UCD_Gh_M_005827, UCD_Gh_M_005827 (genetic_marker) Gossypium hirsutum

Marker Overview
NameUCD_Gh_M_005827
AliasGh_M_005827
Tm1_Mira454_Contig_24364_1212
Gh_M_005827_Class_I
i00511Gh
dbSNP IDN/A
SNP Array ID
TAMU_CottonSNP63K:i00511Gh
TypeSNP
SNP AllelesC/T
5' Flanking SequenceCCTCTGACCCATGAGGAGGAAGTGCAAGAAGCTCCGCATGCTTCTTTTTCTTTTCTTCCT CTGTTTCAAAATCATCCATCCCCTCATTAGCATCAGAGCC
3' Flanking SequenceTTGTGGAAATCAACAAGCTCAGCATCCTCGTCCTCTTCTTCTTCTACTTCCACTTCCTCT TCTACCTCTTCCTCAACTTCCACTTCCTCCTCTTCCTCTA
SpeciesGossypium hirsutum
GermplasmAcala Maxxa
PD-1
Sealand 542
Fibermax 832
TM-1
Source TypeRNA
Publication[view all]
ContactAshrafi, Hamid
Stelly, David M.
Commentclass_I: no only SNPs derived from contigs with no known homeo-SNP positions in the contig within our data set
Germplasm
Stock NameType
Acala Maxxacultivar
PD-1cultivar
Sealand 542breeding_germplasm
Fibermax 832cultivar
TM-1breeding_germplasm
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNPi00511GhSNPi00511GhGossypium hirsutummarker_locus
i00511Ghi00511Gh-21.4Gossypium hirsutummarker_locus
i00511Ghi00511Gh-19.8Gossypium hirsutummarker_locus


Libraries
Library NameType
TAMU_CottonSNP63KSNP_chip
Contact
NameDetails
Ashrafi, Hamid
First name:Hamid
Last name:Ashrafi
Title:Bioinformatics Specialist
Institution:University of California
Address:1 Shields Ave, Davis, CA 95616
Country:United States
Email:ashrafi@ucdavis.edu
Last update:24-Aug-2014
Stelly, David M.
Description:Integrative structural genomics; Cytogenetics; Genetics; Cytogenomics; Radiation hybrid mapping; Chromosome manipulations. ; Wide-cross introgression.; QTL definition. ; Reproductive cytology, genetics and manipulations. ; Fiber cell initiation.
First name:David
Last name:Stelly
Title:Professor
Institution:Texas A&M University
Address:370 Olsen Blvd. , Dept. Soil & Crop Sci., TAMU, College Station, TX 77843-2474
Country:United States
Email:stelly@tamu.edu
Phone:+1 979 845 2745
Fax:+1 979 845 0456
Last update:19-Feb-2007
Sequence
>UCD_Gh_M_005827 ID=UCD_Gh_M_005827|Name=UCD_Gh_M_005827|organism=Gossypium hirsutum|type=genetic_marker|length=205bp
CCTCTGACCCATGAGGAGGAAGTGCAAGAAGCTCCGCATGCTTCTTTTTC
TTTTCTTCCTCTGTTTCAAAATCATCCATCCCCTCATTAGCATCAGAGCC
[C/T]TTGTGGAAATCAACAAGCTCAGCATCCTCGTCCTCTTCTTCTTCT
ACTTCCACTTCCTCTTCTACCTCTTCCTCAACTTCCACTTCCTCCTCTTC
CTCTA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Phytogen 72 x Stoneville 474, consbin (2017)PS-consbin_ch01N/AAD_chr.0121.7SNPi00511GhView
23-79 x TM-1, F2 (2015 SNP)3T-F2_c01N/AAD_chr.0121.4i00511GhView
3Phytogen 72 x Stoneville 474, F2 (2015 SNP)PS-F2_c01N/AAD_chr.0119.8i00511GhView