X75423, X75423.1 (region) Gossypium hirsutum

Overview
NCBI AccessionX75423
VersionX75423.1
Typeregion
SpeciesGossypium hirsutum
LibraryUni-Zap
Publication[view all]
Sequences
The following sequences are available for this feature:

region sequence

>X75423.1 ID=X75423.1|Name=X75423|organism=Gossypium hirsutum|type=region|length=449bp
caccattctaaagaggtcatcgtaaattcgagtacaaagcgctaaccgag
atgagagccaagtggaagaagaagcgtatgaggaggctgaagaggaagcg
ccgaaagatgagacagagatccaagtagatgcgccttggactgaattagt
tttgccctgacaatcccttgtcttcataattatcctgcatatgttgcatg
aagttgtgaagattgaagggtattttcaggcaaaccttatctgttttgtc
ttctatatctcggttaaagttttaagactgtttgagatgtttgtctagta
ctattagatattatgttggggatttgtggtttgatctgtgtaagcagtta
tcttaacatcctaaatgtttgaaattgaaacttttgttcttcttatatcg
gtctataatatgcgagatagattgtttccttaaaaaaaaaaaaaaaaaa
back to top
Libraries
Library NameType
Uni-ZapcDNA
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2019-03-14