GBU31113, U31113.1 (region) Gossypium barbadense

Overview
NCBI AccessionGBU31113
VersionU31113.1
Typeregion
SpeciesGossypium barbadense
LibrarypXP
Publication[view all]
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2019-03-14
Libraries
Library NameType
pXPgenomic
Sequences
The following sequences are available for this feature:

region sequence

>U31113.1 ID=U31113.1|Name=GBU31113|organism=Gossypium barbadense|type=region|length=464bp
aggacctcaaccaccgataggacattcatgactagcacccaaaattcgag
ctccctaatgacatgtcatttgtatcttaagaattcttaaggttcaacca
agactcaatatctgtcaactcatcacagccattgatatgttcatatatat
cgatccatctacatcacacataacataataaaatctactataaataccat
aacccacgataaccatacatagaaactccaccccgatgactatgggtgta
gtagttaggttgatctactccaaagctctcacttttaccttgatctacgt
gtgcccatggtttatcttggacctaaatagattatttatattcaaattaa
atactttcagccggacctcaataattttcaattcactccataattcacat
ctatgcaatctttactcaactcgggcactaactatcttacctcaacagaa
ttttgaccttaatg
back to top