NAU6434, NAU6434 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU6434
Genbank IDAC187810
TypeSSR
SpeciesGossypium hirsutum
GermplasmAcala Maxxa
Acala Maxxa
Source Typegenomic
Repeat MotifTA(10)
Primer 1NAU6434_F: GACATGACAAAGGTTCACGA
Primer 2NAU6434_R: GGTTCAATAACTCACTTATGATGG
Publication[view all]
ContactZhang, Tian-Zhen
Germplasm
Stock NameType
Acala Maxxacultivar
Acala Maxxacultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU6434_FNAU6434_FGossypium hirsutumprimer
NAU6434_RNAU6434_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU6434NAU6434Gossypium hirsutummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1W10 x TM-1, F2:3 (2015)WT-F2:3_chr02-1N/AAD_chr.02146.9NAU6434View
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAC187810