CER0024, CER0024 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCER0024
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Source TypeEST
PCR ConditionAnnealing temperature: 55
Primer 1CER0024_F: TCACTCTCACCCCTTTCTTCA
Primer 2CER0024_R: ACCCTTTTGGCTGCTCCTAT
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CER0024_FCER0024_FGossypium hirsutumprimer
CER0024_RCER0024_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MON_CER0024MON_CER0024Gossypium hirsutummarker_locus
CER0024CER0024Gossypium hirsutummarker_locus
CER0024CER0024-97.555Gossypium hirsutummarker_locus


Contact
NameDetails
Monsanto
Country:United States
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr01-2N/AAD_chr.01144.8MON_CER0024
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr01N/AAD_chr.010CER0024
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr01N/AAD_chr.0121.5CER0024
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.0197.56CER0024