nau0837, nau0837 (genetic_marker) gossypium spp

Marker Overview
Namenau0837
AliasNAU837
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Primer 1NAU837_F: AACCAGCCAAATTTCATCAC
Primer 2NAU837_R: GATCCACGCCAACAAGTAA
ContactZhang, Tian-Zhen
Guo, Wang-Zhen
CommentPrimer data obtained in 2013-02
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU837_FNAU837_FGossypium hirsutumprimer
NAU837_RNAU837_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
nau0837nau0837Gossypium hirsutummarker_locus
NAU837-205NAU837-205Gossypium spp.marker_locus
NAU837NAU837Gossypium hirsutummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Guo, Wang-Zhen
First name:Wang-Zhen
Last name:Guo
Institution:Nanjing Agri Univ
Address:Weigang No.1, Nanjing, Jiangsu Prov 210095
Country:China
Email:moelab@njau.edu.cn
Phone:+086 25 84395311
Fax:+086 25 84395307
Keywords:Cotton Genomics
Last update:20-Sep-2011
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr06N/AAD_chr.06203nau0837
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr25N/AAD_chr.2526.1nau0837
3TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr06N/AAD_chr.0646.4NAU837-205
4TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr06/A6N/AAD_chr.06107.86NAU837-205
5PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr06-2N/AAD_chr.0611.3NAU837
Image
File NameLegend
45_FISH_GEN-178-1117_fig2.jpgBAC clones and their corresponding genetic markers of the 22 probes according to FISH signal patterns in Figure 1. [Image from Wang et al., 2008, GEN-178-1117]
48_FISH_TAG-115-675.jpgTwenty-six individual cotton mitotic chromosomes with FISH signals derived from the chromosome-speciWc BACs, and comparisons of linkage and FISH maps. [Image from Wang 2007, TAG-115-675]