NAU6367, NAU6367 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU6367
Genbank IDAC187473
TypeSSR
SpeciesGossypium hirsutum
GermplasmAcala Maxxa
Acala Maxxa
Source Typegenomic
Repeat MotifAAATGT(3)
Primer 1NAU6367_F: CCTCGAGCCCAAAACTATAA
Primer 2NAU6367_R: TCCAACCTTTCTTGGGAAT
Publication[view all]
ContactZhang, Tian-Zhen
Germplasm
Stock NameType
Acala Maxxacultivar
Acala Maxxacultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAC187473
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU6367_FNAU6367_FGossypium hirsutumprimer
NAU6367_RNAU6367_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU6367NAU6367Gossypium hirsutummarker_locus
NAU6367aNAU6367aGossypium hirsutummarker_locus
NAU6367bNAU6367bGossypium hirsutummarker_locus
NAU6367NAU6367-58.508Gossypium hirsutummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Prema x 86-1, RIL (2015)P8-RIL_chr15.2N/AAD_chr.1514.33NAU6367
2GX1135 x GX100-2, F2 (2013)GG-F2_chr01N/AAD_chr.0161.2NAU6367
3GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-1N/AAD_chr.01116.3NAU6367
4Yumian-1 x T586, RIL (2015)YT-RIL.15_chr15N/AAD_chr.1566NAU6367a
5Yumian-1 x T586, RIL (2015)YT-RIL.15_chr08N/AAD_chr.0857.9NAU6367b
6CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.0158.51NAU6367