TMB2386, TMB2386 (genetic_marker) Gossypium hirsutum

Marker Overview
NameTMB2386
AliasTMB200-1-M9
Genbank IDBV679753
TypeSSR
SpeciesGossypium hirsutum
GermplasmTM-1
Source SequenceBV679753.1
Source Typegenomic
Repeat Motif(TTA)10
PCR ConditionAnnealing temperature: 55
Primer 1TMB2386_F: GAAGAGTCGAAATAAAAATACCACAA
Primer 2TMB2386_R: ACGGTGCAAACAGGTGAAGT
Product Length152
ContactYu, John Z. (Zhi-Hong)
CommentPrimer data obtained in 2005-10
Germplasm
Stock NameType
TM-1breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBV679753
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TMB2386_FTMB2386_FGossypium hirsutumprimer
TMB2386_RTMB2386_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber uniformityqFU.GG-RIL_ch02-2.hd12-bc.1Gossypium hirsutumQTL
fiber uniformityqFU.GG-RIL_ch02-2.hd12Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TMB2386aTMB2386aGossypium hirsutummarker_locus
TMB2386cTMB2386cGossypium hirsutummarker_locus
TMB2386bTMB2386bGossypium hirsutummarker_locus
tmb2386tmb2386Gossypium hirsutummarker_locus
TMB2386TMB2386-91.391Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BV679753.1BV679753.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Yu, John Z. (Zhi-Hong)
Description:Cotton molecular genetics and genomics including integrative genome mapping and QTL identification from the Gossypium germplasm.
First name:John
Last name:Yu
Title:Research Geneticist
Institution:USDA-ARS
Address:2765 F&B Road, College Station, Texas 77845
Country:United States
Email:zyu@qutun.tamu.edu
Phone:1-979-260-9237
Fax:1-979-260-9333
Keywords:Cotton Molecular Genetics
Last update:6-Sep-2007
Sequence
>TMB2386 ID=TMB2386|Name=TMB2386|organism=Gossypium hirsutum|type=genetic_marker|length=152bp
GAAGAGTCGAAATAAAAATACCACAAAGTTAAAAAAGGTAACATTTTATT
GTTTATTGTTTATTATTATTATTATTATTATTATTATTATTTTGATTTTT
CTCTTTTTGAAACAAAAAATAAAAAAGGAGAAACTTCACCTGTTTGCACC
GT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr02N/AAD_chr.0251.47TMB2386aView
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr14N/AAD_chr.1492.42TMB2386cView
3Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr24N/AAD_chr.2479.92TMB2386bView
4Emian-22 x 3-79, BC1 (2015)E3-BC1-2015_chr24N/AAD_chr.24187TMB2386bView
5TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c02N/AAD_chr.0289.84tmb2386View
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr02N/AAD_chr.02162tmb2386View
7TM-1 x 3-79, RIL (2014)T3-RIL.14_chr02N/AAD_chr.0291.4tmb2386View
8GX1135 x GX100-2, F2 (2013)GG-F2_chr02-1N/AAD_chr.0228.9tmb2386View
9GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr02-2N/AAD_chr.0253.9tmb2386View
10GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr02-2N/AAD_chr.0253.9tmb2386View
11CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr02N/AAt.0258.6tmb2386View
12CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr14N/ADt.0224.7tmb2386View
13TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.02N/AAD_chr.0291.39TMB2386View