SWU16259

Marker Overview
NameSWU16259
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(TC)11
Primer 1SWU16259_F: CGATTGTCAATGTGTCCCTT
Primer 2SWU16259_R: CTAATGAGCTTTTCGCCGTT
Publication[view all]
Commentprimer in TbS1
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU16259_FSWU16259.SWU16259_FGossypium raimondiiprimer
SWU16259_RSWU16259.SWU16259_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU16259SWU16259Gossypium raimondiimarker_locus


Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-35 x TX-41, F2 (2020)CT-F2_chr21N/AAD_chr.2176.7SWU16259