NAU_RAD_A01_4828004, NAU_RAD_A01_4828004 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU_RAD_A01_4828004
Genbank IDN/A
TypeRAD
SpeciesGossypium hirsutum
Restriction EnzymeEcoR-I; Bfa-I
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
A01_4828004A01_4828004Gossypium hirsutummarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D01chromosomeD01:4021162..4021466 -
D01chromosomeD01:4126003..4126307 -
D01chromosomeD01:56556105..56556408 -
D01chromosomeD01:4042393..4042694 -
D01chromosomeD01:4090324..4090625 -
A01chromosomeA01:5429901..5430201 -
A01chromosomeA01:5340600..5340904 -
A01chromosomeA01:5379716..5380020 -
A01chromosomeA01:5470487..5470779 -
CM018215.1chromosomeCM018215.1:3902171..3902476 +
CM018215.1chromosomeCM018215.1:4132382..4132686 -
CM018215.1chromosomeCM018215.1:4153638..4153939 -
CM018202.1chromosomeCM018202.1:4582054..4582358 -
CM018202.1chromosomeCM018202.1:4501441..4501745 -
CM018202.1chromosomeCM018202.1:4535600..4535904 -
CM018202.1chromosomeCM018202.1:4617585..4617877 -
D5_01chromosomeD5_01:3781829..3782132 +
D5_01chromosomeD5_01:3972505..3972809 -
D5_01chromosomeD5_01:3987988..3988289 -
KI_13chromosomeKI_13:19522324..19522628 -
KI_01chromosomeKI_01:3415921..3416226 -
KI_01chromosomeKI_01:3435284..3435588 -
Chr7chromosomeChr7:20917521..20917825 +
Chr7chromosomeChr7:20755045..20755352 +
Chr7chromosomeChr7:17664626..17664930 -
Chr7chromosomeChr7:17577574..17577866 -
Chr7chromosomeChr7:17623575..17623866 -
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:4932130..4932434 -
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:4773474..4773781 -
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:5145664..5145968 -
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:5104239..5104530 -
Chr2chromosomeChr2:34000801..34001105 +
Chr2chromosomeChr2:33985534..33985835 +
Chr2chromosomeChr2:34202837..34203141 -
D10_01chromosomeD10_01:56597682..56597984 +
D10_01chromosomeD10_01:56564424..56564729 +
D10_01chromosomeD10_01:7295518..7295821 +
CM016614.1chromosomeCM016614.1:6089195..6089499 -
CM016614.1chromosomeCM016614.1:6348099..6348403 -
CM016614.1chromosomeCM016614.1:5883573..5883877 -
CM016614.1chromosomeCM016614.1:6345260..6345564 -
CM016614.1chromosomeCM016614.1:6015258..6015562 -
CM016614.1chromosomeCM016614.1:6017494..6017798 -
CM016614.1chromosomeCM016614.1:5923578..5923882 -
CM016614.1chromosomeCM016614.1:5752994..5753298 -
CM016614.1chromosomeCM016614.1:6162663..6162967 -
CM016614.1chromosomeCM016614.1:6381348..6381640 -
CM016614.1chromosomeCM016614.1:5781246..5781485 -
scaffold235.1supercontigscaffold235.1:1055797..1056101 +
scaffold235.1supercontigscaffold235.1:1160432..1160736 +
scaffold235.1supercontigscaffold235.1:1139174..1139475 +
scaffold235.1supercontigscaffold235.1:1091480..1091781 +
Dt_chr2chromosomeDt_chr2:11210325..11210628 +
scaffold2385.1supercontigscaffold2385.1:99316..99616 -
scaffold2385.1supercontigscaffold2385.1:49835..50139 -
scaffold2385.1supercontigscaffold2385.1:143874..144166 -
scaffold12428.1supercontigscaffold12428.1:1528..1832 -
scaffold50805supercontigscaffold50805:4..307 +
scaffold4820supercontigscaffold4820:17146..17450 -
scaffold4820supercontigscaffold4820:13611..14196 -
D01chromosomeD01:3848523..3848827 -
D01chromosomeD01:3869161..3869462 -
D01chromosomeD01:3916660..3916961 -
A01chromosomeA01:4276502..4276802 -
A01chromosomeA01:4190760..4191064 -
A01chromosomeA01:4228405..4228709 -
A01chromosomeA01:4315440..4315732 -
Ghir_D01chromosomeGhir_D01:4381350..4381654 -
Ghir_D01chromosomeGhir_D01:4486025..4486329 -
Ghir_D01chromosomeGhir_D01:55531098..55531401 -
Ghir_D01chromosomeGhir_D01:4402552..4402853 -
Ghir_D01chromosomeGhir_D01:4450395..4450696 -
Ghir_A01chromosomeGhir_A01:4745184..4745484 -
Ghir_A01chromosomeGhir_A01:4655960..4656264 -
Ghir_A01chromosomeGhir_A01:4695052..4695356 -
Ghir_A01chromosomeGhir_A01:4785723..4786015 -
D01chromosomeD01:4119525..4119829 -
D01chromosomeD01:4228279..4228583 -
D01chromosomeD01:57227192..57227495 -
D01chromosomeD01:4138872..4139173 -
D01chromosomeD01:4184665..4184966 -
A01chromosomeA01:4502848..4503148 -
A01chromosomeA01:4412466..4412770 -
A01chromosomeA01:4454512..4454816 -
A01chromosomeA01:4542001..4542293 -
D01chromosomeD01:4109541..4109845 -
D01chromosomeD01:4214352..4214656 -
D01chromosomeD01:56941241..56941544 -
D01chromosomeD01:4130767..4131068 -
D01chromosomeD01:4178682..4178983 -
A01chromosomeA01:4745596..4745896 -
A01chromosomeA01:4656302..4656606 -
A01chromosomeA01:4695413..4695717 -
A01chromosomeA01:4786116..4786408 -
D01chromosomeD01:4237143..4237447 -
D01chromosomeD01:4341999..4342303 -
D01chromosomeD01:54179829..54180132 -
D01chromosomeD01:4258386..4258687 -
D01chromosomeD01:4306319..4306620 -
A01chromosomeA01:4692396..4692696 -
A01chromosomeA01:4603087..4603391 -
scaffold50805supercontigNAU_RAD_A01_4828004:1..300 .
scaffold50805:4..307 +
scaffold4820supercontigNAU_RAD_A01_4828004:1..301 .
scaffold4820:17146..17450 -
scaffold4820supercontigNAU_RAD_A01_4828004:1..295 .
scaffold4820:13611..14196 -
D01chromosomeNAU_RAD_A01_4828004:1..301 .
D01:3848523..3848827 -
D01chromosomeNAU_RAD_A01_4828004:1..295 .
D01:3869161..3869462 -
D01chromosomeNAU_RAD_A01_4828004:1..298 .
D01:3916660..3916961 -
A01chromosomeNAU_RAD_A01_4828004:1..301 .
A01:4276502..4276802 -
A01chromosomeNAU_RAD_A01_4828004:1..301 .
A01:4190760..4191064 -
A01chromosomeNAU_RAD_A01_4828004:1..301 .
A01:4228405..4228709 -
A01chromosomeNAU_RAD_A01_4828004:1..301 .
A01:4315440..4315732 -
Sequence
>NAU_RAD_A01_4828004 ID=NAU_RAD_A01_4828004|Name=NAU_RAD_A01_4828004|organism=Gossypium hirsutum|type=genetic_marker|length=301bp
TCATGTGAGAACTTGAAGCAAATAATTGGAAATGATGACATTTTAGCATC
TTCATCATCATCACAAGATCCTCAGTCGGAGATGAAAATGGTATTCCCTC
GGTTAAAGCAAATACTACTTCAAAACTTGTCAAAGCTCGAGAGTTTCAGC
CCTCTGCTTTATCATCTGGAATTCCCGTGTTTGGATTTGCTTGACATTAA
GCAATGTTCCAAGATGATCACAAGTTTCAGTGCAGATTATTTAACGTTGA
CTGTGCATGCTAAAACTGATCAGGTATCCTCCCAACACTCTTTTACTTGA
G
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Prema x 86-1, RIL (2015)P8-RIL_chr01.1N/AAD_chr.0126.34A01_4828004View