USDA_CFB0787, USDA_CFB0787 (genetic_marker) Gossypium hirsutum

Marker Overview
NameUSDA_CFB0787
AliasCFB0787
i22085Gh
dbSNP IDN/A
SNP Array ID
TAMU_CottonSNP63K:i22085Gh
TypeSNP
SNP AllelesC/T
5' Flanking SequenceCGACTTCATCGATTAATTATGTACACGTCTTTAAGGTGCATACTCTCTCCA
3' Flanking SequenceCAACCGAGACACTCCTACTCCATGAACCTTCAGAA
SpeciesGossypium hirsutum
Publication[view all]
ContactFang, David D.
Stelly, David M.
CommentSNP generated in Data2Bio, LLC, Ames, IA
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNPi22085GhSNPi22085GhGossypium hirsutummarker_locus
i22085Ghi22085Gh-20.54Gossypium hirsutummarker_locus
i22085Ghi22085Gh-16.5Gossypium hirsutummarker_locus


Libraries
Library NameType
TAMU_CottonSNP63KSNP_chip
Contact
NameDetails
Fang, David D.
Description:Molecular markers, fiber development
First name:David
Last name:Fang
Title:Supervisory Research Geneticist
Institution:USDA-ARS-SRRC-CFBRU
Address:1100 Robert E. Lee Blvd, New Orleans, LA 70124
Country:United States
Email:david.fang@usda.gov
Phone:504 286 4527
Fax:001662686-5218
Keywords:Structural Genomics
Last update:2-Jul-2009
Stelly, David M.
Description:Integrative structural genomics; Cytogenetics; Genetics; Cytogenomics; Radiation hybrid mapping; Chromosome manipulations. ; Wide-cross introgression.; QTL definition. ; Reproductive cytology, genetics and manipulations. ; Fiber cell initiation.
First name:David
Last name:Stelly
Title:Professor
Institution:Texas A&M University
Address:370 Olsen Blvd. , Dept. Soil & Crop Sci., TAMU, College Station, TX 77843-2474
Country:United States
Email:stelly@tamu.edu
Phone:+1 979 845 2745
Fax:+1 979 845 0456
Last update:19-Feb-2007
Sequence
>USDA_CFB0787 ID=USDA_CFB0787|Name=USDA_CFB0787|organism=Gossypium hirsutum|type=genetic_marker|length=91bp
CGACTTCATCGATTAATTATGTACACGTCTTTAAGGTGCATACTCTCTCC
A[C/T]CAACCGAGACACTCCTACTCCATGAACCTTCAGAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Phytogen 72 x Stoneville 474, consbin (2017)PS-consbin_ch01N/AAD_chr.0119.15SNPi22085GhView
23-79 x TM-1, F2 (2015 SNP)3T-F2_c01N/AAD_chr.0120.54i22085GhView
3Phytogen 72 x Stoneville 474, F2 (2015 SNP)PS-F2_c01N/AAD_chr.0116.5i22085GhView