DOW_DASCOT_1_9, DOW_DASCOT_1_9 (genetic_marker) Gossypium sp.

Marker Overview
NameDOW_DASCOT_1_9
AliasDASCOT_1_9
i49501Gh
dbSNP IDN/A
SNP Array ID
TAMU_CottonSNP63K:i49501Gh
TypeSNP
SNP AllelesA/G
5' Flanking SequenceCTGCTTTTTCTTTGTATTCAATATACGAATAGTGTCTGTATTCCTAAGAAATTACAATGA
3' Flanking SequenceCGAATCCTTTTACTTTATAGCCGA
SpeciesGossypium sp.
Publication[view all]
ContactStelly, David M.
Commentsequence data obtained from TAMU CottonSNP63K Array
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNPi49501GhSNPi49501GhGossypium sp.marker_locus
i49501Ghi49501Gh-21.4Gossypium sp.marker_locus


Libraries
Library NameType
TAMU_CottonSNP63KSNP_chip
Contact
NameDetails
Stelly, David M.
Description:Integrative structural genomics; Cytogenetics; Genetics; Cytogenomics; Radiation hybrid mapping; Chromosome manipulations. ; Wide-cross introgression.; QTL definition. ; Reproductive cytology, genetics and manipulations. ; Fiber cell initiation.
First name:David
Last name:Stelly
Title:Professor
Institution:Texas A&M University
Address:370 Olsen Blvd. , Dept. Soil & Crop Sci., TAMU, College Station, TX 77843-2474
Country:United States
Email:stelly@tamu.edu
Phone:+1 979 845 2745
Fax:+1 979 845 0456
Last update:19-Feb-2007
Sequence
>DOW_DASCOT_1_9 ID=DOW_DASCOT_1_9|Name=DOW_DASCOT_1_9|organism=Gossypium sp.|type=genetic_marker|length=89bp
CTGCTTTTTCTTTGTATTCAATATACGAATAGTGTCTGTATTCCTAAGAA
ATTACAATGA[A/G]CGAATCCTTTTACTTTATAGCCGA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Phytogen 72 x Stoneville 474, consbin (2017)PS-consbin_ch01N/AAD_chr.0123.62SNPi49501GhView
23-79 x TM-1, F2 (2015 SNP)3T-F2_c01N/AAD_chr.0121.4i49501GhView
3Phytogen 72 x Stoneville 474, F2 (2015 SNP)PS-F2_c01N/AAD_chr.0121.4i49501GhView