AF419970

Overview
NCBI AccessionAF419970
VersionAF419970.1
Typeregion
SpeciesGossypium anomalum
StockB1-1
Publication[view all]
Germplasm
Stock NameType
B1-1wild_unimproved
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Sequences
The following sequences are available for this feature:

region sequence

>AF419970.1 ID=AF419970.1|Name=AF419970|organism=Gossypium anomalum|type=region|length=1076bp
gtggtngaacatgttgggttgaatgttaatggtgaaccctttgtggcttg
ccatgaatgtaatttccctatttgtaagagttgttttgagtatgatctta
aggaaggacgaaaagcttgcttgcgttgtggtantccatatgatggtaca
tttcattttaactcttgatactagttttttacttgtttccatttggttct
tgataaatctttgttataaatcttgtgtttgccaagtgcttgtttgattt
cccatgaaaaagataaagatagagaagttgtaaactgattgcacgactga
ttattgtgaactcctcanaaaacctgttggacgatgtcgaaaaggccacc
ggcgatcaatcgacaatggctgcacatttgagcaagtctcaggtattgtt
ttcttgctgcctttgaaaggttcagtcaaagccagagggatattgagagc
tttgtgttattcatgttggtttatacaggatgttggaattcatgcaagac
atatcagcagtgtgtctacattggatagtggtatgtaatataaatttctt
tccatactattggtttctttctttcaatcttccttcaattctgaaagctc
gaatcgtctcgtaaaatatcgtagaaatgactgaagacaatgggaatccg
atttggaagaacagggtggaaagttggaaagaaaagaagaacaagaagaa
gaagcctgcaacaaccaaggttgaaagagaggctgaaatcccacctgagc
aacaaatggaagataaaccgtaagtatttaattagaaaagccttgcttga
ttttgaagtatacaaagcagattaatgataagagcctatttagtgaaatg
atttttgtttatgttatgtgttactgatatgtaatatttgcacctgcagg
gcaccggatgcttcccagcccctctcgactataattccaatcccgaaaag
cagacttgcaccataccgaaccgtgatcattatgcgattgatcattctcg
gtcttttcttccattatcgagtaacaaaccccgttgacagtgcttttgga
ctgtggctcacttcagtcatatgtga
back to top