HAU4552 (genetic_marker) Gossypium barbadense

Marker Overview
NameHAU4552
Genbank IDN/A
TypeSSR
SpeciesGossypium barbadense
Repeat Motif(CATA)5
Primer 1HAU4552_F: TTCCTTTGCTTGTTCCCAGC
Primer 2HAU4552_R: ACAAGACAGGGCCAGTTTCAG
ContactLin, Zhong-Xu
CommentPrimer data obtained 2/12/2014
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU4552_FHAU4552_FGossypium barbadenseprimer
HAU4552_RHAU4552_RGossypium barbadenseprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber lengthqUHML.MAGIC-19831_ch15.zk14.2Gossypium spp.QTL
short fiber contentqSFC.MAGIC-19831_ch01.zk15Gossypium spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU4552HAU4552Gossypium barbadensemarker_locus
HAU4552bHAU4552bGossypium barbadensemarker_locus
HAU4552aHAU4552a-197.1Gossypium barbadensemarker_locus


Contact
NameDetails
Lin, Zhong-Xu
First name:Zhong-Xu
Last name:Lin
Address:shizishan 1, wuhan, hubei 430070
Country:China
Email:linzhongxu@mail.hzau.edu.cn
Phone:+86 027 87283955
Last update:5-Mar-2007
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.01159.12HAU4552View
2DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.15159.12HAU4552View
3DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr01N/AAD_chr.010HAU4552View
4DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15N/AAD_chr.150HAU4552View
5MGG-293-793, MAGIC (2018)MAGIC-19831_chr01N/AAD_chr.010HAU4552bView
6MGG-293-793, MAGIC (2018)MAGIC-19831_chr15N/AAD_chr.15197.1HAU4552aView