TAMU_GH_TBh048G18f77, TAMU_GH_TBh048G18f77 (genetic_marker) Gossypium sp.

Marker Overview
NameTAMU_GH_TBh048G18f77
Aliasi40136Gh
GH_TBh048G18f77
dbSNP IDN/A
SNP Array ID
TAMU_CottonSNP63K:i40136Gh
TypeSNP
SNP AllelesA/G
SpeciesGossypium sp.
Publication[view all]
ContactStelly, David M.
Commentsequence data obtained from TAMU CottonSNP63K Array
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNPi40136GhSNPi40136GhGossypium sp.marker_locus
i40136Ghi40136GhGossypium sp.marker_locus
i40136Ghi40136Gh-19.69Gossypium sp.marker_locus
i40136Ghi40136Gh-15.4Gossypium sp.marker_locus


Libraries
Library NameType
TAMU_CottonSNP63KSNP_chip
Contact
NameDetails
Stelly, David M.
Description:Integrative structural genomics; Cytogenetics; Genetics; Cytogenomics; Radiation hybrid mapping; Chromosome manipulations. ; Wide-cross introgression.; QTL definition. ; Reproductive cytology, genetics and manipulations. ; Fiber cell initiation.
First name:David
Last name:Stelly
Title:Professor
Institution:Texas A&M University
Address:370 Olsen Blvd. , Dept. Soil & Crop Sci., TAMU, College Station, TX 77843-2474
Country:United States
Email:stelly@tamu.edu
Phone:+1 979 845 2745
Fax:+1 979 845 0456
Last update:19-Feb-2007
Sequence
>TAMU_GH_TBh048G18f77 ID=TAMU_GH_TBh048G18f77|Name=TAMU_GH_TBh048G18f77|organism=Gossypium sp.|type=genetic_marker|length=105bp
TTGATCCAAGCCCACCTCAACTCACTTGTTTGCCACCTCTAATTGTAAAA
[A/G]TAAAGTTAAGATAGTAAAAAAATATGTAACTTATAGTAAATTTAC
AACCA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Phytogen 72 x Stoneville 474, consbin (2017)PS-consbin_ch01N/AAD_chr.0119.47SNPi40136Gh
20-153 x sGK9708, RIL (2017)0s-RIL.17_chr01N/AAD_chr.0126.05i40136Gh
33-79 x TM-1, F2 (2015 SNP)3T-F2_c01N/AAD_chr.0119.69i40136Gh
4Phytogen 72 x Stoneville 474, F2 (2015 SNP)PS-F2_c01N/AAD_chr.0115.4i40136Gh