CSIRO_D5chr02_60693125 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCSIRO_D5chr02_60693125
AliasChr02_60693125
i14752Gh
dbSNP IDN/A
SNP Array ID
TAMU_CottonSNP63K:i14752Gh
TypeSNP
SNP AllelesC/T
5' Flanking SequenceTATGCTAGTATTTTGTATTTGTTGATGTTTGTTAATATAGTATAAATCGGTAATTTATGG TTCATTTTTTATTTACAGATACTGAGTCTGAAGAGGATCT
3' Flanking SequenceCCTGAACCTACAATGAATCTTGTAAAGTCAGAGCCTGCAGCATCTGATCCTACTACGACA AAGCAGGTTAAGATTGTTGAACCTAAAAAAGACGACGATA
SpeciesGossypium hirsutum
GermplasmNamcala
Sicala 40
Sicot 81
Sicala V-2
Sicot 71
Sicala 3-2
Lu Mian 14
Deltapine 90
Coker 315
Tamcot SP37
Delta Opal
Sicot 70
Sicot 189
Siokra 1-4
Riverina Paplar
Deltapine 16
VIR-6615
Source TypeRNA-seq
Publication[view all]
ContactZhu, Qian-Hao
Wilson, Iain
Stelly, David M.
CommentData obtained 2014. SNP location is based on D5 JGI 221 position
Germplasm
Stock NameType
Namcalacultivar
Sicala 40cultivar
Sicot 81cultivar
Sicala V-2cultivar
Sicot 71cultivar
Sicala 3-2cultivar
Lu Mian 14cultivar
Deltapine 90obsolete_cultivar
Coker 315cultivar
Tamcot SP37cultivar
Delta Opalcultivar
Sicot 70cultivar
Sicot 189cultivar
Siokra 1-4TBD
Riverina PaplarTBD
Deltapine 16obsolete_cultivar
VIR-6615breeding_germplasm
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNPi14752GhSNPi14752GhGossypium hirsutummarker_locus
i14752Ghi14752Gh-15.4Gossypium hirsutummarker_locus


Libraries
Library NameType
TAMU_CottonSNP63KSNP_chip
Contact
NameDetails
Zhu, Qian-Hao
First name:Qian-Hao
Last name:Zhu
Title:Research Scientist
Institution:CSIRO
Address:CSIRO Plant Industry, GPO Box 1600, Canberra, ACT 2601,
Country:Australia
Email:Qianhao.Zhu@csiro.au
Phone:61 2 62464903
Last update:24-Aug-2014
Wilson, Iain
Description:SNPs; Disease resistance
First name:Iain
Last name:Wilson
Title:Senior Scientist
Institution:CSIRO
Address:Black Mountain Laboratories Clunies Ross Street, Black Mountain, ACT 2601
Country:Australia
Email:iain.wilson@csiro.au
Phone:+61 (0)2 62465211
Last update:28-Feb-2010
Stelly, David M.
Description:Integrative structural genomics; Cytogenetics; Genetics; Cytogenomics; Radiation hybrid mapping; Chromosome manipulations. ; Wide-cross introgression.; QTL definition. ; Reproductive cytology, genetics and manipulations. ; Fiber cell initiation.
First name:David
Last name:Stelly
Title:Professor
Institution:Texas A&M University
Address:370 Olsen Blvd. , Dept. Soil & Crop Sci., TAMU, College Station, TX 77843-2474
Country:United States
Email:stelly@tamu.edu
Phone:+1 979 845 2745
Fax:+1 979 845 0456
Last update:19-Feb-2007
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr02chromosomeChr02:60693125..60693125 .
D5_01chromosomeD5_01:54536123..54536324 +
scaffold294supercontigscaffold294:447177..447377 -
D10_01chromosomeD10_01:2047306..2047506 -
D10_01chromosomeD10_01:2035265..2035464 -
Sequence
>CSIRO_D5chr02_60693125 ID=CSIRO_D5chr02_60693125|Name=CSIRO_D5chr02_60693125|organism=Gossypium hirsutum|type=genetic_marker|length=205bp
TATGCTAGTATTTTGTATTTGTTGATGTTTGTTAATATAGTATAAATCGG
TAATTTATGGTTCATTTTTTATTTACAGATACTGAGTCTGAAGAGGATCT
[C/T]CCTGAACCTACAATGAATCTTGTAAAGTCAGAGCCTGCAGCATCT
GATCCTACTACGACAAAGCAGGTTAAGATTGTTGAACCTAAAAAAGACGA
CGATA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Phytogen 72 x Stoneville 474, consbin (2017)PS-consbin_ch01N/AAD_chr.0117.82SNPi14752Gh
2Phytogen 72 x Stoneville 474, F2 (2015 SNP)PS-F2_c01N/AAD_chr.0115.4i14752Gh