TMB0598, TMB0598 (genetic_marker) Gossypium hirsutum

Marker Overview
NameTMB0598
AliasTMN07
Genbank IDBV679389
TypeSSR
SpeciesGossypium hirsutum
GermplasmTM-1
Source SequenceBV679389.1
Source Typegenomic
Repeat Motif(GAA)10
PCR ConditionAnnealing temperature: 55
Primer 1TMB0598_F: TGAGCATATTCTTGCAAACGA
Primer 2TMB0598_R: AACCTGCTGCAAGCAAAGAG
Product Length200
ContactYu, John Z. (Zhi-Hong)
CommentPrimer data obtained in 2005-10
Germplasm
Stock NameType
TM-1breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBV679389
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TMB0598_FTMB0598_FGossypium hirsutumprimer
TMB0598_RTMB0598_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TMHN07TMHN07Gossypium hirsutummarker_locus
tmb0598tmb0598Gossypium hirsutummarker_locus
TMN07-200TMN07-200Gossypium hirsutummarker_locus
TMN07-260TMN07-260Gossypium hirsutummarker_locus
TMN07-320TMN07-320Gossypium hirsutummarker_locus
TMN07-240TMN07-240Gossypium hirsutummarker_locus
TMN07TMN07Gossypium hirsutummarker_locus
TMB0598TMB0598-39.56Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BV679389.1BV679389.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Yu, John Z. (Zhi-Hong)
Description:Cotton molecular genetics and genomics including integrative genome mapping and QTL identification from the Gossypium germplasm.
First name:John
Last name:Yu
Title:Research Geneticist
Institution:USDA-ARS
Address:2765 F&B Road, College Station, Texas 77845
Country:United States
Email:zyu@qutun.tamu.edu
Phone:1-979-260-9237
Fax:1-979-260-9333
Keywords:Cotton Molecular Genetics
Last update:6-Sep-2007
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D09chromosomeD09:25953312..25953511 +
A09chromosomeA09:45400866..45401058 +
CM018223.1chromosomeCM018223.1:23837932..23838129 +
D5_09chromosomeD5_09:18661939..18662135 +
Chr2chromosomeChr2:62134538..62134732 +
Chr09_CRI-A2_v1.0.a1chromosomeChr09_CRI-A2_v1.0.a1:48491258..48491451 +
Chr6chromosomeChr6:15448928..15449125 -
D10_09chromosomeD10_09:25424301..25424470 -
Dt_chr8chromosomeDt_chr8:33664467..33664666 +
D09chromosomeD09:24810005..24810204 +
A09chromosomeA09:40686374..40686566 +
Ghir_D09chromosomeGhir_D09:25861935..25862134 +
Ghir_A09chromosomeGhir_A09:45553773..45553965 +
D09chromosomeD09:25745487..25745686 +
A09chromosomeA09:47678751..47678943 +
D09chromosomeD09:25390348..25390547 +
A09chromosomeA09:46985127..46985319 +
D09chromosomeD09:23757900..23758099 +
A09chromosomeA09:43978396..43978588 +
At09chromosomeAt09:41680972..41681164 +
scaffold15708supercontigscaffold15708:53897..54089 +
scaffold12745supercontigscaffold12745:97583..97780 -
Gbar_D09chromosomeGbar_D09:24436903..24437100 +
Gbar_A09chromosomeGbar_A09:42547393..42547585 +
D09chromosomeD09:27310786..27310983 +
A09chromosomeA09:43678941..43679133 +
CM017631.1chromosomeCM017631.1:24838263..24838466 +
CM017618.1chromosomeCM017618.1:43040021..43040213 +
CM017657.1chromosomeCM017657.1:25898239..25898436 +
CM017644.1chromosomeCM017644.1:45723378..45723571 +
CM017709.1chromosomeCM017709.1:25316948..25317145 +
CM017696.1chromosomeCM017696.1:43481567..43481756 +
Sequence
>TMB0598 ID=TMB0598|Name=TMB0598|organism=Gossypium hirsutum|type=genetic_marker|length=200bp
TGAGCATATTCTTGCAAACGAGTTTTATGCAACAAGTGCTCTGGCAATCC
TAAACAAATCAATCAAATCCCACATCCATTACTAATAATATATTTTTTAT
TTACAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAACCTATGAAAATATT
GACAAACCTTTAGTCATGGTCATGCTTTTTCTCTTTGCTTGCAGCAGGTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr23N/AAD_chr.23116.4TMHN07View
2Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg12/chr23N/AAD_chr.23134.3TMHN07View
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr23N/AAD_chr.2366tmb0598View
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr26N/AAD_chr.2648tmb0598View
5TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c23N/AAD_chr.23104.43tmb0598View
6TM-1 x 3-79, RIL (2014)T3-RIL.14_chr23N/AAD_chr.2339.6tmb0598View
7TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr23N/AAD_chr.2354.2TMN07-200View
8TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr23/D9N/AAD_chr.2354.29TMN07-200View
9Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr26.2N/AAD_chr.2684.3TMN07-260View
10Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr26.2N/AAD_chr.2693TMN07-320View
11Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr26.2N/AAD_chr.2699.7TMN07-240View
1260182 x Jun Mian 1, F2:3 (2007)6J-F2:3_chr23N/AAD_chr.2335.6TMN07View
13TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr23N/AAD_chr.2381.8TMN07View
14TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.23N/AAD_chr.2339.56TMB0598View