaaagcac
tgatcagtttcgtacaccaactcactggcgctcatggtgttgagataact
gaggatttgattcagatagtcgagtctttgactcagttccatcatctgag
ccctcagaactgagttctcagcctgaatgttgagatagtggtgggtggtg
aagttgatgctgttcaggatttggttgttatctttgctgagctgagccac
ttgggccactaattcatccaagtgctgctgtttcctcatcctggatcttc
ttgccgattccctgtttgattcctttctctttctttttctttggtccatc
atgttctgctggtgcaggtcctcttcagacccagagttctgaagctgcga
ggagcttgaggaattggagtttccactggacgaggccatgttaatatttt
tacaccaaactcactgctaaaacttcaaatataaattactaatatttcag
gataatctaacctcaaaggcgactggacacctatactagcaacagataat
tatatatatatatatagtaaaaaaaataagcatgtcatttatgaaaaaac
atagaaccagtagaggaagacaactgagaaagattgaacgagatgggtcc
tgcgtctgagggaggaatttatcataaaaccggatcggaggatttcactg
acaactggagacatgagtctcaagcatcaaccacaacaatttacgcagca
tcaagatttacagcaaaaaaaaaaaccaagatatgtctttctcttcttgc
tggaagataagagttttgacttaatggatttttggtatagattctagaac
ctagactggagttcaacaaccaaaaatccccgatataaaagcaaacaccc
tcaaaagggatgtgattagaacagaggaagctgaggaaaactggggaaaa
caagaactaaaagaagcagcagaacctcagctcaaagagaaaagagagaa
gagagcggaagtggaagaggttgtttagaatattgatacggtaatttata
gaaggaaattattgaaaatgaggaaattaaaaaataaattaaaaaaagag
cattggagaaccttcttgtttgggagttgttggaggaagatgagacgaaa
tttaccccaccctccgacttaggctgcatcacccaacacatgctaatttt
tttattctcctttttgcctctattttatttcgcttgtaattgtaatataa
gctcgttcttaactaaaatatatcaagaccattattatatcttagttgtt
ctaatagtaattaaaatattttaaaaataatttgagtccttgtttaaaat
aagattatttttaatgagcaaaatctaaatacgaatgtagtggttacgat
gaatttgtcatgagtaagattggctatgtgattatgttatgatttgtgtg
attcatcactcccaaggtgggagcttccacagtcgaggtgattaaagctt
aatacagatggtaaagttgatgtaggatctggattcaccactgctggggg
tttagtgaggaatcacaagagagattagatgcttgggtgttatcgaaatt
tgggaattaactaggtgttagaagctgaactttatgagattgtagatgga
ctccaattggcatgaaagtaaaaggtgtgtcatttggttattgagaatga
taaacggcggtggatttaatacctgagaataagagaggggggaaactctt
ggctggagttagaaatctataattgggtggcaaagacttcaatttgtgcc
aagaccaacaaatgtgacagttgacgctataactaaggagattaggaggc
gtacaatgagggttcttttctttgctcatcgcattagtgcaagattttta
tttttttctgttgaaccttgcaatactttttataacaaaaaaaaatcttt
atattagtattttttttatcaaacttttatcactagtatcatatttttgt
tgttgttgttttgatagattttattattgacatttatatttaattaatat
attctaatttgattaattttaacgctaataatttttaattttgttttcta
ttaataaaaaaaacatggcacctgattcgtaaattcaggatttagtgctt
aaaaaaaacaatcatcacagcctattggaatacaatctgaccaaatcttt
tggcatccaaaactaaaagaagctccatgcgcataaaatgagctcccaat
aatggtgttaaagcctaggctgtaacacaaaggaaccatcaaagttttga
ctttatttggtacaggttttactttgaagtgaaaacatatagaaacaaat
aataacatcccagaaagcttaattaaaaatgaacttccattttacgcctt
atatgggtatggtattaactaacaacagattggaccacaaacccaaatta
gagcatatggccccagccttaattgcatgccagtagtgggtagggcaatg
atactaaaaacagttttttttctgatatgttttctaacaggaaatatcac
aagcaaaagcaattaatatatatcaccccattccaatagtggtaatagtt
aaaaaacttgttaattgtttcttagaccctgttatagtgttattgtgcaa
ttcctggttctattctttgctaatgtgacaagatttgttttttttattag
tcatgttgatgtgatagctatgggctatgggatttgtttaatctgcctaa
aacctactcttccatctgcccaaccttcacatggatacaagagatccaca
gaaaatatatgcaaaaggaacgtggtgaaccatttgctgagaattaatgc
tacttatttatatttattcgaagaatttgtattaaataatattattttaa
ttataaaaaacttaaaaaaatacacatattaaatacatataaatatcaaa
cacttaattcccgtggtccggataatataactgctggcctggccaacaga
aactcagatcagggagacagggaccattgtctttgcatgaatacttgtgt
cggaagcgcaatgatgcagccataaacttctacttttatacatgtttaaa
catgaaatcaaggtttctgactttttatctagacagaaaaaagaatgaag
atgaacccccccccccaaaaaaaaactatgaactatcaaaatgttataaa
tacattttaattgatgaagcagttggacccaaaaaaaaacccaccatggg
tgaagcacatatacttgagaatattccatcagttaaaactctaaaatttg
cctaattgatgtcatcaggtttttcctttctgttactatagttgagccca
tgtcagactgataatgaccacttccaatcccatgtttttctttacttacc
cccccccccaaaaaaaacaccaaaatttattttatttttaccaaatgctt
acacacaatggaagactaaaaggggaacacgaaagttctttgatgcttac
cctgttttggtttatagccatgataatgcaatacacactaatccaaccaa
accaaacccaacaccatgttcctgtatgtaacagctgcacccctttatgt
ttcggtctgcagtttacaatgaggggggtgtaattaccaaaaattaataa
attaaccacagttggaattcatttttaggataatctgttaagatccacat
gatcttttaatactaatattggtttgcggacaaaaccatgaaacatgttg
atagctgaaacagctgatggaatcaccatgctaaaggcgaccaaaaacag
ttaaactactgatcttgggtgaggccccttggaagacagtggtggagtac
gtatagtatctctaacaggtgggtggggcacaaaataacagtaaatataa
caaaattttatgtactctatcatggatgggctgatggttggtggcagtag
gaagtgagtcgtagacctgtccatgggccgggcggcccagcccggtccgg
tccggtccgatggcacgcccgaaatatgggaaggttcgggtaaaaatata
ggctcgaaatatgggcttgggcaaaaaaacgaggcccgtttaaaaaatgg
gcggggcctcgggtaccacttttttggcccggcccggcccgaatataata
aatatttatttttaattttattttttatttttaaaataatttttttttat
ttttaaaataattttttaatgtttattttaaaaatggaccgagccgggat
cgggcttatgatatttttcccgggtcgggccgggcctgggcaaaatttca
ggcccatattttgggtcgggctaaaaaattttctgggcccggcccgaccc
atggacaggtctagtgagtcgggctgaactaagaatttaagtaaaaatat
agtttcaaatgtacatatagaccggctggatccaaaaacgatgatatatc
tctaaaaggttgaatattgttacattcttttctaattacaaaactattgt
ttggttacgtgaaaattagatgtaggaactcatatgtaatttaggagtat
aggttaccactcatttagttaattaagctggtaaactctctagttattat
atattaataaatattagccaaattggagctttgcctccatcattcattag
tatagtcgttaaggatatggggactcgttccttatcaattaagattcgat
atcgtaaaaagtattttaagaaaaagatagatttatatttagattaggtt
aggttaatagatcagataataaaagattaagtgaagtgaaattattttga
tgatatctgattgattaatgatgtatagaaattgtatattattagatcgg
tccatggaaaactaaaacttaacttatttggattcagttaaaatacagat
aacagattcaagattcaggaagtgttgtaaaaagaaggacattgaatact
ttttccaatttcttcctccaagaaaactttagattctgaatgtttagtaa
acttgtgattcctcttacaatttgtaaggtaaacgttgattttgtacgag
taaaagagacaaataaatttaattacttccatggccaatcagacatatta
ctactttcaattttctttattttaacaatcttcttcatcaattggcaaac
gatatcaggcagagacgagagagcagcagagggaaactcaattataagga
tataataatatatggtcggtttttgatgggtcaaaaccaagaggctagtc
tatttcagcttttccgaaagggtccccaaacatactcgatcaatttcgat
tttccatgcacatgattttctcatgttccacttttattttctcctttctt
tttttcctcggcttatagctttcaacatcaacaacttgcatggtttggtt
tcagagcttccttttcgcctattacctgacaatacacaattacagatacc
taaaacacatatacgatatattttgcgtttatagataagagaaattatcc
ggcagtggataatttctatttaacaaactatacccaaatccctgaaacag
gatttagaaagttgttcttcaaccttggctgcttaaccaacaaggaggtg
gtctctcagctttggtcaagtcacctctgggtcgctttgttggactagtg
tatagctaaaaaaccaggctaagtataaatccacatgctactttatacga
acaaagcgaaaaaagaaaagaaagcagccatctcatcaaacctaaaaatc
tagaccagccaccatcaaatttgatcatctttacggctccaaattacaaa
actccctcaaaaagaaaaagcagatgaccgctcacgctatatcgtgcatg
agagaaatagttaaacagtgaggtgaagctgtcatgtcacctattcttgg
tccagtttcgtaccaacttcatgtctgatacatatattttattcttttat
ccaactctggaatcttgaatgaatctgccttcaccgtgaaggcaagcctc
aaaatgatattacagcgtatatatatatatatgttaatgtcacaaaccaa
aatggagataattatttgagaatagttctaattttgcacttgccccaaaa
cgggagaagtaaacttggagtttaaacaattccgtgcttctaaaagcatg
ctttcttagagaaataatcatgattatctacatgaaaagcatattcgaag
aacctggtcatagtgggaatggaacccaaaaatcaactcccttttgttta
cttgtaatttaaaatgtcattaaaaaatacatatttttctgtaaggagaa
tcacattcaaagtgtgcttcattgatgttatgctttaatcaatatatata
tatataacagttgaaaattcacatttgagataaaaaaaataaaggaactg
aattcatacattacttgctacagtcaagctggcaattgagaacccaaaaa
gacatatcaatgtagtgtaactgctattttctttaatcataaaaacaact
agggcatgtgaacattacttaaaagaaaaaaagggttaggagaagctgac
acagaatccatcaactttaacctttgcacagttcaatcttatcatatcta
cctctcattcattttgaccaataacttcctatctctcccccaagaagata
ttgggttcatatggttcaccagaggctactatcctttttccttcaatgga
aaaaagcatctgccatttgagttgcttctggtagcaccactactaaacaa
tatgcaaacaaattgccaaacgaatatcatcatatcaatcaattagatgc
ttttttaatggtttgatattttacttaattcagctcttccaagtggcaaa
caaaagcacacgggaactacttctttcaagcaaaaaagaaatatatagct
gagggataatttctttttcttttccttccccttcgtttaaaataactcaa
aactcaatgaatttatgttagagtcaatcccctacatgttttttgggttt
ccaagcttaacataatctgccatgtttttacattaatttccaaagtaaga
gtgggattattacacgtgatctattctctttccgacacctatttcactgc
actttattttttatgacaaacttcataagatgtgccccccaccaacccat
aagaaaaaaaaaaaaaaagggtggccattgggttaaagaaaggagccaac
ttgtaagttggaaggtttgcccctgctgcaatgccgttaaagcagccaaa
gataagcaatagaaagctgaagcatccacttgaaaagccaaaccacgaca
ggaagcggggtgtgggaaagggaccagaaaatcaaatgtggacccctccg
actcctcctaagggtctttttttttttcaaatgtgcggcaaaaccaaata
ttctttttggatgagaatttgagttatatgtttttatgagttgtattaaa
ttatattttattaattttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnngatgatgtaatatgttatttacagggttaaca
tttaatttgacccctaaactatacctaaaatatcaatatgatgttttata
ttcttttacaaggaatccaaaaagttataaaaatataatatttggtcctt
ttataattcaaaaattttaattttcagattttataaaaaatagtatttta
aattgtttatataaatataaaagaatcaaattaacattttagctataatt
taggagccaaattaagtattaaccatatataaaatatgtcatatctccag
tcaagtggttaatggcatttaaaggatgattgatgaaaactttatgaata
gataaatttaatgattattttattaattttccatgattatcaaaataaaa
ttttaattcataattgagtggcagattataaaaaagaataaggttaaaaa
cgagtttactgtgttatatgtcataccaagagaagcggttagaagttagg
aacaaagcaaattatgtgtggaattatgaaattctaaacgttaaaataat
ttaaaaattcctcaaattgattagataaatcttattaccatcaaataggt
tattgagctttaatttttattagaatctaaagccagtaatcttttgtttg
agctttaatttttattagcatctaaagctagtaatgttttgtttgaaata
aaaacttaatttaaaataaattaaaaggcttaatatttttgctgttataa
agttgatggctagctctataaataggaacagtataagccgtgtttctcac
ccagaatttctcaaaaaaaaataataaaatccgttataaaatacctaaaa
ctacccaaacttcctctccaactcataaataggagttggaggcgtatttg
aacccacattttctgtattgacaacaatgcctatgccagtcaaactaata
ctcaatcaattcgatttttctttacttaattcactttacatctcgcaaat
aaattatttaccatccgtaatcttcaaaccttataactaacataattgcc
tgctaagtaatatttaatttttttgttaaataaaaaaatgagataacaag
atcaaattaaatgaattaaaaaagcaccaactttgtcttactcaagaaag
ctaatcaactctctacgtaccatcaatctcaacaaaaaatattttagcta
aacaacaacttgatttctctccctaaggacatgcttaattatccaatgtt
ccttattcggtaacatttacttaatttatcgaatcaatactgaatttgat
acctcaaatagtcatcttgaatagcattaaccgcctctaaacaatctgtt
tatatcccttcttgtaattactttcttttaaacctcctctttcaaatatt
attcttttttattatacaccatctaactgatatatttttgcaattgctgc
tgaaatggggcaactgcaaaatgaaattcaagagcgattgctaaactttc
ttttgagaagtgttagagcaatagatcttgcaaggaaagaagcgaacatt
ctcgctaccagagagcgcatagagggtttggaggagaggcagcaagggct
cattgttcatggagcactccatcgcccgggagactagaagaaactattac
acaatgttactgcacagtaagaaaccaacttcttcaacacttaaagattt
cagtattatactttcatttgcttatatgttaatctaatttcttaattttg
tttcaggcatgacagaaagcatcctcggattcatgatattgaagaaaaga
attaatcttcttactcgacagtgaaagcaattaacctcaataagtttcca
tgaacaatgaagtttcactggtttcatccttggaaaatctcgcactgtga
ccacggaaatgtacatagaaaacttgggatagctcatgtttcaaaatgat
agaataaaagagagtaaattccaaagcttatatttatggatacatatctt
ctgcagcagtccaagttgcaaaaattcttagacttggattcaaagtagag
tgtatagctttgaatttcttagccggggtctagtttagattaaattgaag
gctttctacggcattataatcaagtaaagactgattcactaaatacaaag
gaaaaaaggttaaaaagagaaatataagttaacattttcaatttttaatt
atactaagcaatgaatgaatatttatttaaaaattttttaatgaagtaca
caacgcaaataattatttattatttctctactttttaaaatttttatctt
ttcgattatcttctcgcgaagcctaaactagactttttgttttttaaact
tttgtttggtgaaagtagggaatagcgaatacagttggggtacttaatta
tgtacaattcatgaaaatggcatggaatgctggttaagattatacaaaaa
ccccctttaatttaactttagaaaattgacccaaatttctcactcttctt
aattaccatattatatgtgtcgaataatttaaaatttagaatcataaaat
ctaaaattcaaatctcgaattcattaacctgtgccctgtctaagaacaca
ttgcatcgtctatcttcttccaaaaaagtttcactagagagagatgttgt
tgatttaataagtttgtactttaattaccgaaaaataaaggtgtttagtt
cttctctgctgataacgttattaggaagagagaagaaatgaatcatacac
ttaatcctacacaaattactgccattcaaccaccgcttagttgatcatta
atgttgttttgatgatgacttatacggtcttatgaaaactgtttcttaag
tttccttttttcctttttataagtcaaaagatattaaacgattatcccct
aaaataaaaataaaaatacggaatattcggaccttgttaaatttccaaat
gatgttcaccttcaaccatatatataaattattaagctataaatcaaata
gagtttgggaagttctgtcgccaactaaaacccagaagatgccatgagct
agtcaatgttcactcggaaagtgctggtatcatttatggcgtttaaatgg
agagaaacggttggtgattgttctttcaatataaattagaacagatcaga
gattggtccaattcgttttgcatctctccttgaggggttgggttctttat
tgactcgggttttcaaaaagctttctttggcttcattattcagctttgtt
gggttattagctttgagatttgaacatgggggaggaatacgatattgtga
atttgattgcgttgggagtgatctcatggacgacagtttttctacttgtc
cgaaaaatcttctccgaccgctcctttgaactttgcaaccgcattgtttc
tacaatccatgggattttggctgtgattttagcctcgctctctgttgaag
attggagctgccctgtttgtcctttggcttcggcttctacgcctaagcag
gtatgtaccaagcaaaagcaacttcttcatgtcttttccttttgtttatt
tatagcagagcttaaacataatggtggaaggaattaatattgtgaatggc
tgacagaggcaagttttggctgttaccgtcgcttatcttatatatgacct
catatgctgcctctttgacgtcaaattcactcttgacaatacagttcatc
acttggtcagcatcgttggtcttgcagctggccttgcctttcaattggta
ttcacctttatgtttgttttttcccccttgtgcggattttctttgggcat
ggttttacaggactaatctgtgttagtccatgcatcctttgtacgtgatt
agatttagttatgatgcagtgtggatcagaacaagttgctgccttattca
taacggagatctcaagtcctttcctccacgccagggaactgcttaaagaa
ttcggttacagggacaccgatctcaatttagcagctgatgttagtttcca
atttctttttcttttgctttagatcagcatttgcatctaacgtgatgcct
gcagctatcatttaattatgttctgtgaggttttcaaattgtattaaaat
atatgtgtagtcatgtacgttattgtttacttgaacaggtcctatttgct
gtaatattctcagttgcaaggatggtgggtggaccttatctcactttcgt
tactctgacagctaataacccactacttatcaaggtattacttgcgacta
accctcttcttcctaactctattatataaatagataaattaatatcgtat
ccgtgttgttacttaggcaatggctgtaggacttcagttagtgagtgctt
tctggttctacaagattgtaaagatggtgaagtacaagcttactaaaaga
tggaagcaggtgggcatgcctggaaaattggactgaggctgtgttacata
ctagtgaactaggatgcataaaatgttcagtatcttaattcacttcaagt
atccacacagctgatagtttactaaggatgcataaaatattcagtatctt
aattcacttcaagtatccacacagctgatagtttactaagggttgaaaat
tgaaatatactgcgtaaacatgcaggattctatgtacgacttttaaaaaa
aaaagaatcaaatcataagaattatacggttgtactcgtatttttgatgg
ggctgtttttacttgtgaacaatatgcacattttgtttgattcattcatc
aatctctaccatcaaggaaagtaccagataaggaaaaactacataaatgc
ggattgaagttaaaaaaaactacatgcaccataagttggtggtggatagc
ataatcatagaataatcaatgcaacgacctaactttatgtacgaaaagaa
cccaacatttcaggctgaaacccgcaactgtcaataataaagagactggt
ggtggtggttgaaaattttgacattgaaatataaattcatttaaccagcc
caaactaaatcactccagaatgaaaaataaagtcaatttcctgaaacatg
cagaaggggtccatgattcaagtatgactagagggctgtaattatggcaa
cattataatgcactgtccaacagaaaacttctagtctttcccaaaatcag
cactgtaatgtgcacttgattccagtttcttagcttcgttcaattttctt
actgcctgcaatttataaccaaatagaagaaagcccatcattagtatacc
gggaattggaaaattctccattccacagagttctagactagtgcacataa
gccaccaatttttcgtaacgcattctttcaagtttcatggttatatatac
cttcatgaaatcttcatggatgacataatcacgctctgcacggattgctg
acattccagcctccgtgcaaacatttcgtagatcagcaccattaaagccc
taaagtaataaggacaaaaaacaatcttagcgatgagtattacagccatg
aaacagaaacaagccacacctttgactaacctcagcaagtttaacaacag
cctcataatcgatttcaccatgcttggcaatgccagcagcatgaatcttg
aggatctccattctggattgctcatttggcaatggaatctctatctttcg
gtctagccgcccgggacgaagaagtgcaggatctaaaacatcaggtctgt
ttgtggccatgatcattttaacctacacgaaacaatttaagttcaataat
gattttgggaacataaaaacaaaccaatgtaccgggcagcaattaggggt
gcattgagagaaatttcagctccaaacaataaatgcaataaaataaaaat
atatataattaaatccaccaggcatgcacttgaagatgttaatgagtaga
cctgtttttcaaggaccataaaggagaagttatgatcctgcagtactaga
gtggaatatgcaccctactagataaaacagtgattaaaggcacttggaag
tttacagagacaagataccagaaccacccccccccctctttagccacttt
gtgaggaaagcatataaaatataagattacaaactatggcatatagaata
tctgttcaaatcacaacttgtaccatgctcatgaccaaattatgtacctt
cccaagctgatcaaatccgtcaagctgattaagtaactccatcaacgttc
tctgtatttcacgatcagcactcgttccctcactgaaacggcgtccacca
atggcatcaatctcatccataaagatgatgcaaggctgaacacaaagaag
caaatatatgaatggcattaatggatacaaagaagcacaaaagcaaacat
tcataactccaggttctcacttggtgatcccttgcatatccaaacatttc
tcgtatcaatcttgcactttctccaatatatttgtcaattattgcacttg
aaacaacctggtttcagatgagaaaaagttagatgcattcattcaaggac
aggatgagaaaaccacaaaggtaagacatagattcaaaaatactgacctt
taagaagttagcatcaatattacttgctattgctctagctagcaatgtct
tgcctgtaccaggaggtccatagaggagcacaccctgcaaggaagacaag
aaatttcaggattgtcaaccatacatcactccactgtagcatgcttcacc
catcaacatatacaaaagcacacccattgaaattcagaattgacagagag
aggaagactggaagtaataatcaccttgggaggtttgatcccaactctaa
ggaaaagctcaggattcatgagagggagctcgatagattcccttagctct
cgaatttgatcagataaaccaccgacagctgagtagctaacattaccagg
atcttcatgcagcatgttgtaaacaactggatcaacctgccatcaaaaga
tgtactgggatttgaaatatctgcagagaaaacttgcttttatatcataa
ataaagctgaactagttaggatggtaatacctcacgtggaagagcccgca
ttattgtcagtgttgtcatgtcaagaactactctagttcctgaagttagt
ttctccttatcaactttgctgcggcatccaaccacatagcgagggccact
gcttgctttaacaatcactgaaatgtcatatagacatccaaatttatagt
tacaatatattctaaaacaaaatgaaccaacaagaagccaaaacttcaaa
tgcaactacgcagatgtcagactaagcaattttaaaataagaacaccaaa
acgaactttatattaaaaggagggaggggatagatagtagttacagcgtt
cattatcaagaggcctgagaacttctccaatgatctgtccaacactctga
agagactttaaatcatcttctgttttgttaaagtccttcttagcagctct
taaattctccctaccttaacattcaagagtgaaatagcaagtcaaaaact
atgttaggtatgcactatattaagaagaaagataaagatttggtcttcaa
acaactaatacaacaagctgtagccaaagctacaaacatccttttctttt
gtttcttcttaactactttattttaccagaaagccaaaatttcaacttca
tcaacaacataaacaagatccaatcatcaacccaagtcgaagacattgaa
aaacataatttcagttgaaaacaaagcagttatctatcgcagcaaccaag
gcttaagactttctcgccaaattttacctacccaagctgcctctacaatt
aacaggaaaaaaggatctaacttccaaagcagcaatatttgtaaaacaac
gaagcagctgatatgaccgagagcggaagcaaaaccctaattcctaaatc
gtaaatgggcaaaccgcaaaaaaaaacaataatttaaatgcaaaacgagg
aaaagagaaaagtgaccccaattaggggtaagagggtgaggattatggga
agaggtggggaatacctgctcgaattctcgattcatactctttgtgttga
aggagtttcttccggtactccgcaatagcattatggcgtcgtacagcgtc
ttctccgtcgctcattgtcacaatctatgatcgaaatggtctgactttga
agaaagcttggtgtctgggctttcccaaggttccttgggtaagaggttgc
gcgagattggggctatttgtattttgtaaactctgccaggtatgtatata
tatatacatgtattctaaagcggcctgggctaaaatttcccttttagatt
ttataaggttaaaatatgccctaggtccctgaactctttacaaatttaga
atttagttcctatacttttattttcaggatttagtccatctactttttaa
attttacaatttaaatccaattattaagaatgtttttttattattaaatt
gattggtatgacattttgaaataaataaaaaattcttatttgatagcaat
gtaactaaaaaatgatgttgcaataaacctaaatttaacaaaataatttt
aatagtttcaataatttgacctaaactttaaattttgaaaagtagagaaa
gattaaattctcaaaaagaataaagagactaaatcccaaatttacaaaga
atacaaggacatatggtacaattcagcgtattaaaaataagtacatttaa
atttatttctgttgggcgacaagtattttataattttaaattgaatttat
agtaaatagatttgacctatttgctatttgctatttgctatttattaaaa
caaagttatacaaagaagtaaaaagagaaaacttgttgcaaaaaagaaga
ggaaactacacttaattcattttattcataagtagagaaaaggcttaggc
gacaagggatgatgcatttaaacaaaatctaaaaatctccaatctttaaa
cttaaatcctcaattaaaccatttcaaggggaaagatatcaaccattaca
ttgggaatcttgaatccaaccaatttaagaatcacaatttttctgtctct
agatttacgtataaaagaataaatttaaacgtaaaaaagaatgaaaaatg
ggtatcataacatgattatctacagttttccccccacttgctacataata
tacaaatagattttaccctcaagtttattattcatcagatgcttgacaaa
aacagcagagagcaacttcggtaccggatgatgaaggcactgaacagtgc
agcaaagttttcaagactcagagtggcgctttgccttgtgcagcagtatt
tccttcagaaccttggcaattctttcagacatgtgatgctctaaaaatct
ctctttcaccctttcatatcctctcttccccatagtcagcctcttctcta
catttgtagctagtttcacgatattatttgagaggggcatcacgccttct
ttgccagcaggatgcaacaagcttgttgtcccgtttaccactatctccat
ggtgccaccggcagctgtgccctgaataataaatgtaatcaacaatagca
cccaaaaaagaaaaaagtggttacattgctttgttaaaatgaaaagagag
agaattggtagattgcaaagaagaatttctattagatattacagggcata
ccaggacaggaagctgaaaggccatagcttctattgttatccttccgaaa
cactctccccgggcctaaatgtgacaacaacttgtaagctttgccaggaa
agcaaaagcaaatcatacttgatagatatgtcatgaaatggaacacgaat
gaagctatagtatatactatgagtttatggtgctgcaattagtactgctt
acaacacaaataaacaacatagttattcagagaatacctgagaattttga
acaagaacatcgatagaagccagatagggagctacagttagggttttatt
aacaaagtgaactcgaccctgcatattattctgtgatacaaagttacgca
gctctgtttcaaactttgtctgagcattcatgtcacttcccactatcacc
gcatgaattggtggcacctttagttttctctcctggatcaacttcaaact
ttcatgaaatgaacggagaaataggtcctgacccttccctcgggaaacac
ctgaaacagtacagggattggtgctcaaaagatgataaatcagtacagta
ggctcgaaccatataacatatttcaacattctgcaataatttagtcgttc
agagttgtgaaagaacacaaggtgtttgcaagaacacaaacaaaaaacaa
aaggagatatgctaccaaggaaaatggaggaagaaattggcaattgatca
aagctctaaaatataaccataatccgatgaagaataattttattcatgca
acaatgcctgtggggaacctcattgagaataaaaaatttcccaggcctac
aatgcaaactgaatcatggaataattaagaggctgttgactcaaggaacc
aaagctgctagcaggagtataggatactaaaatcatccatgcaatcaatt
ctcagaaaggcaacaataactatgaaccacaaaatcaaactaggatttca
accactaaggatccactgtaagcatgtgttttatttataatacatccaaa
gcatacatactatttataagagcaaagactagatcttcatttttcacgcc
aagagattcacgaacatgctcacagagaacccttttggcaactctatttt
cagccacttccattagctccttgctgtttcctaagtgcacaacgtatgtt
tcaggcattttgatcctgtaaaataaactgtaaaattaagacaaacaacc
aaaaacagcaaaaaaaaaagaaaaggggtgaaacatatatttaaatcata
gagtcaataggtgtatctgaatcctataatccacatatgacaataacatc
caccagcattgtaaccgtactccaaagcctcttaaatcttcatatatatt
agcattagcagacaataaaatcctaaaacttatagcagatggtacaaaaa
ccattaccctaatcgttcccgagtccggtttttccagtaatttgctgtgg
tgtgtgaatcaatcatggcacctccaactaaagggaggtgcttaacatat
tctagcttgaagtaatgtcctcgcatttcatgaatccaccagagaacctt
tggaagaacatcagcaacatgttctttaagaacagcatccagccactttc
cagcaaccgcagtgttcaaaactaccaaatcagcctttagagcagtatct
atagcttcttgacctttggcagagaaaaccttgataaaagttggaaaaaa
cccaatgtgttaaaatttcgaaacaacatttgcattgaagacagaagaaa
acaaagaaaccaagaaattaagaattacctgaacccctcgattcaacatc
ttatgttctaaactgtaaatgatgtcatcagattcggtttgtttctgatt
tgttacccagacaacgtcggcgccaacttctcttagcagaaatgccagtt
ccattaacaataaaggcccaccggaaagggagagttcgtgagagactaag
agaacgagttttgacttcatgaaatcgagaggatttggagtcggcgcttc
atcattgtggttaacttgatggtgggtaccccctttttcttcttcttgtc
cttctcggatgaaattgccgacattgttaatagaaccgttactgcaagaa
tcgaaggtggatctgatgaggaaggccatgagtgttgatagagaaaggag
taatagaatcataagtggccatctctttttctgctgggttgtaatccatg
cgctcggttgcttacccattctttcaaatattgcttagcttcgctaattt
actactgctttgctttcgatctataaatgaatatcagcagtgaattaccc
gaactatttgagaattcacgtttcgattcgacgatcaacgatttgcttgt
ttgctttactggttgaagaagcaattcgaccaaaagcaagagcccagctc
agtctcgttgtcgctggacgtgaaattttgcgggctttcatttgggattt
taccctttgtaatatccatctttattgggctattagatcactatccgact
actagcgtgctggatgctttcaacccaaatcttgatccatataataaact
aacacctcttaaccctaatgcaattttagaggcctaaacctagacaatta
ttcttatattaggtttaaatttttttatttaaatcagtccctaattattt
tcatattgagacttgagtttttctttgtcaaattaaatttttaatttttt
ttcaaaagaaagataaaaaagttcagtcatggttaagaaacaattactaa
gtttaggagttaacttgaaaaaaaaatttaaggtccaatgtaagaacaat
tgtttacttcaagtcctaatgtgaaaataattatcaagttttgattggat
cagaaaattctaaccccatatgagatcagaccctaaaatgtatattaatt
caatgtatgaatgagcacttgttaaaattcctaaataagaataaaaaaaa
acttacaatatgtttaaatttacgtcctccagtattgataataatgacat
cgttattaagacccggtgaatataactctaattagtttatgataataata
aactttgattcattcattaaacaattaaaaaccttacatcctcaacaaca
cttttccccccttgtttctaaatgaaattaagggatgttactcaacaacg
cttaccattgcaaaacaacacaatttgctgtcagacatgactcaccagat
accataattcatatcctagttaactaagcgacaattcttccttacttccc
cattaaaaccagttagaggactaatgtttcccatcttaatcatggacttg
gcaaattgtttaaagaagagattctcatcctttgcgtaagctttaaccaa
ctccattgtatttccaacattccctgtcaaaagcacttcatccgaattga
gcagtccttttccccacaaaataagcttgaagtaaaggttgtcgaatttt
acaggggacccgaaatccaaaggtgaaatgttgttgtcaccgccagattt
gggacacacagatttcaagccatagtagtaggttctttctagtgtttggt
ctggcaggttgtttccgttttggttgtagagtctctgcttgaaggtcgca
cacctggctacaccaatggtatgtcctcctgaaacattagtacatgttca
aaatgagtaagccattataaggtcaaagacggtttttaattatgttatgg
tctgactgaaaacgtgggacaatgggttgacctgagagagcaacgaggtc
tacttcatcaagaccttgacgttggaaaagtgttatcaggttctgaagag
tggagtttggtggtgggatgttgttgtttgaagtgctgaggctcgctgtc
tttgaatcccttcttccaagtggaagctcccaagatggtccgccgctctg
ttatggcattaattgtggttagaaaaaaaaaatagtaatgctgaattggc
cttacgagtaccgtggagcttttttttgtcatgctttatgcttaccaaga
cagtggaaccacgagcagccattgcgagtatgtcagcaacaaagaaacta
ggtttggggacatgcttcttctagtctagctttgatctcatcaatcactt
caaagcctctaacggagttcctgtttggtagtgaattcttttcactaacg
atggtcgcactgttgtccaacaatatggatgcatcacagccctatcagac
gaaaaagagggtggaaactttatataattttacgagttacagtaacaaaa
tacgaaccaagttatttaagcaattgtttgcgtctgcattaaataaaaaa
gtaggaagaagcaagtaacctgcacgaaacaatcgtggaaatgaagcctt
agacaaagaggcagccatcctaggctcttttgctatggccttctctagaa
ctgacatgacgatgtcctcagcttgagggcatgaaaactgatagaactgt
gggaaaaggccatatgaaggtgcaccagattgaccacctggcgcaccaac
acctccccacgccaaaacccaaaccagggtgagccagagaaactgcggct
gacaggaaagctgttactaggaagacaaaagctaacttaaaatacgccat
tgatgattagaaataagtgttagcgataaacggtcattggttggcaatgg
aatttataatggttgtaacgattaaatcaactgctccactcggcaaatct
tcccggaaaaagcacctaatactgatagccaagactgcgtcaacttgtct
ccacgcttattttcgtgcggtgcttctggtttacctgctccttacgcttc
atagcttattatagtaaggattaatttagtcactccttcccaaaacccaa
atctcatctcaatgtaaatgaaaattgaacgctacatttagcattagcct
agaaagaaacaacccaaagatggatagtttacatgttggttttgactttg
tatcgtataaatttcttttatatataagagcaaataattacgtcaccata
ggtaaggggtttactaacaaagtaatccaatctcaattaactttaaattt
ttgtaagtttgtcattaaatcagcgatgtgattgatgtattgtataaatt
ttaatgcatttgaatatgcctgttatgttgagattattatttttggtttt
tgagattttttttaattatctatatttttttattaaagcacacatgtcta
gaataaagttagaatttttttaagggatattagattgaattataaatttt
ttgagggatcaatgtgtaattttattacgtgttaatttatattttcatca
tttttgaaagacaaaataaatttttattttttttattttggggagtgtaa
tttcactatgggttaacttactttaattatttctaaagagactaaagaaa
aaaaatttccattttggaggccctaggcccttgccaaccccttggcatca
tctttaacttctgtacatgtcaagtattcattagaccatatgacgtcatt
tattctaaatattaaattgaatattaaagtcaaactcatgccaaattgaa
aagaaaaaaacctcaagtaacaaaataaacattagtatattaatgctaag
agtaaattacaatcaatatcactaaactattagtaagtttacattttggt
cactcaacttcaaaagattacaaaatagacattgagttattcggaagttt
tcatttaagtcactcaactattcaaaagtttttcatttaagttactagac
tattaacatttttttttaaattcgtccaagcgacaatttgacaatcgtta
tagtggatcagtattcatcaacaagtacaaaagcataccttagatccaag
ttgatctaactgtttcattaagaaaaactgaactgaagaaggaaaagaag
aaaaagaaagaagaaaaaaagctttcaattaatgcaaacaatacgaacct
aggggtgagcattcgatcgaatcaaatacgtaaatttttcgagttaatca
agttttcgaatctctattttatcatcctaactttacttgaagttttctcg
aatcgagtgaaatgagatggaattcgaatcgaatcaaatcgaatatattt
gttcgagttaaaattttaaaaaataattttgggtccttgtaaccattgtc
acctatcgtaataaaatttatccaccttaatcaaaatttttattaacttt
caccacttcataatttatttattaatttttttatatactgattagcttct
ttgcttgcttagttgtttcaattatcttcagattcttgtcactatgtatt
ttagaattaaaaaatatattaaatgtaaaaatatgattttttaataaaag
ttattttaaaaataaaatgtgaaattgatacaaatataaaattttaacac
gaatattttatgacataattaataattcaattttaatataaatattcaat
atgactaaacaattcaataatataaataatataaaatgtgaaatttaatt
taataatataaatagtagatataaataaaattattactatttatgtttag
taaatttttttttggatattttgattttttatttgggagtaaatggtggg
aagtaaaagtttaggggaaaaataaaaagttttggggaataaaagtttga
gggaaagtaaataggggagtaaaattttggagggaaaatattaaaaaaaa
ttggagggggaagggtttggaatagatgggaggtgggatgggaagggaat
aaaagttttaggggaaaagtgggagggagtaaaaattttgggggaaaata
aaaggttttaagggttttggggagtaaaattttgagaaaaaataaatggg
agagtaaaattttggtaggaaatggattttgggtagattggggggttggg
gaggggaggggagtaaaagttttggagagaaagtgggaaggggtaaatgt
tttgagggaaaagtaaaaagatttgagagttttgggtaaaaatgtaaaat
attatagtttgatattcaaattattcgaattattcgagtattcgaattcg
aaaactcaactcaattcgaactcgaaattcgaaaaaaaattcgagtttat
tcgaataactcgattaactcgattcgtttaactcgaaattcgaatttttt
ttcgatttttttgagtcgaatcgagttttgctcacccctaatacgaacaa
caaagatcatacaagatcgattttaatagcccagtaacttaaatgaaaac
ttctgaatattgaataaaactttttaaaattgaatgaccaaaatataaac
ttaataataatttaaaaacctttagtgtaatttaccccaatactaattat
ttctttccgcgttatctgcaaaagtggttgaaagacattagtaactacat
ataaggaacaaggaatttcaaagaggaaagatgacgacagggttgaccct
ttcacaaattcgagtggttaacctgctaccgagctactttagctttcaga
ttcatctacttcatggtagcaaatcaaagttagatgttggcttttccttc
gactagcagtttcacgtctcattgcaaaacaaagtacgatgtcagtatga
agtatgaacccctgttttattcaatatctgacgatttagtcatgctagtg
ccttggggtcttataatctagcacatcaaatttacacagaaaaccgacat
tcattgttgtcaagttcaacgtctattacatatttaatgacaacggagct
gggtattctatatacactggtattggggcaatgctgtactgggaaatgtg
ctgctgctgtcctcccaaatcaccctcttgctcttgaaaactcatcgaat
ttaatacaaactattgaaaggttacattcaagagagttgaaagttatgat
ttacacagttgcctcattggggtaagcagcctagcaaaacgaagagggac
aaatgccttgacaaatgtcccgtttcggtatattcctgtagaagggaaaa
gacatataagaaaacagcagcgatattaactctctttataatgagtggaa
aatagattagttcaatatttagctaatacttacagttttctccaccattc
caacctgatgtatggtactcagaagttcccctttgtcaatgggacaaagc
ttccaccggaacatggaatcctattaaaaaagaacattactcactagtaa
aacacagtccagatccagaatttcactgaatgaaccactttcatgtttta
aagatactgaaatctgaacatcaattaaatacctttagtttttcctgcac
agcattgcagaattccagcaagccctcaccagtcaaagcagatatacaaa
caatatcttcccttctctctgcttctaacttgatcttttctggatcagta
actttatcgacctgccataaatagtccatttcatgttgcaataacagaac
tttgggaaaatgcacagaatatgatacatacatgcatatatatatcacca
acattacagataagctccactcctatgacaattaggaatacaagactgtg
taacataagcaatttaatccctttctgatgcatggttcataaaccaggat
acagaatactttaacacatgttataatcactatgaatactttagtgtgtg
tctaaaagcaaaatcggcctgtaaaagtagattataaattctaaaaaaat
tagattagaaaggaagaataaatctatgcaaaaacaaatggtataagcat
gctgaggtaagatagactgcaggcaccatgtgcaattaagcaacaaaaaa
aacgcaaggtttcatgcagatgtattgagcagatataaagttataaaaat
cacaagtacaataagctgtgaggaaaagggtcaaattgttcattatgcat
gtttcaattcttagtatcttagagatagagaatatctccattaccttgtt
ccagaccattaattttggaatttctgacacatctagttctgctagaactt
tttccacagcatctatctgctgctctgctaggggatggctgaaattgaca
ggaaacctagttgaaattttgagaagagggagaaaaactaaaaatagtag
aaagcattatacctgatgtccaccacatgcactaaaagagaagactcaga
tatctcctctaatgtagctctgaatgcagcaacctacatgaagcaaccat
taggtggagctgacatgattatttgggcaccctctttgaactaattaggt
attaagattcaatagaaacatctttcaatttaactaattgcgcatgaagt
atttcaaaatcagaaggcaccctctttgacacataatatgaaggagcccc
tcctaacataaacatcaaacagtgagaagcattaccagggttgttggcaa
cttttggatgaaaccaacagtatcagtaagaagaaattcacttcctattt
ttctatctggaaagtacacaacagaaacaagtatcccttgttaccggcag
agatcatagataaagcagtaaaaactcttttcaacaccagaaacaataag
caacttttgttcacgaagacagtatctgtacaagtttataaaaccaacat
tcatagatctaaatcatgctatataacttcttcaattcttaattcttttc
tagcaaaatgaagtagctagaagcccctagatttgagaatcaaaatgcac
tcatagtgaacagaagtgattagaatagcacaacatagaaatgatatgtt
tctagatagaaaaaacttatagctacagctggacaactttgttttaattt
atatcttctctgaccactcaattgcataaagaacaggtttttgcttgaaa
gcaaggtgtaacaataggtttccaaacttatgactgacctgaacccttct
tgttgttggatcaagggtagcaaacagtcggtcctctgaaagaacattag
ctccagtcaattgatttaaaagtgtactcttgcccgcatttgtgtaccca
acctataatgctttcaaatgtattatatgtcggagacataaaagcaacac
aataaaactgtccttgtattattttttaaaaaaacaaggttaagtgctta
ccaaagatactacaggaacgggaacagaaaaccggcggttctatattgct
ttcgatgttttctgacagattcaagctcttttttaagaactccaatctag
caaaagacataagttaggtcatggaggccccaatagccataaatcctatt
ctatgtacaagttttgagttcctatagcagcatatatctatctataaaat
attgggaaacagaaattgttgctcacttgagtacgtaagatacgtttgtc
cacttcaatttgtttctcacccatacccttcaccttgcctccagcttgac
gctcaaggtgagtccacattttagtaagacgtggcaattggtattccatt
tgagccaatgcaacctagaaaaggccccatagcttgagtaacaaatgtat
aaattattcttcttttgtattatcttcattacataaaggttttaccaagg
agtgcttttattaaacaaacaatcttaaacttgcctgtaaagctgcttca
tgcgttgcagctcgctgattgaagatatccaggattagagcagtccgatc
acaaactctaacatccccaccgaatgccttctccaaattccgcaattgcc
tgaaatttaattatagagccagatgagatgcagtgttaaataatgaaggt
tgcatttcaatttcataaggtaaaaacaattgacatcacaaattacactt
tccccatcgaaaacactccaagctagattcttatataaaagttgaaacta
agaaaaatattacaaaccttaccccggtgagagctcatcatcaaatatta
cagtctcaacctcaaaagcacgaattgcgctcttaatttctgcgaccttt
cctgatcctatatatgtcctcgggttgggagaagctaaccttcaaggcca
aaaaatagtcagacaatttcagcttataatatgaaaatgcaattcgattt
aatagataaaaatcgtacttttgataagttgaaccaaccaccataagccc
agcggtgtcggccagctgagccagctccttcagcgactcctcgatggcaa
aagaatccgacgtctcgccttttcgctctacgccccccaaaataagcttt
ttcttcaaaaaccttacaaaaaaaattttaaaaattgcttagtagctaat
tccaaaaaatttcccccaaaaatttgaactgatagaaaaaaaaaaatttt
aacctccctcccatttcgtagcttgaatctatcctcaaagctttcatcat
cactaccatcaccgtcatctctcttctttctaactcttaccgatctcggt
gtatcctcttccaccggttcagcgacgacggnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttttcctctaattttcttt
gtgtaatcaactgttctttttggcgtgttcttcattttcatttgcttcgc
caagttttaacttcaattgtttcgctgaagtagcccaaatgtggatttct
cccattttcaagattcataactgaagaaaatgctgttaagagaaatgtag
ttcggtttagaatgcaccaagcactgaagttgcataatcaagaggtaact
ttatgtatcttcatattagtagggggtttttctgggtgctaagttgttgc
tgtgtcaacatgcaagggaagggtgtctctttgtagcactttctgaccca
tatattggccaatatggccattttgttgaaatatctgtgacatttcaaaa
atatttcagatatcagaatatagtgaatataatccgctggatttattctc
tggatccagagaagggatacaaaaagctattgaagctctgtatgccactc
ctcagaacaatttccgtgtatttctgaatggttctattgtatttgggggt
ttgggtggtggcacgaacagcactactgttcaggttggtgaggcctttga
agatatacttaagaatgtcattcaggcagataatggccagcgcacaacta
gttttctacagcttgttgctgagacaatttatatttctggtgctttagaa
caacttcttgaagttcagaagcttgatacttatgacattgagggggcgat
tcatgcttattacaacataatttctcaaccttgtatggtctgtagagaat
tgtgtaaagataaattatcatgccgctatacctctttgcactccattcca
ttggatcaaagcttgaagattgtaaaggactatctgatagctgcaactgc
gaaggactgtactctgatgattagttttagaccaaaggaagatggtagac
tcccttcttacaatactgtatatctaggatcaactaaccaagcttttgag
tacaaggtagattccaatgccattttcatttgactcatactctacatcat
tattgctatagtattgtattagtatcgtcatggcatatgaaattgatcca
tcaaaatatgtttttgatgcatgggttgattttgaagtcaaatttttgtg
attcttttgcatatataatttccattagggccatgataatttgctcagtc
cttataaataaacctataaaaatcattatatagctctttgtttaacaaga
aattcttttgggctgaaatcaaagtcatctatggcagcttttcttacttc
gttctcattttacatgcatatcttatctaaattgcaaatttctaggtgta
tttcattgatctggatctgaaacccttgaagaaaatggaggcttattacg
agttagataagaaaattgttagctgctattctcagatggtgaaaactgag
catgaaacagataaagctgttacaataaactccaatggaagtgtacgaga
tcaaagatacgcattagaagacagtttgtttactgaaggttgtactggta
agtgcaagtagttcttattatatgatccctgaactgttgttgtaaaagta
aaggttgcaaggagccaagatgattaactcgtcattaggctcaagttctt
cctttcaccactttttggggcttttggatttcccttggagaaaataatct
cttgtgtgtatcttttgcttaaagatttatttgagttgatatcctttttg
ttttccttctggtaattcctctactttcacagcagctgtgtatttatgga
tttataatcaaacttacccatgtctaaggtactacttggtggcaaaggat
ttaatccttttccaatttgttgtacaatccatgcaacatggaccgccata
aaatcagataaccatgtgcatcctctttccagagtatggttagttgataa
tctaccaaaaatgttactgctattcctatacttagtcgaataaataaatg
aatgctctcatgttttataaagctatgatatttctcagccccttgaagta
aaattccaagttgtcaataatcatctattcttgccatcgaacttcacatc
tttttcctttgcttagaacgaggtaatgcattttatatctttcagtgttt
atattggcatgtctcatcaggtttaagagggagagctttttaacattcct
tggtgaaaaaatatatccaaatgacggaacataaggtaagggtttgggct
aacagggaaagtgatgtgccaactactcactgccgttacatctcgattct
acatgccaaattatgaatcatacagctggatattgaagttactgcttttt
ttgtgtgtggctaacttgattgtaatttatggtgatgagaaagagtactc
attgcattaaagttgatgagatgagagcagaatttttgtttgaaagacca
actaatgaattttgttctctgatttgtttctaaacctgaccaatttgtgt
aatttttcctaatttaatgtgataagactcatagagcaacaactaaaatt
ctcaaaagaccttaatttgagctttccatcagcttcaatgttacacaaag
cattaaaaaaattgtaatagtttgtataattggaaaatgtaatgcgatat
gtattaaaaaaattacaagatttataaaaaattatataattaagaaatgt
gtgcaactatacaaaacattagaaatgttataatttgtgtgactacacag
aacattatggaagttgtgtaattgagtaatattttgtataactcgagggg
atgggagcattgaagggaggacgtctgggtcgtaggcagacaggcttggt
ctcacatcacatgtccacaatgggggagatagggacgcgtgggtaaccgt
agaaacacggctaaatttgcagtgaaaaactcaaggtgagtcataggtct
gacagtgttctgcaattacaagaaaatgttgttccatctggttattctga
tatctctcggataaaccatcccactgtctgtactctgtacaaatgattat
ttgctcagtcgactgggaacttttcatagcatgaaatcgtcaatgtcata
ctggttgtatgatttagttttagcaattgaaagaacatacatttgtgagc
cagggaaaccattcaaaacttgttaacatcatcatgagtgaaaactccca
agtatgaaggtttctgttttttcccttcatgtgcgtaaacattccacatt
taatgagcaaggtgccattggtaaacaatcaaacatcttctgactggcat
ttacttctcaccaactaatactgtcagttcatttacttcccaacaaaact
tcttttatccaaagccataagtaaaaaaacaaacatatttagaagacaaa
aaatttacatgtaatgaaatgaaagtttgagagagatgtagtaataattt
tatatataagagtaagactgcttggatccattgaaaaaaaaaagcttctt
cacattcctaagtcttatacaactttgtttattgtgtctgctttattcaa
aaacaccatgtcgaaggtttcattccattcccttgatacctattttgctt
cctatatttgcgctttttatatatgtaatttgatgtttgttctgtggaag
catttaattttgaactcatcaattcctgctctgccattctctccctgcag
cctgcactgacatcctacagtacttctatttgtcataggatattattgtt
ctgagcagggacaaagtaacatagaatctgactctttgttttggctgttg
cagaaaacaatcctgtcagtcgagctgctgtgtccaaagtgcaggcagaa
ggtaatgcatgtaatttcagagctagtggggataacgtccatcaccctcg
atccatcgaaaaatacggtaatggttaccggcgaagctgatccgtttaag
atcattaagaaagtcaggaagttccgtaaacacgcatcgatcgtaagtat
aggggccgcaaaagaggagaagaaggatgagaagaaggatgagaagaaag
atgagaagaaggatagccggaaagatgtagtgatatactctccaaagaca
tgccggagatgtgaagtttggtacgttgtgcatgatgatctttaccatca
ttgttccattctgtaaaattaagatccccccatgagttcccaatgtaagc
ttttgttgcatatctagaattctagtttcaaaatgacaagtgccagagga
acttcatatctttcaagtagctctggataagcatatttagcctttttcgg
tcccttgtatatcataaaccttatgatgtttcatggccaacttttagtat
gtctaaaaggtttatatttcttttatcaatcattttattttctgcaaaat
acacatttcccgaatatagagattcatcccattagttggaataatcccat
taatggttagaaatggctatgtttattacttttctttttaactctagctt
cacataaaaaatattaatattaaattatttaactttttccacacgttaca
tgaattaaagtataaatacgtgtgtatttaccatataatagtttagattt
aattgttaaaaaaaaaactctttcaaactttattaacgtagtttaaactt
ttagcaaattaaaatcagttgtccatgaaataggaacgcattatttacat
tttcatcgtgaaagcattttacatctaaattaataactaaactaacagaa
gcacttgtttagtatagtaatattttgaagctcaattaaaatggaacaat
aattaaatgaggtttgttgtaattaattttatttcaaacttgatgcatct
tgtatgagctcacaaatatttttaactataaattttaaaaaacaataaag
ccatagtagtaatatcacaagaaacattggcttctgattagaattagaag
cgatgtgacagttggattatttgtataaatcacaaaatgtatcctcattg
ccggtaatggagtggtcagttttcatacaaatggagatgtgtttaataaa
tattaatctatgaaagctgtctattttacttggatgatatcaacacgttt
gatccatttccttttagtaggaaaaagactttacaacattttaggtggct
attattattaatgctgcttccttgcttctacctaccgttcccgactatat
tcagcatgagaatgatcattttaattaccctttccctagttgagagtttt
atcattaccaggcttcaataacagatcattgggctgccttgcttttagct
ttttcatccttatgggcttttattgagatattggattacctcttcggcct
tgaaaggtggcaaagcacctacctaaaaccccccaaaaaaaagaaaaggg
ttctccatgcaaaggcaaaattgcttttgaaggcctaaattgtgattgct
caaaccgcaagtagaaaaaacataaataaataacctgcacaaccccaaaa
ccgtcccttcacttctcaaccaggcaatatactaacacaaactagattca
tataattgaatgtgtttgatgcaagttaaagcacaacagttcctgcaatt
ctcttttgagtgaggtgccattatcttaacgccattttgctgctcaaaca
tttgtacaatatttatgtaaaatgtaattgtctatacaacaagacaacca
ttggcattgcttcagagagaaatataattgaatgctaataaaagggcagt
gaatctttctatttctctttacaatcatcctaaaaacccaatggatcaaa
gatgcagagtcttttcttttgctcattgatcaccaaaatttgcattccct
atggacaggataatctttgtacaaaaaaaagaatgaattcgataaagaag
aaccaacctaaggtacagcaacgacataagtaagtaccttagttatataa
gaagatgaaaagatctgcaaagatagacttacattgtaccaaatcacaac
atggactggggatgatgctcatatttacatttaaacatcagcaacaacaa
taaaatgtaaggcaaagagcagtagagtcatagagaaccaaagtttaaga
ctacctaggcaaatgaattctgcatctaaccagtcaaggatcttgcttgc
cacttgagatagtttcatgaacaagtctcagtagtatttactaatcgact
cattcatctcgtctctcaacaatcatcctgggcaagaaactcaagtcttt
tacctcataattatcagttgtcctagatctaacacgaacataagttgcaa
atgaaaaccggacattattttcttccaatggcttcgaagagtacaacagc
tggaaacaagacgagtcaattgaaggaatgaaggtatcgcattcaatgct
tgtcccaatttcagtaatgtgaatggcttcgcaacctggagcattgagtg
tttccctgcattgtaaaacatcaaaacattatctttccccaacaaatatg
caattaaaattcaacaacttttactaaaaaatctacctgaatatctggcc
accgccaatgacaaacaccttctctattgaaaaacaataaggatccttgg
ctaatagttcgaaagctgatggaatgctcccacatattacaacattttct
ccagttgtaatatcagaactctgggaacgagtaaggacaacattcaggcg
accgggtaaaggtctaaactcaagtggaatactctcccaggtttttctac
ccattactacagcattcttcttctcaggatctgatgttgtcactgtaagt
tccttgaagaatttgagatcagaaggcaatctccatggcaacttgccatc
tttccctattcccatttcacgagttgcagccactacgactcggtaattcc
tcggggaagcactgttagataggctccgtagattatcacccgacattaca
gaaaacccatgctttgcaatctcgttaaaacctcttaaaaattgagaccc
agagataagattgggaaacccatttttgtaacgactcagaagaacctaaa
aataaaaacgcagatcgcgagaacaataagtcagataatacgacgcaagc
gaaagtgtagaaaggaaaccccatataactatacaaaccttggagaaaag
tttgttactctgcagacgcgtcaacattgagaagaaaatgagatccaata
accaaaatctttgaacatcggaacaaaccaccaaaagagtccgaccagaa
caggtgctctgcttctgtttgaaacaccgacggtcatggagggagtccag
caaatattattgacccttttttcattgcgatttacattctttttggcttt
ttttagaaaaaaggaaaactattacacaaatataatattatttacacaaa
aaggtaattattttttacattttttaacaccttaatcaattattaatatg
ttaataaataattctttaaacctgatatgtatatatagcataaattaaca
gtgataaacatttttaatataatatattttaacataaataaaataaatgc
attatttatgtagcataaattattaatatgttaataaataattctttaaa
cctgatatgtatatatagcataaacacaatgaacaaaaagatataacaca
aacaataacacaaaatatttgtgttacaaaacaaaacaacattttatact
acattaaaatgtgcactaacccaacaaaaaaaatatccattcaccactgc
aaaaccagccggtccgaatgacactgttacacgcttctgtttggtatttt
tatttacacctcatttcccttcgactctgataatctgatatatcacccca
acaaagctttctatccatcttcaatatgcatgcatacacacaccacaaat
attattgaacatttgatcgattcttttcggtacatacatctcattctcat
ttgcaccagcaaaacagcttccttctctgcatcatgcatgcaaacgtaca
aatcatttatctaactaatgaaaatttaatcatattgcatcagttcacgg
ttgaatttgattatcttttgacttaccccaggtttgactactacttcact
ttgtatgcgtgcaaggagttcgtcctgccgaattatagcttcatggagag
cctgctcatgtaaacaacagtcgtcaagaaacaagaaaacatgcatcatt
acggaatccttatatcaaataacaaacggtgctgtaccactgtagcctcc
tcttacatcaggctccggtcatttagtaaaggagtagaacagtttgggac
aaagatcaagacaggcttgaaatgcttcttaaggctactcacaagtaaca
acctaagaacgcggcatggaagagataatctatactcggagctggaagca
tagaatggttaccttctttgtagcaattagttctgcttctagcatttcca
cacgatacatagcagcattcaacaactcctctttctcatgaggcatctca
aatcgttttgattgcagcatctcaatcttctcttctagatcacccagcct
tcttacaacagatgacaggacgtctgcctcagtaaaccttggagcaggag
aaggtggacgagtttcctccttgtacgttggttcaatatgctgctcagga
atgctacatgttaaatcagttgaactcttctttttcatcagattcaatgc
cattgtttggataaatgttaaaaaagtcaagaaggcaacaactatagcaa
tgatacgaccatagattccttttggagtttgcctttccagcagcagagga
gtccctgcaattaaagatagtaggcttcattgaagtaaaaaagaaaaaag
aaaagatgagtaaataaaataccttttaacgtagctcattttgctaacct
tcagaagtatatagagtttgacgtgacacttgtttctcacattccaaatc
tacaaccttgtcaatcatgggaacatactcaccatactcagacgaaccac
caccacagatcaccttgccagccattctagcctatacaaatatcatggta
tgttgttacaacttcaagattgaagaatttatagtctgacactgaaagtg
cagttccacttcttagggtgctaccatgttattttatacagtgagcaaag
catccacatatatactcactcttgaatagaagaaaactattctggtatta
ggtggtcttttaaactatgaatctagcatgtaacgaatgaaatcctttta
tgccacttaaatctgtcaagcaatttgcaactatctacctcttcactaac
gggagccaatattggatgtaaatagcttctagttttcttaggggaagcaa
gttcttccacttcagatcctgactcagcagcagatgtgtcactactcttt
atctgattcaggatgaacatttaatgcagaaataaaaattagagaatatt
tgattaaattctaacaatgcaaaatacaaagctgagaaggtataatatgc
actgcaaaagacaaataatgaaccgtaccaaaggataacatggcttatca
taggcaattacccttccctcactgtttgaaactgttacaatctgtctggg
aaatagtgcttcaccactggcaatcatctacattaagatagcattcatat
tgcttaaaacatgtatgggataacaatgaaaatgaaggagattggaaaat
aacccaaatttattcacatagtgcatattacacctttaatatgttggggt
cttgccagggacctttgtctgatctcatacaacctccctggtcagaacaa
atgcagctacctccaagaaattgcggcaactcactaaccaagttcaatat
atcaaaaccctttactttccagcacaactaaatgtgaattaacccacata
tcagcaaccaaaaacattttattaccttgcttcaataatttcaagcaact
tattctggtagttgctacccagaacctgagagaaatttcaaaaatgaggt
aacttccagtaaccgagagtccatacttcaactctagtaaaaaaccaaat
tatacaaagattttgaacttacattgatcttactagctgttttagaatca
agaaaagatttgacagctttcaggcccattttaaaacccggaccagcgtt
aatgatgaacatacggtaaagagtctgtagaagggcaatcataataaaca
ttcctgacaaatttctatcaatgctgataacacaagctatattcacaaaa
tatctgagcagattagcaataggacgaacatgctacctcagggtagttat
caccatcaatcttctgcagccgcctcacaagatcttgtgcagtcttggta
aagtttttatatccctgagaacaaaaatgactggaagtgatcaatatgca
aatactgtgatagactcttgttaggccatcataaaatgatggcagggagg
accctaaaatataagaagcaacataaaacataccatgccttgaacatcca
aaatagttgtacttgaatctatgtgtctcttcgcagcaatggagcaagcc
ggaaacttaatagcaaaacacttctcaaattcctgcacatggtatcttac
atatcgttccaaagttgtgactcgcatgagcttgtcaggttcaacttttc
ctagcaattcaatgtaaaccggtcttccttccttatccaccccatgataa
ccttgagggtagtacttcaacacttcattcaactcactgaactcaaaatc
ctggttaaatcataataacattaaaaaaaaacaaaaaggtcagtgtttct
ctacaaaaaagcaggcaacaagtgaataacaacttggaaaaaaaaagtta
tacatgtccttaaaactaaggatagaagcaaatatctaatgcagtaagta
agtaagaccattcctgcaataagatgggatcacctccaaaatagtatcag
taccaaagtctttcctccattggatcatattatcccacatgtgctttgct
ttttcgatgtcgaacttccttgctttcaagaatctgcaagaaaaccacca
agcacagtacaaataaaccaattttgcatcggtaaaaatcgttgaagcaa
tcctacataaaaagcatagtggattttaaacgtacctcagtagcatatga
taatcgtcatgcctagcaggaagcaactgctcggctattaatgcctgacg
gaaagcatcaacagtctgcagctcctcgatatcacgaaagtccttaatcg
aaacagagagaccacttttcctcctactactcttcttcttaagagaacgt
ttaaacttactcgatgcctttatcgctttcttctttaaattcccgattct
agtcctcctgtcatcttcagagacttcgaaatccgatttcctgtctttcc
tttcatcattacaaacaataccttcaaaacctacaacaagttcatcgata
ttcagaaatattattagttcaaacgatgcagcaagtaacgatcaaagaaa
aaaaaactaataagcatgaagcatagacttggcagcagaaaagttccact
cacaaggccttgcgaaacgatcgagcgggccggacatgtttgaaggatca
gtctcgtggaaaagtgcaacacacgatccagaacgtggatacgattgttt
agaaagggaaccgaaatcaatgggagtagcgaaggaactgaagattttac
cagtgggatctaaaaaggaaacggcagttcgaagaaatcgatcttcggga
atgacgtggctgctcaggtttagacggacaaaacaaacaaaagagagata
aattaatacataaatacatcgcaaaaaactaaaaggtaaaaatattattt
atatattaattatcggcggagcaaacgtcaaacaggaaagggacccagat
gggatggggggaccgactttctctccgtttgaaaagtaaactgttagtgt
taataaactgctgcagtgagtagatattgttcacgggaatttgcttacgg
aaaacgagtttctgtcggtgcctttaactgttttattctctcttatgttc
aaagtgcagggcaggatatttttacagttaaaacaatcatatcaatgtcg
tgcctcagggcgaagctaaaaaatatttttagtggtgtcaaatttaaatc
gtaaattttattatagtaaacttttatttttctcaatagtttatattttt
ataattttgaaaaattaaattaaatttttattttttaaaaagattaaaat
aaaattttatttttattaatttaaaattttaaaaattttaaaaagtctaa
ataaaaaaattcattttaagtgctctaactagacctgctcggcctaaaga
ctgctctaaaaggtaggaaaatttgagtaaaaatataaacaaaaaaatgg
gcttagataaaaaataaaatctgtttaaaagacgggtcgaacctcaagta
aagctttttttgtccgagcttaacctagcttgaatatgtaaaaaaaatta
ctttctttttgctcactattatgttgttattatttttttatacatttact
tattaagttattcctatctttgtgttatttaagtatacatatttttaatt
tattttcaatttgtcgagaaatatttattttaatatttttaatatttttt
atttattatattttaaaaaattagaaaaattaaaaataatataaaaaatt
taatacgatttggctcaaattttacatttttatttaaaccagacttggta
aaattttaggcctattttttgaactaaacccaaaactaataaataggcct
aaaattttattcaaacccgacccaactcgactcatgaacacctctactcc
taactactagattgtgtttttattaatatattttaattttcaatatttta
taaagttttaatagtaaaatatacattatttatagtgtattttataaaat
taattaactgatctcatatatatatagtatttttaatttgtatacaactt
gaatattgaaagaaaaaaagaatcaatacttctaaaaaaagttaatttaa
ttatcaatttaaaactactaataatattataaaattaaattaaatataaa
gaaaataaattcaaatattcaaaacagtaaacaaatggaaaacattataa
atatttcttgttagttcattaatattaaacaactcggctttattatatct
ctacttcaaaattggatttaatggtagcaggtgaaacaagaaccatatat
tgttaagcgtcatcataaaccaacgtgctttaacatataataataacaat
aataataataataattgtcaccaatattctaactatatctgtacaaagat
tatttatatacatatatattcacgggacttccctattccatataaattga
tatgaattaataaaaaaggatgagaaacaattgcttgcggccggatcgat
agatgtcagcttcaacaataactgctatttacacttgaaaactcaagcat
aaacaactgcaacaaattattacaagttttgttaaataaaaaataaaaaa
aaacaagataggcagagatgatagaggagacactaccacacaattaacta
aagccccttcaagattcacatattataaacattacctgtcacgtgaattt
cctcaagttccttgctgcccggaacttatcaagtttgtctctcaaatcag
ctgtcagagagcatcagaatcatgataaacatattaatgataattaacaa
acaaaaaaaaaatctgacaaatgaagaggaaggtccaagcgatgctacga
ttctaattacactccagtcttctttttaatcataattagatagatattct
attggacaaaagacaaatggcttaagcctatgttaaacagcaatgcaatg
tctgagaaagacacagggagagtaccggcatccttgtaacgttcctgaga
aatagcctcatttaagtcgccgacaattttgaactcctctgaatcgagac
aaggctgaccacttggcctggaaaattaattaaggtaagccgcattcaga
gacaagaatctcacgcaatttttaatgagtctaattctatcggtaaagaa
agcaaatgcaatctccaaagggattccaagactaactggtccagttcggc
atgtggtaaaacatctgaagctgtggactgtacggacagcttccctgatt
caatcactcgcattccatcactatatgccaagtacttattcacttgtata
ggtacctgcatagcaggtcaggtatggttcaaaggtcatcgttccaaaag
gctttcacattcttatggagagtgtattcagtccagaaagtaaacaaaaa
aaaaagggcacataatactttatgtaaaccatatttcacataacaatatc
tagttaaatggacaagaaaaccaaaagaaagaaaggggaaaagcaacctg
aggtcaatgagaaagcatatgaatgcttctataatctgtacagtggatac
agcattcccgcaatcagatcgacaacaacacaaaaaccaattttccaagg
ttatacactactgtagagggaaaaatctaacaagtcctagcatacacttc
aagtattgttaatcatgaaactggcataaacattcgatccagtccaaaaa
tcatacaagagactaacatataaagtttaccttgcatctcacagcaatgt
tgatagcatcagaaggccgaaggtcaaaactaacagactctgtttcatca
cccacctgtgacaacaccaaaaatgagtcagtgaagactacccccgagtt
aaaagtttcagtaagtaagagagcaatcatatgttccacgcttaagtgca
tacgtacctttgttaggtacaactgagcaaaataggcctcatgcaccctt
ttagtaactctgacaagctttacctgcagaagaatgaggtatttatcata
ataaaaataaaattggttgaaataagggaattcggacaggaaaagaaatc
ataccgagtagcccatcttttcaatcatgtccttaacaacttgatacatt
gtaggtctaggctggagataatagccaaaacatatgttagcatccatatt
caaaacaaaaccgagtgagaaatccaaataaaactcaacgcggaagtgaa
aatgatatcatacaatttggacattgctcattgctgccatgagcaacaca
cttggcatctccactgcattcaaaaccacaatccatatcaattatgactg
ggaaggtaataaatggatccaaaaaagactaagatcatgtaagatcacat
acaaacaatgattgggagaagaagaccagtcccatcttccatcttcagaa
caatcgcaggatgcggtgcataatctggcagatttccaggttgcggattg
ttttgaatacatcttaaatgcctaccatccctcattttaattataaatcc
atcaggtccgctcttcacatgatctacatgaaacagttatgaaatatata
aaaggcacaagttaatttcgaaattaaaaggcagcagcaaacatccaacc
aaccaacaatcactggcttaatgagaacccatataccagtttcaaccaca
gtggaattaacataatcttcatccttctcattgaaactctcagccatgct
tccactcccatctgaagatgaactgaaactacagtgcaccatggtcttgc
aatatcgtattttcagtttatgagacttcattccatcaatcactcttgta
cgtccccatatatcacttctaagcaacctcgcccaaggagaaggcctatt
caacatcagcgtgtcaaccccaaccggtttgctgtgaacggaagggcaaa
tcaccggtccttgcaacgaaaccatctttctccgatcactacctacaccc
acaattaaaaaaaaaactaaatgtcagatgtcttatattcataacttgaa
gtgtactgatgaaaaagcattcaaatgaaatttacagttcattttagttt
tcttagttagagctctgaatttaaaaactaaaacaataaagaaatcctct
atatttaaaaaggatggatgatcctacgattcaaaaattagacatgatag
aattaaagcgtaaattaaagtgaaattcgatagataaaattttacacctg
gaaaggtttccaaaacaggcaactatattacctatacaaagatcaaagaa
tcaaaagccgatcaacgatcagaacaaagttattgcgaagaaggagaatc
ttcggaagttgaagggcggtcctgattgattagaatgtggaatatgaata
aggttttcgaagatctaagatcttcgaaaagaaagaaatagaatgaaaat
cggagaatgaaagatggaaagaaaaaagagtttatagagtaagcaaatga
gtggtggacaaaaatatacatgagattttctttttcttttttcttttgga
tattattaaaacaccgcaacatccgaaactcttttcccttatctcaaaaa
aaaaaaaactcttttcccaaattacgcttgtatcccttctgtagttctgt
tctgtgtggttcgattttttttttttagttttccttttcaataaaaatta
tttgctttgatagtaaatataaaataaaattattagcaattttacagtgt
ttgttgatgataattatacacaattttaaaaattaagaaaagaatataca
atattataatttgaaaaatactgtttaaatttgaataaaaatatgtctaa
ttctataaatataaaaatacgagaatatattaagcttactttgatttata
ttttctatactatgtataaaaaaactctttaatccaatatcaaatcagat
aattttttaaagatgataatataaaataatattttaaaacttatcctaaa
aaattaaaatttaaaataagtatccacttccctacaaactttcactaaat
aaataatattgtatatttacatttttttttgttttacaaataagtagaag
gcatggattcttcttttgtcgttaatctagtattcctgaattgtatagat
ttgtttctaattattaaaatttcatttggtagatattttcaacatgtttg
gtggtattgtggttgatggaaggggagaaatgagatttgggatagaacga
caaaaacggctgaaccgaggcccgagcctcagagccacgtttttaagttg
taacagatcaacgatgccagcggccgaaaatttcaagattctacgtaatc
gccacgtgtatactgattctctcgaacgatgtggataaggctgtctaaca
aattcctgatctcttcctcaaaatatcaaattcctttttgaagggaagtg
gataagacgggagggtaaaatcgacatcatttgccatttttcattaaaac
cggtacaatatgttcttttttaatacaatggatttttgagattcgaacgc
gtgtatatcttgctttagtatttttatttttatttttattcatttttatt
agaaaaacaaaaatattaatgtaatcttattcaaatttcaaatatgtcaa
cagtcgttataacatataataatctaggacatataaaaaaattatttatc
tttaattttataatatttttcaggaagaaaaacaggtttaaacatagtta
aagttacattcccctaaaggtaatgccaatcaaatactacacaagtatta
aatttagcaatagttaagtaatgaatttgatgaaatctgaaatatagagc
tgttctgtctctggtcggaaaaacgtgggaagcaaggagattgatattat
ctatatgatgggttattctatataaatcctaattacttgatggaggattg
tcttaaattgcaccaacgaatattatataaatggaagcggttgcggtgga
gggttcaatatgtattttcttccaacttcatctgcctttgcccatctgtt
tatttttaataaaaaaaattgtctagataaagcaaagacacacgtgtatg
agattgatcattgatattgtcgaatatgcgcgaaagaaaatgaaaatgag
taaacacaattgattttgttccatctacaaagtttgcatttgtttctgtt
tttccaaagctaaaattgggattgggttcagattatgattttaatactta
attttaggcccatttcgggcaaagtacaatacactctaccccagccgccc
aattaatgaacacctattctttggctttggtggatgagaaaataatttta
tttaactgaaattttttattttttaaaaataattagcagcctttttttta
gtatttttaaatattattggacactgggtagctttttagaataacaagag
ggaagttaacatatggttaatgataaaaactgtatgagacataataagtt
gtttttttttttaaatttgctttctcaaataaataaaatacatatataat
tttattaatattaacatataagtttgtttttttaaaaaaattagttattt
tattctcttcaattaagttgacattattttaatccgtactatcaactcga
tctttttctcttataaaaaataggataaaaattatcaattgatggaattc
aaaattagtataattgaaaacttaactataaatccttttcgtcattccat
tacattgctaattttcatacctataatgtaaagtgtaagaaaatttttac
catatagtttaccgagtaagtggcctacgaaagaaacataggaagattta
ctattattttatatcccatgtttaaattacttatcctcccttttatatta
tatatttaaattattacattcgtaataataataattaagttaagataaag
ccagtaaaatatttcccttttcaatatttttttctttcttataaaataaa
acattaattgtttttaaattatttttttaaagtattttaaatgagtttta
agtcttatagattaaaggaatgtgtgttaggaaaacaaactaattaagta
ttgaaattaattattgataaaaacacaatgtggaggaagctcttctaaag
ggtacaaactataaattaaattttaaaaaaagtacaagaattaatgttgt
taatggatcaagcttggtccgtcttgtaagagagtaatttaaacaagatg
accaaatttgttccattgaaaccaatgctagcagcacttattatttctcc
taacatacgggattagaaactaatcagtattttttttatcataatatata
tgtgtatatatatttatatatcccaagatttaatatctcttctcgcttcc
aaaccagctagcggcagttgttttctaacttcatccggtgaagttggggg
gcggcggccaaatgccgcccccaccgctctcactagtcatgtaagacatg
cacgacaatggaactagacatagacctcggcttctgagatcccgccttgc
ttcatcttcttcgttttcgtcctccatcgttgaaccctaaacatcagcac
aaaattttcaaaagttacagtaattgaaatgatttgaatacccattgtcc
cttaaaatgacgtgacaaagttattgtttccattggccaccgtagatatg
ttttttcttaccccttgtttggatttggatgttttattgcgagataactt
catatacggaacgctcagtgtctgtcgaaaacaaatacggtaattattca
gtatatacacatattcatacgtaaactgatcatgtttacatggaaaatcc
aaacaccaagattgattctaacgggatatgactaagtctttgatttctta
aactcattccaaagaaagctcatgttgagctctctctttctctccagcta
gctaggctgagaacttcttgggaaatcaacaatggctaatatttagtttt
aaattggactccatacccatagaataaaacgctataaagaaccctagcta
gcagctagttttgcctgaataatttagggtttacttctagagaaggtaac
aggttgggggttgcagtagcccccataagtggcagtttccaatgggtctc
atattgaggtggaaataatattttaaagatgtgtcagagaataggaatag
taaaatgaatatataacgtaagaaatcgcaaaattcaaggagaatgtttg
ggaagtgatattgatatatatatatatagtacctcgacttgattttgaag
gaatttgatgtatccaatagcctccattagtacggacgctgtatctgtct
gcggtatcctccccaccaccaccaacgcatgcaataaaaaaaaagtaaac
ctcgtcatttccatcaattacccactaattaattaaatctaagactgatt
attactaataaattaattaatctctctcattaatcttctgttttcctttt
tcttttctctatcagcatagcagctactggtggttgtttattattgtgtt
tctttcctcttttaccttgccaaaaggagctaccagttgttgaagagctg
caattctgtctcccagtttctccttcctaacctgtttgatgcaaacccaa
acatgatacaaggttgtaaaacgtggaaatcaagaatcaggtctaggttt
aatgttccttagggcaccttaaagggagggcaatgaagcgcgtgactcca
aacgagatttcttggctgtagttgttgttggtgctgctggctttgtttct
ggtaaaatggctgggtctctttgcctctgttatttcagtggggaagggtg
atgtctttcatggagtgcaaagagtaaagatcagttgaatgatcataaaa
aagaagttttaaaaaaataataataataaagccataaagttctggtaaag
atatatgcattacaacgattaaagctgaaggtgcccatatatgttttctt
ttagtgggcatagttttgaacaagataatattcttacttatgaataaagg
ttttcaactttccaatcttttcttgccttagcatcatttaagaaagtgct
ccactaattaatcatattctactcattattgtgttatttaatggagtatt
agatagtattattgagattccaactatacttttacataggattataagat
gcttagcactagttgatcttatatttgatttttgagttcaatgcatgaaa
gggtggggagggaacataacatgcagtgtcatacatatatacatatatat
aaatcagagccatgacagtgcagtgttagaaaacaataatgttttgtact
tgaggtatggtttgtggtagaaatgaatgctgctacaagaaagaatagag
agcacttactttactaggggtataagctactggcctctgacttgactgtt
gcaaattatggtggtaatgaagaccaaaagaagggctgatctctttgtat
atatcaagattatcatgatcttccgaagggtagctaaacctactgcttct
gctaaaccttgctgggtttaagagatccaaggcctccatattcatgtcga
aggagcttgggatattgggggaagaagaagcttggttcaaacttgaaata
tttatactagggtaaatctggctgaaactccctctactaggtaaaaagct
attcctagggatggaacaattctgggtagtcgagtaaaattccggtcctg
tagaaaacattgggaaaccagaagatattgtcttgagcaatagtttctgg
ctgagatcactcaaatccctttgctcattatttttcaagtagtttggagg
aggcaggtggtgagaatctatgacgctggaggtactgtcgcttaggatat
cagtaaatttagtgatagattctgaaagctcgtcctttattttaggaagg
tgtaggccatggcaagaatgggtagtgaagctcccttcgttgttagtcca
gccttggatcatggaactgttttgaggtgatactaacatgtcatttttca
gcctggaatgtaagatatccccattataactcggattgaattcactggag
ttcctgcccaaaaaaaaatggaagggaagcaattagtgagagaaagcagt
atctgatgcactatacttggtgaaccgacaagttttaggaatccaaaaac
aatgcaacaaaaagaaaatattctcctgaaaaaacaaacaaatgataaat
aagtaaaacttaaaacaacataattgtgattgatgcacatcaaatcagaa
aaaaaaaagggcgatagattccggagttaaagtaaattcataatggcctg
tgaagtatgaagagacaaacatatttgtagaaagcttaaccagagagaga
gaaagagaaaggtttaacttacaaagcagtagttggggtccaagaatggg
tgcttgaaactccataacaaggtgagataggtaaagaagaagaagaccca
agaagctggtcttgaaggtggtgttggtgatgggcattttcaggctccat
gatgataatttaaaagagagccaaaagaagaaaaggggccttgaaaatcc
caaggttgagtaattaaaattttagttactacacagctagtttccaggaa
tctctcacgctaatcaaagaaaacagtttcaggtgacacccacatataca
caccacctcctttgcttttatctaagcaacttttctctagtttttttttt
tttcctttctttactatttcaagtttccatctttaaaagaaaacaaagaa
agagagagagaggagcttcaacaatcccccaccctctatcttgactttaa
ttatttattcttcttttcatcctaaacttttttttgcagctatccctcaa
aacaagattttgcttaaaagaaactcactccccacttttatttatatata
taaataaagctttattgcactcactgcaattacaggcagatgattaatac
ttcctcaaagccatgattaagatccctgccttcaatcccaagactttcag
caaaggtctgaggagagaaatgataacaccatgctctcttagctgcctct
catctccacatgttcaaagcccctttatatatatctattgcttctattgt
tatcttttatttataaattcagcattaatacagtgtcccaaaatattgta
attttctacaaacatttccactggaatttatcatatatccttttaaattc
tttcatcgatgacatgattgggacaccttaacttaaatttcttttttttt
tgtgtgtgtgtctctttgtattgtgattggtcatctcaaaaagtacttaa
cttgccccctaaaatattactacttcgtacagtcacatttaaaaagagaa
aaaaaaaatctttatatataagttttgtctgaacttaataatatatttta
ttttatcgttagaatataaactatatacatgatatgtcggctgtaatatt
tttcaaaaaattcttttgtttagaattttagacatgaaattatgttttag
aagtttggcctacccgatgctggtgggatgcaccttttttcactgccatt
aatggggttttgtgtggttgaatgaggccttgttcagatagagatgtcgt
cctttgtgatacagagatgatcagatcagactatatttatagctatgatt
ttagtgaagactaaccagactcactgggaatttcccaagtgtgaggggcc
tccccctccccctttccacaattgagatatcgatgcagtaaactattata
tattttatatatctgtgtaaaataaagataagaaaattttaatatacaat
atgcatcaaatatagaaatggtaatagaatggaacagaaacggatcctta
ctagattcattatcgctcagcatattctgcttcgccatccacctactcca
cttcattataaatgtataattttaaaaatttcaactgcctttatagatat
tgaatgtaattaacgatcctcacctcactctgcttcactccaatttaaat
ttttaattttttttaaaattaaatatatatttaaatataattcttcaaaa
aaaatattttgtttttaatactttaccttttcaataattttatatatata
caaaggataaaatagtaatctcatatagcaggtgagacaaataattatca
taataatttaaaaaaattgtattctatctcacatctacttatatttgaag
caaattaattcgaaatgaaatattaaatattaagtcggagaggtattaaa
agataaaattctattatgataatttatgtaaagattgaaaaaggaatatt
tatgggcaatccccttccgttcctttataatgccactgtcctgccgtttt
cattcatttcttctcttcttccaattctggccctctccagtctcccccca
ctatagttttcattttttttctttcttctatttgaattaaactaccgata
tttaaaattcaattttgttgcctaatttaccaaaaaaattgaaatcataa
aattcttttagtctggtgtatttttatatttaaaatattgatttgattca
gttttacatctatgtattacatactcaataattatactcatccgatataa
aaataaattgatatttttatatctttaaagtgtgcgaatgaaccataatc
aagttgcacgtaaatatttatgtaataaataaaaatttatattttaatat
ttatgatgataaactggaagggaggcaaaagaataggaatgtaataggtg
tgtcatcttcatgaagcaataatatgttgcaaaataaaacttattgattt
actatatatatatatatgaatgatctaaattcgaaatatcataaaataaa
ataaaataaatttatcatctgacatgtttctttgaaactcaacaaataat
tgatataatgctagatgatttgtgttgttggataagccaagattattgtg
aggtgtggtacaaaaatttagagctcatatacaaacatataattacttat
aataaccattctctcaacatcattaattcaaattcaataatcaaatttat
gatcacttcctccctacaattatatataaaggttttaatttaatttgtgt
cacaaattaattgactatttttaacaaacaacacatattcttataatggt
taggccaagctcaaacacatagctctacataagtcatcccaagaaatctt
tgttcgaaataggaaatttgatcctagagtcatcggcaacattactatgg
gcatgaacttaacctttcggcataaccatgcccctactaccaagtccgat
gatctacttgccaccatgacccatacatggcaaccatccctgcccctatg
gggggtaagggactcaccactcggtgtggggggtcgttgaggggcaacag
accactaccccctaaagagcttacaagcttttataaaactgctactaata
gatattaaattgtctgaaacaagacaatttattagcaccctccttcgtgc
cccttagtggcttaggcaaggtcttgtggtgaccgaggctcccatacaac
taaagcatcaaagtgtcgatgatatccaatgttcccacaccaccaagggc
ttatgttgttgatgatattcaaggttttcgcacagtcaaaactgttagca
tacataattactttttaaatataagttaaaaggattgatataattatgaa
catgtttaacgacaaaaattaatatgaaatatttttttatatttgttaat
tttttaatatagtaagaaaacaaaatctgttactttctatatatatatat
atacgactttagttaataaatattttttaaaatgataatataaaaatatc
aatgattatatttaatatattaattaaatttatttaaaaatacttataaa
gtactcattccttaataaagctcatatgtataaagaacaagatagattaa
gttgtcattccctgagagagcgatatttgaagagtccccacaatatttca
catcactccaaaagttgatgggagtgagagagaaagactctgagtccctc
tctgtgagactcaggcacacggtatgggcatcatgcattgcccaatgcct
ttgcctttgccaatgcctcactttttttctttcctccccttgttgagttg
tttataaatctttgtttctctgtcgatacttactttttgttcaaatccct
ctctcccctcctcttttttttaatccttttcccccatcatcttctccttc
aaagcttttcatctttattgaaaaagaaaaaaaagatggtatttttcttt
ccctttcctttgcttgtgagttgtaaacttttccatatttcccaatttca
ttatcttccaagtttcatttcacaaaagctgcttctgcatcagatttcac
ttccaatatcctatgcatctatttcaaaacataatttcttaattaccctc
aataaattatgaactactttgagttatatatacatattttagcttatggc
tagttttaatatatatataagtctatcaatcattttaattttaatcattg
aaaggataaatgtatcttttccttttgtaaaaatatattaccccttcaat
attttcaaattaaatttttgctttagcgaccgcagtgttttggttgttgg
gtgcggtctctttaactatttttttatagttttattttgtttttaatttc
aatctatattattttgattttgtctataattttacggttatcaatatttt
ttatgatttttattttatctagtctatttttttatttttaatttttagtt
gggttctaacatatatgtgggatttgccaatataatgatactttcaaatt
tattaggaaccgttttcgaagggcattatcatgatagattataatgatgg
tgatagatttgagatgatgaggacaggtcatctgagacctgatcatttgt
gcatcactaacgtacatagtggatcttttgaggcttttgacagctttttt
tttgttgatcggtgtacgtcattagattgatttgatgatgacaaggttgg
gatgcaaatttcagctatttgattagttgatgcgtttctgaattattcta
gtgttgcggttactgttaatttgtcattccctttatttttaagattatta
tacaaaaataacgtttgtgcattagtttatagtgattaatttctcgtttg
tacgtcatgtttttatattattattgttcaccgtcatttctttaaaaaaa
tgattgagagaatacaaagatgaaatattatatatagaaatctttcccat
aaacggagaacaaaacacaactccaaaagaacaaacaaagatgaaaaaaa
aagtgataaactattcaactacccccccccctcctcctctaaaccctttt
aacaaagtgattcaaaagggttccaacttacaataattaagtaaacagat
tcatggggatttttattttctttctttttgtgtgtaagtgatgattcgtg
catgttagagttaccttcacgatactaaatgatagaagcatgaatggagt
ggtgtcggtagctaatggttagcaatttgaaattgaaaaacaataatact
atttatgtgatttaacataaaagatcagatatggtatatgacttcagcta
cccctctcccacttctcaatctcttcaaacttggtttagactaagcatat
aaaatagtggtcaatatttaaaaaagcagatggctttgatatccacatat
tggtgatcttttgtgggtgcattatttgtaaaaaaatttaagattcaaat
acttttttattataatttctttacatataaaacaacttaattgggcccct
tttggctatgattaatcgctttttaggggtccattagggggaaaaaagca
agagccctatgttggcttttatgggcgtaggcagtcaaccggccgagggt
caaacatccacttcccacaaatatatatatatgtaatgtaaaaatatcca
aacttttagacaacattggcttaattgatggaaatattaactctgatgcc
atgatagtgaatataagcatttttaaatgatacaacatgccttttttttc
cttcttttttaatccgtggagcgatttgaaaattattggattattcagtc
tccaaagtttatatttaaaaagaaaaaaaaaacttaaaaaggtcaattta
gaaaatactgtcaagattatcaatttattgtcttaattttatgtaatacc
attatcttgtcccaacttatgtgaactaattccaatgaagattgtttggt
gtctctggacatatagggtgacatcattgtaaatgattctttattagtat
agaaggtatttgttttacttgatatataatctaccatcataccaaatgat
ttttattttgttatgatgatggatggatggatgatagtttgattcaataa
ttgtaagatctgaattatttttaatgacttatgttcatggttatgatgat
aatgttgatgtatgataatttgataacccaataattgtatgatatgaatc
aaatccagtatgtaaatctgtaatacaaaagttaatttccaaaaataaaa
actaaaataccttgcatactatatggtagtacattaattctgaacaatta
ttacatattttatgcaaccttttttttccttcccttttcccatttcaatt
gtttaatctcatttgttgcttatgctttttcgctgtgtatatttatacat
attgcaacttttttttttagtcaaaaaaataataatcagaaagcccttaa
aagggggtttaaagtttttgtaagatttaaaggtatgtcataagaagaag
acaaagccattgtcatagcagaatatatgctttctatcacccccccccac
ccacttagcctcatgtatatgtttatatgtatatatatttccttattctg
tgttgatccctttatttccctatggttatttagaatgatttttatatgta
gctttggtatcttccaacaataatggtggagattatccacttctttgtta
aaatattgatgccagtcagcccaatgattcaaacactttagctttgtgca
tattttcagtttccatctaagaacagaccactttgatcaaagttttatcc
tttgatttttccaatatgaaatcttgatggatcatgttctctattttttt
ctttaagggaaaaaggggtatgcctaaaataatctagaaaaagaaaataa
aaaagaaaagagctttgtttcaaggatcacaaatacatggaacatataag
acagttttgaccagattctttttctttctacagatttttctttccagggt
aaaattaaaaggccagataatgggagatgttgatgaactggttgaaagaa
agaaagcgaaaacataacccacatggctgatgcccggggctttggaggaa
gcatttggtgggttaagagctttatgtgcttgcttttcacggcaatggag
ggttccactaccttcatcttcatccccacacttggaaagttaagtgctta
aatgtttctctgcttcttccttctgaccagatcaaatttgaaccaagttt
tcaagcttatacaattataaaaatcatctatatataatgcaacatatagc
catactgatccgattcatcatttttcttaaagctttcatgtgtaacatta
ctaaaatatgaatttcaaaactaaaaaaaatgaaatctaattatactcac
gtcgaatacattcgacatattcgaaactcgtctagttgagaagacaaaag
ataaatgacgcaaaagaccagtaacaaaagaaaagaccatgagagagagg
aagtcgtagaaaaacaatcacaaaagaaaagaccatgagagagaggaagt
cgtagaaaaacaatcttttctggtcattatacttgaaaaagcaaggttta
tccttctttacaaatgacttgtattaaacgtaaatcagttctttcttctt
ctttttcatttttgttcgtcttttaacgaaacgatcatcttgaaataaaa
agcaatccaatcaacccaaatcattacattttccgtatatttacatgtgt
atgcatgtacgtccacaaaaataatgggatcttttcagatgaagttgaaa
ttatgccaaaaagcagaaggcataaatttagttctttcttgctccttggt
accaactgtcaagtacgtaatcaatgaagggtagttgagattattagcca
aagaatgacttcatgttttgatacactgattttggtgtttaaggtgaaaa
aaaaaaaaagaagcaacaggaaagaagtaatacatacatcggggccttac
ctaggtcagcctttttgcactattagtttcttagtatatttcatcaatta
gttgctaaaagtgaataacaatgaatctgttttaataaatggtaggtcaa
ctatatatttacaattcaacagaaaagaatggatgtgattcttgcatgaa
tgatccaaaatacaaataaaatatctctcgaaaaaaaatgttacaattat
tctacacttgtatacagtctacaacaaggcaataattatagttgttctaa
gagagaaatagaattcagtctttcttgaaatgccataaatgagaccatgg
aagggtcgctttgatgcattaagtagaaagaagatatgtggttagagggt
atcaacgaactacttctcccaacttcaaacctcagtgcacctccctcgct
tccgggaagtggcagattccagttctattcccatctccagttctctctct
atccaggcttcactgtctacctcgtcatctctaactttcgttcgcttcaa
atttgcagccctatcgcatctcctcctcttaaagatctctcgaatccggt
cggcgtcgctcttactgaaagtattacaaattgatacaatcttaatactt
gggtttagatgatgagattcctctgttcttagctcacaatcgccttcagc
attgtcgacaacagtacttgcaccactatcactggtttgacttggtaaac
tttcttttgcacttgcttgcttgttgtcacaggcaacggatgaaacaata
ttcaaactttggttctggtcagattcctctgttcttggctgacccgtacc
actgccatcctcaacaccaccacttgcgccatcatcacttgttcgatgtg
ggaaaacttctttcacacaatcttggctggcacaattgtccattgatttg
ctaactttactactctcagctccagcaccagactgagtaccaactgatgc
actcaaggtgcatgattgcgtcattgcgttcccagctaaagaagcagata
gactggccctctcatgtcttgacgataaagctcgtcttttgtcttgctct
aacaacctgaccatctgctgagtgacctctgaaaattttgggggtagagc
ttatttttagccacaataattatgcacacatcaaggcaatggaagataac
cgtcccaaatatatatatttaggtaaaaagaaaaagagggttatgaacaa
ccatgcatttaatgttcgagaaacgttccaataagcttccgtcatttata
tttattatataagagggaaaaaacagggtaaggttaatgagggtgatttg
aaaaaaaaagttccgccatgaacaatgtgtaccacttttaaatattgtag
ggagtatataagaaccacagccaggcttttaattatcaactatagttcct
gttcattaaaatataatgaccatgagtaagaattaaagctgacacatgta
aagatagaaagatatatgtagtacaaaccttgtaactgtttaggtgaaat
atcaaattccaaccaccatacttttcccttctccattggaagcttaactt
tttgaaatttagcagcaagacacatggaaccagctgcaatgtaatggggt
ttgtattgcaagcacaaggttgtacgaagcctgctagttcaattcatgtt
aggttaatatcataaagacataaggaaatgatccaaaataattcaacata
gcataaagataagtagtttgcttaaaatgaactagctggcaagttctcac
caatcattcacaaaattccatgccacttttaagaggttcggaaaaatttc
caatctcttcacagctgcaacaagggacttgtaagggagttcgatatcaa
gatcgaaagcaatcgttgccaacaaaagcctctccccagtcaagatcaat
tccttctgcttatcataaacttcctgcatgccaaaagtggtaaaaacatt
aggcaagcaagatattgagaaggcacgtagttcagctgaggtgagggaat
cgacattactctttgtctgattcttcctggagcagaaggatcccgtttat
agataatttcatagcccacaacaataacatcccgcagcaagcgtggtgtt
tcctctattttgcatgcaagaaatgtgcttacagttgcaatggtctgcag
aattcaccaatatgttcagaaaagagaaaaccaagccagctaggtttgaa
caatttaatatacactttctctttgaatgaaaactactaaatatccaaaa
ataagaaatagcatgtgatgatattatgtgtataatccttcatttcttat
atgaattcagtgatttctgcttccaaagaatgcagataactggtctcgtg
aaaagtacataatcattgcatcttttccctattagcgctcatgtccatta
atacatggttccatatttagaatgagaaagatgcaagtacgcattaaaac
agtggaatacaattaaagcatctacctgccaatcattctttgcatgggat
tggcgcatgtgaaatcggtgacacagcatcattgcacatgctattgctac
ttgaggcctgcaagtaaatttttcaatcaccaattaaaaaaatgttacac
gtaacgaaagctaatgcttcaaaagcaatatgcaaaacaacttgagaact
acaaaactaagggcctaattggtgatatattggaaagcaattagcatctc
atcaagttagtaaagaacttcaaaataggcacagcccctgcacttacact
ttaagcttcattccaagctcttgaagaaaagaacaatacgacttccgcaa
ctgctcctctcttccaaggtcgattccgtccttcctagatggagaatggt
tctcaatttcttctcggctgaagtaccacttgcgcatagatgaatgcggc
tgctctggtaaacacatgctagctgcacaagttgaatccatgtgcggcag
ttttgccgtaactacaataaaagttaaacaagcagctcaatacaaacaat
gatcttatcataaattttacctctctgttaaaccaagagaacccaagtaa
aattaaaacagcatatcatgatagcaaataatacatcaatagagttacca
taattaaaaaacaaaaaatttctctgattcttaaaagggttcttttgact
aaaagagaaggttttagttctaaagagaaatcaaacaattccttcaagga
aattaaagtctaaacctgaattatcctagcatttaatgaattgtagctaa
aattgggggggggggaagaataatgaacaaatctaattcaaattctcggc
cggagaaggaactttctaaattgggttaaaacaacaagaatttaaacgtt
tgttacctaattcacgacaaacataattaaaaattgacgcaaaacacaga
aaatatatatatcaataagcaataaaagcaatctgggaaaaacgaaaaat
agaaagggggaaaaccccaaaagagaaatcacctgaggaaaattagaaaa
gaaaaataaaataaagaattttggtagtaaaaccctaattttccgttgcc
tttgaattgggtttccaggcaaaatactttgagcagagttgactcttggt
ttttaagttctttttcctttaatttctttaatactaaaagcgtagcttgg
cagctaagcatgcgcgtgaagtgtgttctgcaagcgcgtgcattcgtacc
taagttggaatctaatccaggattctgattctaaattctactcgcctaag
cctatggcgtgcatcccatcaaacttcaaattcttcaatatatcttatta
ataaaattagttttttaattattaagttaacaattaataatcagggagta
gttagctgggtgatccatattttttagttgatttttctctactcttaaaa
tattatgacaagaagaagctgattacgaaaagtaaaaaaaaaaaaacaaa
gctaccaccattctggatgaaagagtagatcataggagaattggagtgtg
tatccagttggatagacaagtctggtagaaagatcatttagttacccata
cgttttcaaaatctaatccaaaaaatattataatctttaagaatgaaaaa
agagaaaatcgaaattcatcgtgttgttccaatagggtcggaagcgtgta
aattattgtactaaaaaaaccacacaaagttcaattcccaggaaagagag
gtggatcacatggatctcttaaataccaagtctttccttagacagaatat
cccttctatagtaatttaatagcacaattaaatactactattataccctc
aaatattgaaagaaaaataggacaagaaagaacacaagagttttaacgag
gttcggtaaattatacctacgtcctcgggcactaacaccagatgataact
ttactatctccaaagtattacaaacaaatagaattccttaagaattctca
aatgggagaaaagagaaaactaagagagagattggttgggatgaattgaa
atgagaaatgagaaggcctatttatagttgaggtttaaggaccaaacaat
aaatagcccattatctcaaggaccaaaaaaaaattatcccatgccacttt
ttcaaagtcaactttagggtgctaaacttgcaccactttatattgtttgc
cattaatgttgtctcccattaatattaacaatctctaccttgaagatttg
attaggataatcacatcttcacacacttccttcaactccccaaattcgat
aaagctatcttttgtagtgcctacaaatgcactctcgagcgccatacacc
tgaaggtgctcaaattctcaggatgttaatcaagttcaaacaatgattaa
acttgattgttgttaccaccttggtcatcatatctgcgggattatctgct
gtcggaatcttctgaagtagaatttttcctttttcaaagacttcccgcac
aaagtgatatcttacgtcgatatgcttggttcttgaatgatagacttgat
ttttcgctaaatgaataacgctctgactgtcacaatataaacttatgtga
ctttgaacaactcctaagtctttcaacaatccattaagccaaatagcctc
cttaacagcttctgtaactgccatatattctgcctctgtagtagacacag
ctactgtagactgtaaggtagacttccaactcactggggctttcgcaaga
gtaaacagataccccgtagttgaacgacgtttatataaatcaccagcaaa
gtcggaatcaacatatccaactacaaattgaccaagtgcttcatcctgtt
caaaaattaaaccaacatctacggtttttcgaagataccgtagaatccat
ttcacagcttgccaatgtccttttccaggatcatgtatatacctgctcac
aactccaacagcttgtgaaatgtcaggcctcgtacacaccatcgcataca
tcaaactcccaactgcattagcatatgggactttcgccatatattctctt
tcttcttcagttttcggagataattgagcactaagtttcaaatgagaagc
aagtggggtacttacatgttttgtgttttcatttacaccaaaacattgta
atacctttttcagatattgcttctgatttaaacagagtttgcctctcggt
ctatctctacttatctccatgccgagaatcttcttggcctcacctagatc
tttcatctcgaactcttgattcaactgagccttcagcttatctatctcat
tttggctcttcgaagcgattaacatatcatcaacatacaagagtagataa
atgaaagatccgtcatgcagcttctgtaaatatacacaattgtcatattt
gcttcttgtgtacttctgccttctcataaagctatcaaatcgcttgtacc
actgcctcggggattgcttcaatccatatagcgatttgttaagcttacaa
acccaatttctaccaccagcatctgtgtatccttctggctgagtcatata
gatctcctcttctaactcaccatgcaagaaagccgtcttaacatcaagtt
gagctagctccaaattcaactgtgctaccaaggccaacaaaattctaatg
gaggaatgcttcacaacaggggaaaatacatcattgtagtcaattccctc
cttctgagcgtagcctttagctaccaatattgccttgtagcgaatatcct
tcttgctaggagatccatctttctttgcgaatacccacttgcatccgatt
gcccttttacctttcggtaattgcgccaactcccaagtattgttcttccg
gagagactgcatttcttcatccatggcgcttttccatttatcactttcta
agctttgcattgcttcttgataagtgataggaatatcatcaacaacggga
agggcgtaggccaccatatcagtaaatcgagtaggtttacgaatttctct
ccatggccttgcaactgcaactggttctggtgtacttagtggttcttggg
tcagaacctcttcaacctctaattcctccattgtgactagagaattagac
ttattaactgggcaaatccccatctgctcaaactccacctgttttggagt
acactccacctgctgtggagtattgctcgtctgaatatctttttctgcta
cctttttcaatgtggcagattcatcaaaggtaacatctctgctacagatc
attttctttgtgcttaagcaccaaagacgaaatcccttcactccagaagt
gattcccataaagagagctttctttgccatcggatctaactttgactcct
tcacatggtaatatgcagtggttccaaacacatgtaaggaatcataatct
gtagccggttttccagaccatacctccataggagtttttatttctaatgc
agatgatggcaaacgattaacaagatggccagcgtatgtcacagcctcag
cccaaaattgcttgcccaacccagcattggacaacatatatcgaactttc
tccagcaatgttcgattcatacgctctgccactccattctgttgtggtgt
atccctaactgtgaagtgtcgaacaataccatactcttggcacacatcga
agaacggatcacttttatattcccctccattgtccgtcctaagccgcttg
attttcttgccagtctggttttttatcatactttccccaaaaaagacaaa
cctccaacccttcacctttactttccagggtatacacccaaactcttctg
gaaaagtcatcaacaaaagtaaacaaagtagtgttttcctcccaatgaag
gtgtcttggaaggcccccacacatctgagtgaacatattccaaaatacct
tttgtattatggatagcagtaccgaatttcactctcttttgtctttccca
gaacacaatgctcgcaaaattttaatttgcaagcctttgcacctttcaac
aatccttgctttgccagaatttgcaaggatttttcgctggcatgtcccaa
cttcatatgccacaactgcattgagtccaattctttgttaccggaagctg
tagcgactgctccaataactgtactaccttggtagtaatacaagttattt
ttcctgatgcccttcaatatcacaagtgcgccagatgtcactttcaaaat
cccatctctcatagtaacaactgaaccattggattccaaggctcccaatg
agatgagatttttcttcaaactgggcacgtaccgaacatcagtcagaact
ctggttgatccatcttgattcttttaattggattgaacctatcccaacag
ttttacaggcattgtcattgcccatataaacaactcctccatttagttct
actaaatcagagaaccactcccggttaggggacatatgataggtacaacc
cgaatccaacatccactcatctgaatggaacgacgatgatgatgcaacca
gtgatagttcagagtcactagtatcatgcttagcaacacaagcatctaca
gcagcttttcccttattcttcagctttggacaatttttcttccagtggcc
tttctcatgacaaaaagcacattcatctttcccgagtctggactttgact
ttgatctccccttttgagttttcttccgagtgtatgaacgacctcggact
actaaagcttctgtatctctgattgagtttttctgtttgtccttctttct
ctgttcataactgtataaggccgcacagacttcgctcagagatatatcac
tcctgccatgaagtagagtagtttctaggaactcaaactcctcaggaagt
gaccccaacagcatcaaagccaaatcttcatctttgaatgtctcatccat
attcagcaaatcagtgactgactgattaaatttggtgatgtgatcattca
ttgtggtacttgggacgtatgtgaagcgaaacagtcttttcttcaagtgg
agcttattttgactgtttttctttaaaaaattttcttcaagtgccaccca
caacttatttgcagaagtctcctttgaaaaagcatacctctgctctcgag
aaaggcatgatcgaattgtgccacatgccaaccgattgatcacctttcaa
tctttctcctgtacatcatctggtttctcttcatcaatggcaatgtctag
accctgctgaaaaagggcatctagaacctcactttgtcacataccaaaat
ggcccgtgccatcaaagatctccacggccaatcttgcatttgcaattgtc
ggtcttgtccacatggacgatgttgaagctcctacaccgaccgttttctc
cataatctttcaatatacctaaggaaatcttttctgatgtggaagatcag
tttaaactgcaaccacagagcatactacgattaaccttcggctcttgata
ccac
back to top