X75954, X75954.1 (region) Gossypium hirsutum

Overview
NCBI AccessionX75954
VersionX75954.1
Typeregion
SpeciesGossypium hirsutum
LibraryUni-Zap
Publication[view all]
Sequences
The following sequences are available for this feature:

region sequence

>X75954.1 ID=X75954.1|Name=X75954|organism=Gossypium hirsutum|type=region|length=658bp
aaccaaatatggcggagaaagcaatcgagtcggttcaatgctttggccgg
aagaagacggcggtagccgtaacacactgcaagagaggccgtggtttgat
caagatcaatggttgtcccattgagcttgtcgagcccgagatcctccgtt
tcaaggccgtcgagccaatccttctcctcggccgtcagcgttttaccggc
gttgacatgaggatccgagtcaaaggtggaggtcacacttctcagatcta
cgctatccgtcaaagcatcgctaaagcccttgtcgctttttaccagaagt
acgttgatgagcagagcaagaaggagattaaggatattttggtcgggtac
gataggactttgctggtcgctgatcccaggaggtgcgagcctaagaagtt
tggtggaagaggtgccagggcaaggttccagaagagttaccgttgaagaa
ctgtcatggttcgttttgatgttgttcttagtgaaatgatatggttatgc
ttgttttgaattaaggttttattatatggatttaaattagctgtgactga
gtttctgaatttttggatgtttgttttggttgcttaaatttatagataaa
tgcttaagactgttattgccttttttaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaa
back to top
Libraries
Library NameType
Uni-ZapcDNA
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2019-03-14