NAU_TM00361, NAU_TM00361 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU_TM00361
AliasTM361
dbSNP IDN/A
SNP Array ID
NAU_CottonSNP80K:NAU_TM00361
TypeSNP
SNP AllelesG/A
5' Flanking SequenceCTCAAAGCTTGAGCTGGAAAAGCTATAAAATTGTCCGCCAGTTGGAATCACACCCTGCAA
3' Flanking SequenceTGATTATATGCCACGCTAAATTTTGACAAAAATGTAAGCTCGGCAAATGACAGCGGAATT
SpeciesGossypium hirsutum
Publication[view all]
ContactGuo, Wang-Zhen
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.LX-RIL_ch01.15ALEGossypium hirsutumQTL
fiber strengthqFS.LX-RIL_ch01.14LQ.1Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TM361TM361Gossypium hirsutummarker_locus


Libraries
Library NameType
NAU_CottonSNP80KSNP_chip
Contact
NameDetails
Guo, Wang-Zhen
First name:Wang-Zhen
Last name:Guo
Institution:Nanjing Agri Univ
Address:Weigang No.1, Nanjing, Jiangsu Prov 210095
Country:China
Email:moelab@njau.edu.cn
Phone:+086 25 84395311
Fax:+086 25 84395307
Keywords:Cotton Genomics
Last update:20-Sep-2011
Sequence
>NAU_TM00361 ID=NAU_TM00361|Name=NAU_TM00361|organism=Gossypium hirsutum|type=genetic_marker|length=125bp
CTCAAAGCTTGAGCTGGAAAAGCTATAAAATTGTCCGCCAGTTGGAATCA
CACCCTGCAA[A/G]TGATTATATGCCACGCTAAATTTTGACAAAAATGT
AAGCTCGGCAAATGACAGCGGAATT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1LMY28 x XLZ24, RIL (2018)LX-RIL_chr01N/AAD_chr.0122.65TM361View