SWU16136

Marker Overview
NameSWU16136
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(AG)10
Primer 1SWU16136_F: ATCTAGCACTTGCCCACCTT
Primer 2SWU16136_R: ACTTGGAGGTCATCGGTACA
Publication[view all]
Commentprimer in TbS1
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU16136_FSWU16136.SWU16136_FGossypium raimondiiprimer
SWU16136_RSWU16136.SWU16136_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU16136SWU16136Gossypium raimondiimarker_locus


Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x TX-41, F2 (2020)CT-F2_chr21N/AAD_chr.2172.1SWU16136View