HAU1619, HAU1619 (genetic_marker) gossypium spp

Marker Overview
NameHAU1619
Genbank IDAY887895
TypeSSR
SpeciesGossypium spp.
Source SequenceAY887895
Source TypeEST
Repeat Motif(AT)7
PCR ConditionAnnealing temperature: 56.6
Primer 1HAU1619_F: AAAAACAATGGAAACGGTGT
Primer 2HAU1619_R: CTTGGTTTGCCAATATGAAA
Product Length188
Publication[view all]
CommentPrimer data obtained in 2012
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAY887895
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU1619_FHAU1619_FGossypium spp.primer
HAU1619_RHAU1619_RGossypium spp.primer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
micronaireqMIC.ILTM-F2:3_ch01.2011Gossypium hirsutum x barbadenseQTL
micronaireqMIC.ILTM-F2:3_ch01.2012Gossypium hirsutum x barbadenseQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU1619aHAU1619aGossypium spp.marker_locus
HAU1619bHAU1619bGossypium spp.marker_locus
HAU1619HAU1619Gossypium spp.marker_locus
HAU1619HAU1619-5.385Gossypium spp.marker_locus
HAU1619aHAU1619a-168.6Gossypium spp.marker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AY887895AY887895Gossypium spp.sequence_feature


Sequence
>HAU1619 ID=HAU1619|Name=HAU1619|organism=Gossypium spp.|type=genetic_marker|length=188bp
AAAAACAATGGAAACGGTGTCGTTTTGGATCATGATCTTGACCTCGGGTG
GGTTAATGAGCTCTTGATGTAGAGGAAGAAGATATATATATATATGATCT
GCAAAGTGTGTATATTTTATGTGTGATTGGGTTTAAAAAGATTGCTGATC
TGATGATTGTTTTAAATATTTCATATTGGCAAACCAAG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr01N/AAD_chr.0194.73HAU1619a
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr15N/AAD_chr.1531.2HAU1619b
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.010HAU1619
4IL138-A11-3 x TM-1, F2:3 (2014)ILTM-F2:3_chr01N/AAD_chr.0114.5HAU1619
5CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr15N/AAD_chr.150HAU1619
6CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.015.39HAU1619
7MGG-293-793, MAGIC (2018)MAGIC-19831_chr01N/AAD_chr.01168.6HAU1619a