NAU1093, NAU1093 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1093
Genbank IDBM360270
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(TA)14
PCR ConditionAnnealing temperature: 57
Primer 1NAU1093_F: TGTGATGAAGAACCCTCTCA
Primer 2NAU1093_R: AAATGGCGTGCTTGAAATAC
Product Length174
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBM360270
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1093_FNAU1093_FGossypium arboreumprimer
NAU1093_RNAU1093_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1093NAU1093Gossypium arboreummarker_locus
NAU1093NAU1093-42.4Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_A06-1N/AAD_chr.0642.4NAU1093
2PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr06-1N/AAD_chr.060NAU1093
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr06N/AAD_chr.0663.2NAU1093
4TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr06N/AAD_chr.0658.6NAU1093
5GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr06N/AAD_chr.0635.1NAU1093
6GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr06N/AAD_chr.0681.2NAU1093
7CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr06N/AAt.0665.2NAU1093
8CCRI-36 x G2005, RIL (2016)CG-RIL_chr06N/AAD_chr.0631.08NAU1093
9(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_A06-1N/AAD_chr.0642.4NAU1093