CSIRO_D5chr03_3637034 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCSIRO_D5chr03_3637034
AliasChr03_3637034
Chr03_3637033
dbSNP IDN/A
TypeSNP
SNP AllelesC/A
5' Flanking SequenceGGTAAAACAGCTGAACATCTTCTCAAGAGCAGAAGACAGTTCCTGATATGTAGAATAAGT TCTCAAATCTACCTTCCTCAGATAAGGAGCTCCGTCCATA
3' Flanking SequenceTGACCTTGACAAAAAGAGCACCAGGACCGGGCTTTCCATCAACTTCATCATTGTTCTTTG AAGAAGCAGCCAGCGTTTTAGTCCTAAATGGTCTTATTGG
SpeciesGossypium hirsutum
GermplasmNamcala
Sicala 40
Sicot 81
Sicala V-2
Sicot 71
Sicala 3-2
Lu Mian 14
Deltapine 90
Coker 315
Tamcot SP37
Delta Opal
Sicot 70
Sicot 189
Siokra 1-4
Riverina Paplar
Deltapine 16
VIR-6615
Source TypeRNA-seq
Publication[view all]
ContactZhu, Qian-Hao
Wilson, Iain
CommentData obtained 2014. SNP location is based on D5 JGI 221 position
Data obtained 2014. SNP location is based on D5 JGI 221 position. In the published map, the D5-pos in the name was 1 bp diff from its exactness.
Germplasm
Stock NameType
Namcalacultivar
Sicala 40cultivar
Sicot 81cultivar
Sicala V-2cultivar
Sicot 71cultivar
Sicala 3-2cultivar
Lu Mian 14cultivar
Deltapine 90obsolete_cultivar
Coker 315cultivar
Tamcot SP37cultivar
Delta Opalcultivar
Sicot 70cultivar
Sicot 189cultivar
Siokra 1-4TBD
Riverina PaplarTBD
Deltapine 16obsolete_cultivar
VIR-6615breeding_germplasm
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Chr03_3637033Chr03_3637033Gossypium hirsutummarker_locus


Contact
NameDetails
Zhu, Qian-Hao
First name:Qian-Hao
Last name:Zhu
Title:Research Scientist
Institution:CSIRO
Address:CSIRO Plant Industry, GPO Box 1600, Canberra, ACT 2601,
Country:Australia
Email:Qianhao.Zhu@csiro.au
Phone:61 2 62464903
Last update:24-Aug-2014
Wilson, Iain
Description:SNPs; Disease resistance
First name:Iain
Last name:Wilson
Title:Senior Scientist
Institution:CSIRO
Address:Black Mountain Laboratories Clunies Ross Street, Black Mountain, ACT 2601
Country:Australia
Email:iain.wilson@csiro.au
Phone:+61 (0)2 62465211
Last update:28-Feb-2010
Sequence
>CSIRO_D5chr03_3637034 ID=CSIRO_D5chr03_3637034|Name=CSIRO_D5chr03_3637034|organism=Gossypium hirsutum|type=genetic_marker|length=205bp
GGTAAAACAGCTGAACATCTTCTCAAGAGCAGAAGACAGTTCCTGATATG
TAGAATAAGTTCTCAAATCTACCTTCCTCAGATAAGGAGCTCCGTCCATA
[C/A]TGACCTTGACAAAAAGAGCACCAGGACCGGGCTTTCCATCAACTT
CATCATTGTTCTTTGAAGAAGCAGCCAGCGTTTTAGTCCTAAATGGTCTT
ATTGG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1MCU-5 x Siokra 1-4, RIL (2015 SNP)MS-RIL_C02_LG05N/AAD_chr.0214.53Chr03_3637033View