SWU01713

Marker Overview
NameSWU01713
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Primer 1SWU01713_F: CGTGGATTATCATTGCATCC
Primer 2SWU01713_R: TGAAATTGTGAGAAACCGCA
Publication[view all]
Commentprimer in pub 21975 TbS1
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU01713_FSWU01713.SWU01713_FGossypium hirsutumprimer
SWU01713_RSWU01713.SWU01713_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU1713SWU1713Gossypium hirsutummarker_locus


Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x TX-41, F2 (2020)CT-F2_chr21N/AAD_chr.21146.3SWU1713View