NAU6664, NAU6664 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU6664
Genbank IDAC190263
TypeSSR
SpeciesGossypium hirsutum
GermplasmAcala Maxxa
Acala Maxxa
Source Typegenomic
Repeat MotifTAT(12)
Primer 1NAU6664_F: TTAATTTGTGACGCGAACTC
Primer 2NAU6664_R: CACCAACTCGATTACGAAAA
Publication[view all]
ContactZhang, Tian-Zhen
Germplasm
Stock NameType
Acala Maxxacultivar
Acala Maxxacultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAC190263
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU6664_FNAU6664_FGossypium hirsutumprimer
NAU6664_RNAU6664_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU6664NAU6664Gossypium hirsutummarker_locus
NAU6664-200NAU6664-200Gossypium hirsutummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr16N/AAD_chr.1638.3NAU6664View
2H16 x T586, F2sel (2009)H16T586-F2sel_chr16N/AAD_chr.1682.7NAU6664View
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr16N/AAD_chr.1680.9NAU6664View
4TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.1679.85NAU6664-200View
5H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.1679.6NAU6664-200View