psbK, NC_023215.1-psbK.m5 (mRNA) Gossypium herbaceum

Unique NameNC_023215.1-psbK.m5
OrganismGossypium herbaceum (Cotton (G. herbaceum))
Cross References
External references for this mRNA

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
psbKNC_023215.1-psbKGossypium herbaceumgene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
psbKpsbKGossypium herbaceumgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
NC_023215.1-psbK.m5-cds1NC_023215.1-psbK.m5-cds1Gossypium herbaceumCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
psbKNC_023215.1-psbK.p5Gossypium herbaceumpolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2019-03-14
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
NC_023215regionNC_023215:7314..7499 +
Property NameValue
Productphotosystem II protein K
The following sequences are available for this feature:

mRNA sequence

>NC_023215.1-psbK.m5 ID=NC_023215.1-psbK.m5|Name=psbK|organism=Gossypium herbaceum|type=mRNA|length=186bp
back to top

protein sequence of psbK

>NC_023215.1-psbK.p5 ID=NC_023215.1-psbK.p5|Name=psbK|organism=Gossypium herbaceum|type=polypeptide|length=61bp
back to top

mRNA from alignment at NC_023215:7314..7499+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>NC_023215.1-psbK.m5 ID=NC_023215.1-psbK.m5|Name=psbK|organism=Gossypium herbaceum|type=mRNA|length=186bp|location=Sequence derived from alignment at NC_023215:7314..7499+ (Gossypium herbaceum)
atgcttaatatctttaatttgatctgtatctgttttaattctgccctttt ttcgagtagttttttattcgccaaattgcccgaggcctatgcttttttga atccaatcgtagattttatgccagtaatacctgttctctttttgctctta gcctttgtttggcaagctgctgtaagttttcgatga
back to top

Coding sequence (CDS) from alignment at NC_023215:7314..7499+

>NC_023215.1-psbK.m5 ID=NC_023215.1-psbK.m5|Name=psbK|organism=Gossypium herbaceum|type=CDS|length=186bp|location=Sequence derived from alignment at NC_023215:7314..7499+ (Gossypium herbaceum)
back to top