NAU_TM00045, NAU_TM00045 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU_TM00045
AliasTM45
dbSNP IDN/A
SNP Array ID
NAU_CottonSNP80K:NAU_TM00045
TypeSNP
SNP AllelesT/C
5' Flanking SequenceCCCACGTTATAGTATTACTATAGTATTTAATTTCACCGCCATTATTATTTTTACACTAAT
3' Flanking SequenceGCAAATAAATGCACCACTCATCCAAAGGGGCCCTAAGGCCCTAATTATCTTTTTTGGTAA
SpeciesGossypium hirsutum
Publication[view all]
ContactGuo, Wang-Zhen
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TM45TM45-8.4Gossypium hirsutummarker_locus


Libraries
Library NameType
NAU_CottonSNP80KSNP_chip
Contact
NameDetails
Guo, Wang-Zhen
First name:Wang-Zhen
Last name:Guo
Institution:Nanjing Agri Univ
Address:Weigang No.1, Nanjing, Jiangsu Prov 210095
Country:China
Email:moelab@njau.edu.cn
Phone:+086 25 84395311
Fax:+086 25 84395307
Keywords:Cotton Genomics
Last update:20-Sep-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold2140.1supercontigscaffold2140.1:31031..31151 +
At_chr9chromosomeAt_chr9:83594363..83594483 +
A01chromosomeA01:1277391..1277511 +
Ghir_A01chromosomeGhir_A01:1819268..1819388 +
A01chromosomeA01:1771175..1771295 +
A01chromosomeA01:1839038..1839158 +
A01chromosomeA01:1804434..1804554 +
CM017636.1chromosomeCM017636.1:1618820..1618939 +
Sequence
>NAU_TM00045 ID=NAU_TM00045|Name=NAU_TM00045|organism=Gossypium hirsutum|type=genetic_marker|length=125bp
CCCACGTTATAGTATTACTATAGTATTTAATTTCACCGCCATTATTATTT
TTACACTAAT[C/T]GCAAATAAATGCACCACTCATCCAAAGGGGCCCTA
AGGCCCTAATTATCTTTTTTGGTAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x Acala Maxxa, RIL (2018)YAM-RIL-2018_chr01N/AAD_chr.018.4TM45View